displaying the integer representations for parts of a date
Báo cáo sinh học: "Evaluation of the VP22 protein for enhancement of a DNA vaccine against anthrax" pptx
... (5' ACTCTAGCTAGCACGGCGCCAACCCGATCCAAGACA 3') and VP22 R8 (5' ATTGTCACGGTCTGGAACCGTAGGAGCAGCTGGACCTGGACCCTCGACGGGCCGTCTGGGGCGAGA 3') Additionally, the gene for PA63 was PCR amplified from pGPA using ... Construction of DNA vaccines The DNA vaccine pGPA contains the signal sequence for human plasminogen activator fused to the N-terminus of the gene for the 63 kDa fragment of PA [19] and was a kind ... we evaluate the potential of VP22 to enhance DNA vaccines against anthrax The spore-forming bacterium Bacillus anthracis causes the disease anthrax The current UK-licensed vaccine is an alum-precipitated...
- 9
- 331
- 0
Guidance on the teaching of writing skills INSET opportunities for teachers of a subjects across the curriculum at Key Stages 2 and 3 docx
... years, e.g Data Exchange Wales initiative (DEWi) data, information from primary schools via the transition plan, gender-specific data and the national core data set information Find school data ... learners of all ages and abilities as the classroom will be used by a range of classes In this case, there will need to be both generic material and class-specific space for the display of learners’ ... same advantages as those described above If they learn a skill through the medium of one language they can, in most cases, transfer that skill to their second language and can certainly talk about...
- 174
- 616
- 0
Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot
... H2SO4 and the absorbance was measured at 450 nm Quantification of each cytokine (in ngÆmL)1 for IFN-c and in pgÆmL)1 for IL-12p70) was performed based on the standard curve in each assay Preparation ... )76) of the mouse iNOS promoter plus the downstream 47 base pairs, designated NF-jBd (5¢-CAT GGG GAC TCT CCC TTT GGG AAC AGT TAT GCA AAA TAG CTC TGC AGA GCC TGG AGG GGT CGA-3¢) [12] and the IRF-1 ... (5¢-GGA AGC GAA AAT GAA ATT GAC T-3¢) were constructed as probes for EMSA The oligonucleotides were annealed and labeled with [32P]dCTP[aP] Binding reactions were performed (20 lL of the total volume)...
- 10
- 395
- 0
Providing detailed guidelines for implementation of a number of articles of the law on enterprise
... company chairman and the director (general director) in the case of a limited liability company; the chairman of the board of management and the director (general director) in the case of a shareholding ... company; all partners in the case of a partnership; and the owner in the case of a private enterprise shall be liable for the truthfulness and accuracy of the amount certified as legal capital ... stipulated in the company charter shall apply Unless otherwise stipulated in the company charter, the chairman of the members’ council, the company chairman, the chairman of the board of management...
- 28
- 630
- 0
Báo cáo sinh học: " Integral representations for solutions of some BVPs for the Lame'''' system in multiply connected domains" pot
... University of Basilicata, V.le dell’Ateneo Lucano, 10, Campus of Macchia Romana, 85100 Potenza, Italy Email: Alberto Cialdea∗ - cialdea@email.it; Vita Leonessa - vita.leonessa@unibas.it; Angelica Malaspina ... Integral representations for solutions of some BVPs for the Lam´ system in multiply connected domains e Alberto Cialdea∗1 , Vita Leonessa1 and Angelica Malaspina1 Department of Mathematics and ... Lifanov IK, Poltavskii LN, Vainikko GM: Hypersingular integral equations and their applications, Volume of Differential and Integral Equations and Their Applications Chapman & Hall/CRC, Boca Raton,...
