goal attainment scaling at the elderly outreach service results of a pilot project
Postgraduate Research Opportunities at the Telethon Institute for Child Health Research: Student project booklet 2013 docx
Ngày tải lên :
07/03/2014, 04:20
... shown that pregnancy may be linked with the progression of diabetes related complications, for example eye damage. Western Australia Linked Health Data The WA Data Linkage Branch, which sits within the WA Department of Health, holds linkages between over 60 databases containing over 36 million records. ... shown that pregnancy may be linked with the progression of diabetes related complications, for example eye damage. Western Australia Linked Health Data The WA Data Linkage Branch, which sits within the WA Department of Health, ... Asthma is a chronic disease effecting over 12% of the Australian population. Recent data strongly indicates that asthmatics experiencing severe viral exacerbation of disease, requiring hospitalization, are deficient in their type I ...
- 92
- 356
- 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
Ngày tải lên :
07/03/2014, 15:20
... AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ... AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ... AAAGGTACCAAAGATGTGGAATCTCCTTCACG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC...
- 9
- 414
- 0
High Degree of Adherence to Statin Therapy Among the Elderly Despite High Frequency of Side Effects doc
Ngày tải lên :
22/03/2014, 14:20
... share, are atorvastatin, rosuvastatin, pravastatin, and fluvastatin Of these, atorvastatin is the most common (14%); the other are only used by 3% of those treated with statins.6 Statins act by ... initiated in primary care (PC) or in hospital (HC), and • to investigate whether there was any correlation between the side effects of statin therapy and statin dose or renal impairment Materials ... the treatment of cardiovascular disease, it is crucial to create good conditions for patients to adhere to the treatment and to receive the full benefits of statin therapy The aims of the present...
- 7
- 423
- 0
Health of the Elderly in South-East Asia A profile pptx
Ngày tải lên :
28/03/2014, 16:20
... cataract and diarrhoea are the most common causes of hospitalization of elderly women The data also shows a difference in reasons for hospitalization between the rural and urban elderly The elderly ... reveals that the mortality rate of female elderly was lower than male elderly in three countries: Bangladesh, India and Thailand However, after 70 years of age, the mortality rate of the female elderly ... on Ageing, 1999 Common causes of mortality Because of the changing patterns of health problems and disease among the elderly, the leading causes of death have also changed The data on the leading...
- 128
- 479
- 0
Environmental conditions, health and satisfaction among the elderly: Some empirical results potx
Ngày tải lên :
28/03/2014, 19:21
... physical and architectural features, organizational and functioning characteristics, social climate, and residential satisfaction The personal factors assessed were: functional abilities, personal ... indicators of environmental quality As we can see in Table 6, our four indicators of environmental quality significantly correlate; but, also, on base of the shared variance it cannot stated that ... health and social services are available for all the population, financial conditions have no explanatory role in health Education (schooling) is significantly associated with health; it can...
- 10
- 545
- 0
HEALTH BEHAVIOUR OF THE ELDERLY: BETWEEN NEEDS AND REALITY - A COMPARATIVE STUDY – doc
Ngày tải lên :
28/03/2014, 20:20
... subjects relate to the fact that in Romania the elderly are not aware of their low level of health information and are resistant to changing their unhealthy habits The results of the study provide ... importance of health Surprisingly, some of the Romanians who had been diagnosed as suffering from diseases evaluated their health status at a higher level This shows that they are not aware of what good ... within a broad multinational and multicultural context This qualitative and quantitative analysis serves as support for the elaboration of an intervention plan adapted to the needs of each specific...
- 9
- 624
- 0
Department of the Treasury: Fiscal Service, Bureau of the Public Debt pptx
Ngày tải lên :
29/03/2014, 03:21
... (northern half), Iowa, Michigan, Minnesota, Montana, North Dakota, South Dakota, Wisconsin Minneapolis, Chicago Dallas, San Francisco, Alaska, Arizona, Arkansas, California, Colorado, Hawaii, Idaho, ... there are none of the above, then a parent of the decedent; if there are none of the above, then a brother or sister of the decedent; if there are none of the above, then a descendant of a deceased ... (a) General The purchases of bonds in the name of any person in an individual capacity are computed separately from purchases in a fiduciary capacity, e.g., as representative for the estate of...
