the structural and biochemical hierarchy of a cell and a human

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, a large amount of the available surface area of the molecule is buried upon pentamerization, increasing the stability of the ... cloning site The forward oligomer 5¢-TCCGAAACCAGCGGCCGCTT TATCGCGTTAAAACCGGTGATCAAACCCC-3¢ and the reverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAA AGTGCGGCTCGAT-3¢ were used to introduce a Not1 site ... the resulting gene was removed using the complementary oligomers 5¢-GGCGGGAGGGGCGATAATTTTATCGCGTTAAAA CCG-3¢ (forward) and 5¢-CGGTTTTAACGCGATAAAAT TATCGCCCCTCCCGCC-3¢ (reverse) Virus ampliﬁcation...

10
647
0

Báo cáo Y học: Molecular and biochemical characteristics of a gene encoding an alcohol acyl-transferase involved in the generation of aroma volatile esters during melon ripening pptx

Danh mục: Báo cáo khoa học

... each primer 50 lM CM-AAT1 was ampliﬁed by using RSB-5¢: 5¢-CAAAGAGCACCCTCATTCCAGCC-3¢, and FSD-3¢: 5¢-AGGAGGCAAGCATAGACTTAACG-3¢; CM-AAT2 was ampliﬁed with RSB-5¢ and FSA-3¢: 5¢-GATAATT CCACACCCTCCAATTA-3¢; ... the same activity CM-AAT1 is capable of transferring acyl residues into a variety of alcohols and CM-AAT2 is inactive towards the same substrates CM-AAT1 has the same enzyme activity as a strawberry ... of the same family RESULTS AND DISCUSSION Sequence analysis Both CM-AAT1 and CM-AAT2 encode proteins of 461 amino acids with a theoretical molecular mass of 51.5 kDa and 51.8 and a pI of and 8.5,...

8
509
0

Tài liệu Báo cáo khoa học: The role in the substrate speciﬁcity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx

Danh mục: Báo cáo khoa học

... accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg ctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A, 5¢-ggacaa ctttgaatgggcggagggttatattgag-3¢ The incorporation of mutations was veriﬁed by DNA ... E19 0A, 5¢-caacgagcctagagcgatttgctttgagg-3¢; mutation E190Q, 5¢-caa cgagcctagacagatttgctttgagg-3¢; mutation E19 4A, 5¢-gagagattt gctttgcgggttatggatctgc-3¢; mutation K20 1A, 5¢-gttatggatctgct accgcggctccgatcctaaacg-3¢; ... Journal compilation ª 2008 FEBS L M F Mendonca and S R Marana ¸ Following the characterization of the binding of different types of aglycone, a comparative analysis of the mutational effect on their...

12
731
0

Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx

Danh mục: Báo cáo khoa học

... turn, alter the catalytic activity of the complex The mutation could also affect the binding of the ISP to the bc1 complex and distort the Qo site Our data showed that, in the mutant, the bc1 activity ... Instability of the mutant enzyme Further analysis of the kinetic parameters of the G167E mutant was hindered by rapid inhibition of the activity of Fig QH2-cytochrome c reductase activity The assays ... Medical School, Hanover, NH, USA) Fig Optical spectra of the wild type and mutant cells Optical spectra of cell suspensions of the wild type (wt) and mutant (G167E) were obtained as described in the...

7
498
0

Báo cáo Y học: Puriﬁcation, crystallization, NMR spectroscopy and biochemical analyses of a-phycoerythrocyanin peptides pptx

Danh mục: Báo cáo khoa học

... 2400 VÆh)1 at a constant power of 18 W, at 10 °C and continuous buffer circulation in a DESAGA VA-200 apparatus (DESAGA, Germany) After separation, the protein bands were cut out and the gel slices ... For clarity, only the two important regions (NH and aliphatic) of the spectra are presented The main differences between the spectral data of the E- and Z-conﬁgurations are emphasized by the E/Z-difference ... are marked by arrows and the integrated protein peaks are labeled by arrowheads Z-conﬁguration are resolved in the aliphatic region of the difference spectrum Because of the height and the sharpness...