- 30
- 359
- 0
báo cáo hóa học:" Integral representations for solutions of some BVPs for the Lame'''' system in multiply connected domains" docx
... University of Basilicata, V.le dell’Ateneo Lucano, 10, Campus of Macchia Romana, 85100 Potenza, Italy Email: Alberto Cialdea∗ - cialdea@email.it; Vita Leonessa - vita.leonessa@unibas.it; Angelica Malaspina ... Integral representations for solutions of some BVPs for the Lam´ system in multiply connected domains e Alberto Cialdea∗1 , Vita Leonessa1 and Angelica Malaspina1 Department of Mathematics and ... Lifanov IK, Poltavskii LN, Vainikko GM: Hypersingular integral equations and their applications, Volume of Differential and Integral Equations and Their Applications Chapman & Hall/CRC, Boca Raton,...
- 30
- 404
- 0
báo cáo hóa học:" Preferences of diabetes patients and physicians: A feasibility study to identify the key indicators for appraisal of health care values" doc
... In fact, there is a whole spectrum of explanatory and pragmatic trials [5] The second level of reporting is related to the appraisal of the effect of the health service Appraisal means that an ... is based on the levels of assessment and appraisal as shown in Table The appraisal of health care services presumes that preferences can be measured and can be made available to the policy and ... properties of a therapy but not all therapies may cover the patients’ preferences The obtained information is rather important as the consideration of patients’ preferences was requested as part of evidence-based...
- 7
- 401
- 0
Báo cáo hóa học: " A note on the complete convergence for sequences of pairwise NQD random variables" potx
... sequences and NA random variable sequences are the most important and special cases of pairwise NQD random variable sequences, then we have the following results as two corollaries of Theorems 2.1 and ... China Authors’ contributions HH, DW and QW carried out the design of the study and performed the analysis QZ participated in its design and coordination All authors read and approved the final manuscript ... Foundation (2010GXNSFA013120) The authors are very grateful to the referees and the editors for their valuable comments and some helpful suggestions that improved the clarity and readability of the...
- 8
- 483
- 0
Báo cáo hóa học: " A note on the complete convergence for arrays of dependent random variables" docx
... independent random variables have been extended to dependent random variables by many authors The concept of negatively associated random variables was introduced by Alam and Saxena [6] and carefully ... negatively associated and negatively dependent random variables and then they proved the case of mean zero by using these results However, this approach is not good For the case of negatively associated ... negatively associated random variables Theorem 1.4 Let {Xni, ≤ i ≤ kn, n ≥ 1} be an array of rowwise negatively associated random variables and {an, n ≥ 1} a sequence of nonnegative constants Suppose...
- 8
- 394
- 0
Báo cáo hóa học: "Research Article Convergence Theorems for the Unique Common Fixed Point of a Pair of Asymptotically Nonexpansive Mappings in Generalized Convex Metric Space" pptx
... to thank the referee and the editor for their careful reading of the manuscript and their many valuable comments and suggestions The research was supported by the Natural Science Foundation of ... introduced a notion of convex metric space, which is more general space, and each linear normed space is a special example of the space Late on, Ciric et al proved the convergence of an Ishikawa type ... Fixed Point Theory and Applications considered the Ishikawa iteration process to approximate the common fixed point of mean nonexpansive mappings in uniformly convex Banach space Takahashi first...
- 6
- 336
- 0
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần2 docx
... "Thanh Hoa" hay "Nguyen Thanh Hoa" Điều cấm kị nên bạn thật lưu tâm THE SUPERSCRIPTION (PHẦN Đ A CHỈ TRÊN B A THƯ) Các bạn lưu ý gửi thư cho người phụ nữ phải viết phần tên hiệu phần đ a b a thư ... Bởi chữ ký phần quan trọng mang tính biểu trưng thay cho bạn nên cần phải thống thư từ hay văn giấy tờ Ví dụ, tên Nguyen Thanh Hoa bạn không nên gửi thư cho người ký tên "Hoa" sau thư gửi đến người ... thư thân mật không trang trọng thường dùng: Yours sincerely, Yours very sincerely, Yours cordially, Yours faithfully, Yours gratefully, Yours affectionately, Very affectionately yours, Yours lovingly,...
- 13
- 596
- 2
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 docx
... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi đến công ty "The...