- 21
- 263
- 0
Báo cáo khoa học: "Tree water relations and climatic variations at the alpine timberline: seasonal changes of sap flux and xylem water potential in Larix decidua Miller, Picea abies (L.) Karst. and Pinus cembra L." ppt
Ngày tải lên :
09/08/2014, 04:20
... unable to maintain an adequate water supply to the leaves after a few days without rainfall This led to a decrease in the assimilation rate when the supposed most ’favourable’ weather conditions ... abies water is stored mainly in branches as demonstrated by Schulze et al [30]) In fact, if the stem and branches have little capacity to store water and desaturate the reservoirs the variations ... in P abies and P cembra as compared with L decidua allows us to speculate that in the case of an increase in air temperature (and VPD) the latter could be favoured in competition against the former...
- 14
- 281
- 0
Luận Án TS y học: Patient satisfaction towards health services at the out-patient department clinic of Wangnumyen community hospital, Sakaeo province, Thailand
Ngày tải lên :
25/07/2015, 18:36
... consideration in the health care context These are evaluation of specific treatment, evaluation of patterns of care for particular patient groups, evaluation of organizations, and evaluation of health ... needs Many key performance indicators are used to monitor and evaluate the results of working organizations and their staffs Patient satisfaction is the essential indicator that indicates the quality ... view and patient satisfaction may be thought of as a measure of the “process” of care Problem areas can be isolated and ideas towards solutions may be generated (4) Evaluation of health care is...
- 103
- 278
- 0
Tài liệu Exporting the Results of a Query as a String docx
Ngày tải lên :
24/12/2013, 05:15
... is the TAB character rowDelimiter The character or characters that separate rows The default value is the CARRIAGE RETURN character nullExpr A string that is substituted for null column values ... If a number larger than the number of records in the table is specified, all records are converted without error columnDelimiter The character or characters that separate columns The default value ... ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dt = new DataTable(ORDERS_TABLE); da.Fill(dt); // Call method to convert the DataTable to a string resultTextBox.Text = GetString(dt, -1, null, null, null); } private String...
- 4
- 388
- 0
Tài liệu Controlling the Playback Speed and Direction of a Timeline docx
Ngày tải lên :
24/12/2013, 07:17
... Following that, the value of action is further evaluated If action has a value of "ff", an onEnterFrame event handler is attached to the messages_mc instance This event handler advances the messages_mc ... instance With that in mind, let's look at the conditional statement one section at a time If the handleMessages() function is passed a value of "play", the first part of this conditional statement ... be aware of two events that occur later in the statement when the function is passed a value of "ff" or "rew" In either of those circumstances, a fastforwarding sound is attached to the fastSound...
- 9
- 355
- 0
Tài liệu Exporting the Results of a Query to an Array pdf
Ngày tải lên :
26/01/2014, 10:20
... = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection of rows in the ... from the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the ... Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and...
- 5
- 309
- 0
Tài liệu Báo cáo khoa học: The role in the substrate specificity and catalysis of residues forming the substrate aglycone-binding site of a b-glycosidase docx
Ngày tải lên :
18/02/2014, 17:20
... accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg ctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A, 5¢-ggacaa ctttgaatgggcggagggttatattgag-3¢ The incorporation of mutations was verified by DNA ... E19 0A, 5¢-caacgagcctagagcgatttgctttgagg-3¢; mutation E190Q, 5¢-caa cgagcctagacagatttgctttgagg-3¢; mutation E19 4A, 5¢-gagagattt gctttgcgggttatggatctgc-3¢; mutation K20 1A, 5¢-gttatggatctgct accgcggctccgatcctaaacg-3¢; ... mutation on the Sfbgly catalysis could be the result of a drastic alteration in that putative channel, which would change the rate of the glycosylation and deglycosylation steps Materials and methods...
- 12
- 731
- 0
Báo cáo khoa học: Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx
Ngày tải lên :
07/03/2014, 01:20
... fibrinolysis, contact phase-activated pathway of coagulation and, to a lesser extent, platelet aggregation Iris may also exert anti-inflammatory activity because soluble protein extracts of CHO-KI cells ... because it may form the basis of a drug acting in pathological situations involving the overexpression of TNF -a Materials and methods Preparation of rIris, mutant L33 9A and the cleaved forms of ... documented For example, degradation products of elastin or heparan sulfate proteoglycan can act as chemoattractants towards inflammatory cells or activate TLR4, respectively [34,35] TLR4 activation by...