10
452
1

Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc

Danh mục: Báo cáo khoa học

... tracheobronchial tree, nasal mucosa and sweat glands [25] Human tear lipocalin has signiﬁcant sequence homology with the human forms of OBP and, at least in humans, partially shares a similar tissue ... to the same family It is produced by the lachrymal and lingual salivary glands, and has been found to be expressed by several other secretory tissues such as prostate, mucosal glands of the tracheobronchial ... where they are inactivated Hence, this mechanism might be considered as an extracellular counterpart of the chemical inactivation of HNE that occurs intracellularly via GST and other enzymes that...

12
386
0

Báo cáo khoa học: The heterogeneity of mast cell tryptase from human lung and skin Differences in size, charge and substrate afﬁnity ppt

Danh mục: Báo cáo khoa học

... antibody AA5 The action of four separate isolates of tryptase (L1 and L2 from lung and S1 and S2 from skin) was tested on a range of substrates, each at 0.50 mM, and compared with the standard assay ... yielding the input value of Km as Km and a weighted average of the input values of kcat as the computed value of kcat (case of Fig 8A) If each form had a different value of Km, however, although the ... we have puried tryptase from both lung and skin tissues, and have compared the kinetics of cleavage of a range of chromogenic substrates Materials and methods Isolation of lung mast cells Human...

14
438
0

báo cáo hóa học:" Lentivirus-mediated RNAi silencing targeting ABCC2 increasing the sensitivity of a human nasopharyngeal carcinoma cell line against cisplatin" docx

Danh mục: Hóa học - Dầu khí

... 5.0 software were as follow: ABCC2 forward: 5'-CTC ACTTCAGCGAGACCG-3'; ABCC2 reverse: 5'-CCAGCCAGTTCAGGGTTT-3'; ACTB forward: 5'-CACCCAGCACAATGAAGAT-3'; ACTB reverse: 5'-CA AATAAAGCCATGCCAAT-3' ... procedures and in the interpretation of the data, SXW, XL, TFL and WBX gave advises on the work and helped in the interpretation of the data, KTY supervised all the work and wrote the paper together ... Wada M, Kohno K, Nakamura T, Kawabe T, Kawakami M, Kagotani K, Okumura K, Akiyama S, Kuwano M: A human canalicular multispecific organic anion transporter (cMOAT) gene is overexpressed in cisplatin-resistant...

9
509
0

báo cáo hóa học:" The effect of abductor muscle and anterior-posterior hip contact load simulation on the in-vitro primary stability of a cementless hip stem" ppt

Danh mục: Hóa học - Dầu khí

... primarily along and about the implant axis Distal migration accounted for 94 to 99% of the total translational migration The average absolute rotational migration was smaller than 0.04° in the sagittal ... performed the design and execution of the experimental setup and analysis, as well as drafted the manuscript CA executed and analyzed the experiment, performed statistical analsys as well as drafted the ... motion of a triangular plate that was rigidly attached to the lateral surface of the implant through a hole in the cortex The implant motion was calculated from the motion of the triangle using a...

14
400
0

Báo cáo toán học: " The structural and optical properties of GaSb/InGaAs type- quantum dots grown on InP (100) substrate" ppt

Danh mục: Toán học

... such as GaSb/GaAs [8-10], InAlAs/InP [11], InP/InGaP [12, 13], InP/GaAs [14], GaAsSb/GaAs [15], and InAs/GaSb [16, 17] The reason is that they offer comparatively large bandgap energies and provide ... in Figure 1a, the statistical data indicate that the density of the QDs is approximately × 109 cm−2 and that the shape of GaSb QDs is rectangular-shaped which is the same with GaSb/GaAs QDs [9] ... (100) substrate, the AFM and STEM measurements were carried out Figure shows the AFM and STEM images of GaSb/In0.53Ga0.47As QDs and the histogram of the height of GaSb/In0.53Ga0.47As QDs As shown...