- 7
- 475
- 0
Bài 1 - The parts of a letter (Thành phần của một bức thư)-phần3 pdf
... Dear Mai Anh, Tuy nhiên, thư thương mại, trao đổi công việc bạn không nên sử dụng dấu phẩy đằng sau "Dear" Thay vào đó, theo văn phong Anh Mỹ bạn sử dụng dấu hai chấm Còn theo văn phong Anh Anh ... Nhưng bạn gửi đến công ty "The National Cash Register Company" bạn không nên dùng: "Messrs National Cash Register Company" Mà dùng "The National Cash Register Company." "Messrs." phần viết tắt ... thay dùng "Mr." người Mỹ Tên hiệu "Messrs." dùng để hai hay nhiều người cộng tác kinh doanh Ví dụ: "Messrs Le Minh and Ngoc Lam" Hoặc "Messrs Le Minh & Ngoc Lam" Nhưng bạn gửi đến công ty "The...
- 7
- 574
- 1
Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps
... that the conditional expectation of a performance future offspring of some animal i of the parent population is equal to and the variance given the performances of all the ,i d Y of a animals ... performances of the offspring of the candidate for selection The selection criterion (21) is then a true measure of the candidate’s value, and can be considered as an approximation of the criterion ... expressions are given numerical values after estimates of genetic values and of variance components are available General formulae can be derived that take into account all performances of the whole...
- 29
- 347
- 0
Báo cáo y học: "“Floating arm” injury in a child with fractures of the proximal and distal parts of the humerus: a case report" docx
... the combination of ipsilateral fracture of the elbow and forearm Gausepohl et al [7] reported a case with fracture dislocation of the elbow combined with unstable distal forearm fracture of the ... neurovascular examination was normal Plain radiographs showed a displaced fracture at the proximal metaphyseal-diaphyseal junction of the left humerus and ipsilateral displaced extension type supracondylar ... DP: Management of the floating elbow injury in children Simultaneous ipsilateral fractures of the elbow and forearm Arch Orthop Trauma Surg 2000, 120:205-208 Gül A, Sambandam S: Ipsilateral proximal...
- 4
- 409
- 0
Báo cáo y học: " The Scandinavian Solutions for Wellness study - a two-arm observational study on the effectiveness of lifestyle intervention on subjective well-being and weight among persons with psychiatric disorders" pot
... of persons with schizophrenia [30], and also because this scale was already part of the SfW program in Scandinavia and the feedback from the SfW instructors about the ability of the participants ... was defined as a change between - cm and cm, and an increase was defined as cm increase or more For weight a decrease was defined as a loss of at least kg, stable weight was a Page of 12 change ... to play any role here The choice of the short-form of the SWN scale in this study was governed by the history of the scale as it was developed and validated in a clinical trial measuring the subjective...
- 12
- 348
- 0
Báo cáo y học: " Randomised controlled trial of the clinical and cost effectiveness of a specialist team for managing refractory unipolar depressive disorder" ppt
... group the participant has been randomised to at the end of 12 months treatment At the end of the study, these guesses will be compared against chance Statistical analysis Statistical analysis for ... because it is providing an acceptable standard of care In the latter case, the implication might be that better training and support for existing staff is required rather than the formation of a ... be aware of Costs of time off work will be calculated from the patient’s own account of their salary and normal expectations of overtime and informal care to the depressed patient will be calculated...
- 11
- 302
- 0
báo cáo khoa học:" Endoscopically assisted procedure for removal of a foreign body from the maxillary sinus and contemporary endodontic surgical treatment of the tooth" ppt
... the action of the cilia that continue to clear mucus toward the natural ostium It is possible that the foreign body dislocated near the maxillary natural ostium created an antral inflammation of ... view of the foreign body in the supero medial aspect of the maxillary sinus Intraoperative endoscopic view of the foreign body in the supero medial aspect of the maxillary sinus Figure Intraoperative ... left maxillary sinus Computed tomography scan (coronal plane) showing the foreignof the upper first the supero medial aspect of the maxillary Figure sinus and partial mucosal thickening of the...
- 5
- 420
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008