12
579
0

Báo cáo hóa học: " Effect of the Nd content on the structural and photoluminescence properties of silicon-rich silicon dioxide thin film" pdf

Danh mục: Hóa học - Dầu khí

... located above a broad band Figure Evolutions of the positions of the LO3 and TO3 peaks, and the LO3/TO3 intensity ratio, as a function of the annealing temperature Debieu et al Nanoscale Research ... explained by the increase of the Si-np density as well as the increase of non-radiative de-excitation channels of both Si-np and Nd3+ The Nd3 + PL intensity is then maximal after annealing at ... generally admitted as the optimal annealing temperature for the PL of Si-np Figure shows the behavior of the PL spectra of the thin films annealed at 1100 °C as a function of the Nd concentration...

8
474
0

báo cáo hóa học:" The structural and optical properties of GaSb/InGaAs type-II quantum dots grown on InP (100) substrate" docx

Danh mục: Hóa học - Dầu khí

... images of GaSb/In0.53Ga0.47As QDs and histogram of the height of GaSb/In0.53Ga0.47As QDs (a) The AFM image of GaSb/In0.53Ga0.47As QDs, (b) histogram of the height of GaSb/In0.53Ga0.47As QDs, and ... Ga 0.47 As QDs As shown in Figure 1a, the statistical data indicate that the density of the QDs is approximately × 109 cm-2 and that the shape of GaSb QDs is rectangular-shaped which is the same ... GaSb/InGaAs QDs on InP (100) substrate, the AFM and STEM measurements were carried out Figure shows the AFM and STEM images of GaSb/ In0.53Ga0.47 As QDs and the histogram of the height of GaSb/In...

6
451
0

Báo cáo hóa học: " The structural and optical properties of GaSb/InGaAs type-II quantum dots grown on InP (100) substrate" ppt

Danh mục: Hóa học - Dầu khí

... images of GaSb/In0.53Ga0.47As QDs and histogram of the height of GaSb/In0.53Ga0.47As QDs (a) The AFM image of GaSb/In0.53Ga0.47As QDs, (b) histogram of the height of GaSb/In0.53Ga0.47As QDs, and ... Ga 0.47 As QDs As shown in Figure 1a, the statistical data indicate that the density of the QDs is approximately × 109 cm-2 and that the shape of GaSb QDs is rectangular-shaped which is the same ... GaSb/InGaAs QDs on InP (100) substrate, the AFM and STEM measurements were carried out Figure shows the AFM and STEM images of GaSb/ In0.53Ga0.47 As QDs and the histogram of the height of GaSb/In...

6
360
0

Báo cáo hóa học: "Inﬂuence of Rare Earth Doping on the Structural and Catalytic Properties of Nanostructured Tin Oxide" docx

Danh mục: Hóa học - Dầu khí

... For the synthesis of the rare earth-doped SnO2 samples, an aqueous solution of a rare earth citrate was prepared from a rare earth nitrate (Y and Ce-nitrates, Alfa Aesar, USA, purity [99.9%) and ... h, also in air, to allow the organic material to be completely oxidized and to promote the crystallization of the SnO2 phase Sample Characterization The speciﬁc surface area of the samples was ... was then fed to the reactor containing 150 mg of the catalyst The reactants and the composition of the reactor efﬂuent were analyzed with a gas chromatograph (Shimadzu GC 8A) , equipped with a...

6
421
1

Báo cáo y học: "SOX9 transduction of a human chondrocytic cell line identifies novel genes regulated in primary human chondrocytes and in osteoarthritis" docx

Danh mục: Báo cáo khoa học

... TAGAAAAGAGTTAGGTGTCACATTGAATAA SPINT1 CGAGTTGTTTCCTCGCTGATC GCAATGGAATTCAACATAAGCAAA CRTL1 TTCCACAAGCACAAACTTTACACAT GTGAAACTGAGTTTTGTATAACCTCTCAGT CRLF1 AACGGCCATAACAGCTCTGACT ACTCAACCAACCCTCACACACA ... ACGCCCTCGTGTACTCCTGTA TTCCACAAGCACAAACTTTACACAT S10 0A1 CCAGGAGTATGTGGTGCTTGTG ATGTGGCTGTCTGCTCAACTGT RGC32 GACAAAGACGTGCACTCAACCTT ACTGTCTAAATTGCCCAGAAATGG SRPX TGGCTGGTTGATTTTGTAGAGAAA TAGAAAAGAGTTAGGTGTCACATTGAATAA ... collected the normal and OA cartilage and produced the cDNA libraries from femoral cartilage CMR undertook the laboratory work associated with real time PCR analysis of the normal and OA cartilage...

10
387
0

Báo cáo sinh học: "Reducing the worst case running times of a family of RNA and CFG problems, using Valiant’s approach" pot

Danh mục: Báo cáo khoa học

... called a base-pair The notation a • b is used to denote that the bases at indices a and b in s are paired to each other A folding (or a secondary structure) of s is a set F of base-pairs of the ... than a base-pair in an RNA string Call a pair (A, F), where A is an alignment of an SAF instance S and F is a folding of A, an alignment with folding of S (Figure 17b) Define the score of an alignment ... accelerate the practical running times of different variants of CFG and RNA related algorithms Nevertheless, these techniques either retain the same worst case running times of the standard algorithms...

22
344
0

Báo cáo y học: "Mutations in matrix and SP1 repair the packaging specificity of a Human Immunodeficiency Virus Type 1 mutant by reducing the association of Gag with spliced viral RN" ppsx

Danh mục: Báo cáo khoa học

... Figure Characterization of the dimerization state and splicing of viral RNA (A) Dimerization analysis of virion RNA Virion RNAs of different proviral constructs were separated on a native agarose ... RNA in the SL1 deletion virion was replaced by host RNA and that the virion maintained an RNA level similar to that of wild type To characterize the cellular RNA packaged into the wildtype and ... mRNA compared to the wild type; 3- to 5-fold less HIV-1 mRNA was associated with the revertant Figure Characterization of the association between Gag and HIV-1 RNA (A) Measurement of the association...

12
300
0

studies of pathogenesis-related proteins in the strawberry plant partial purification of a chitinase-containing protein complex and analysis of an osmotin-like protein gene

Danh mục: Tiến sĩ

... plasma membrane component(s) of the fungal target and/ or destabilizing the fungal plasma membrane Abad et al (1996) demonstrated that tobacco osmotin could cause membrane leakage and dissipated ... chitinase or in a tobacco class I chitinase caused a great loss of activity (Andersen et al., 1997; Iseli-Gamboni et al., 1998) In addition, mutation of Tyr 123 of a Zea mays chitinase and a similar ... whereas thaumatin mainly has a basic surface in the cleft region The acidic residues involved in the formation of the acidic cleft are three aspartate residues and one glutamate residue, and they...

119
307
0

An investigation into the structural and semantic features of sentence types in english and vietnamese detergent product advertisements discourse

Danh mục: Tổng hợp

... out the similarities and differences of the two languages in terms of structures and semantics 1.2 AIMS AND OBJECTIVES 1.2.1 Aims of the study The study aims at analyzing the structures and semantics ... surfactants Detergent is any of a group of synthetic, organic, liquid or water-soluble cleaning agents that, unlike soap, are not prepared from fats and oils, are not inactivated by hard water, and ... can make our choices 12 Social role- helping increase productivity and raise the standard of living To the society, advertising can accelerate the growth of economy, and thus improve the standard...

26
603
0

Báo cáo khoa học: Exosites mediate the anti-inﬂammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx

Danh mục: Báo cáo khoa học

... placed in glass test tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according to local and national ethical guidelines Animal ... cytokine analysis (MCP-1, TNF -a, IL-6, IL-10, IL-1b) All animals were maintained and handled according to local and national ethical guidelines Statistical analysis Data are represented as means ± ... because it may form the basis of a drug acting in pathological situations involving the overexpression of TNF -a Materials and methods Preparation of rIris, mutant L33 9A and the cleaved forms of...

12
499
0