- 12
- 499
- 0
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt
Ngày tải lên :
16/03/2014, 14:20
... These included the insects D melanogaster (AAB60217), A gambiae (EAA06264), A aegypti (AAK15810), S invicta (AAP92450) and P americana (BAC02725), and the vertebrates Anguila japonica (BAB64337), ... accumulated in the haemolymph (Fig 6) In the haemolymph of dsBgVgR-treated, the vitellogenin accumulated so dramatically that on day it was processed as it is in the ovary, a syndrome that had been ... during the vitellogenic period, and then peaks one day after the blood meal [24] This particular pattern is surely related to the haematophagous regime and anautogenic features of this species The...
- 11
- 414
- 0
The Citizen-Soldier or, Memoirs of a Volunteer potx
Ngày tải lên :
17/03/2014, 02:20
... have the roar of artillery, the rattle of musketry, the prancing of impatient steeds, the marching and countermarching of battalions, the roll of the drum, the clash and clatter of sabers, and the ... terminate an unpleasant matter without unnecessary delay We had a case of disappointed love in the regiment last night A sergeant of Captain Mitchell's company was engaged to a girl of Athens ... still reach us of the great battle at Pittsburg Landing It is strange what fortune, good or ill, our division has had Taking the lead at Green river, we doubted not that a battle awaited us at Bowling...
- 143
- 535
- 0
Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx
Ngày tải lên :
23/03/2014, 05:22
... testing capacity in appendix The ratio of the maximum capacity to the average capacity available is about 2.5 Again, this indicates that the average capacity is a good indicator for the available testing ... size of the small labs might be related to comparative advantage E.g the price advantages of the small labs might be due to advantages of specialization Small labs generally offer a limited package ... given: A separate issue is, that the relative number of participating corporate labs is considerably lower than that of independent labs This is due to the fact, that corporate labs are mainly managing...
- 19
- 493
- 1
Symptomatology of Gynecological Malignancies: Experiences in the Gynecology Out-Patient Clinic of a Tertiary Care Hospital in Kolkata, India pot
Ngày tải lên :
28/03/2014, 14:20
... lack of cancer awareness, poor health education and inaccurate death certification Cancer registries in different parts of India reveal that majority of cancer cases present in an advanced stage ... gynecological malignancy patients reported annually on Friday and Saturday was on an average 215, among the average total number of 5,126 newly registered patients 786 Asian Pacific Journal of Cancer ... endometrial malignancy Gestational trophoblastic neoplasia was found in patients (5.3%) Vulval malignancy and vaginal malignancy were rare (2 patients or 1.8% each) More than two-third of the patients...
- 7
- 321
- 0
PERIPHERAL NEUROPATHY - A NEW INSIGHT INTO THE MECHANISM, EVALUATION AND MANAGEMENT OF A COMPLEX DISORDER doc
Ngày tải lên :
30/03/2014, 23:20
... dictated, at least in part, by the particular pathology Chronic back pain, for example, is associated with a loss of bilateral dorsolateral prefrontal cortex and unilateral thalamic gray matter ... lay the foundation for a clear and accurate representation of spatiotemporal coding of pain in the brain, with the ultimate goal of correlating neural activity with distinct cognitive and behav‐ ... particular pattern of activation referred to as the “pain matrix” Areas of the matrix can be classified as belonging to one of two parallel pathways that control distinct aspects of pain: sensory...
- 172
- 396
- 0
Báo cáo khoa học: Biotinylation in the hyperthermophile Aquifex aeolicus Isolation of a cross-linked BPL:BCCP complex pptx
Ngày tải lên :
31/03/2014, 07:20
... 5¢-TTAA GGATCCTAAGAACGAGACAGGCTGAACTCTCC-3¢; BCCPD67, 5¢-GTAACCATGGGTGAACAGGAAGA A- 3¢; BCCP-rev, 5¢-GGATCCTTAAACGTTTGTGTC TATAAG-3¢; BCCP K117L, 5¢-GAAGCTCTACTG GTTATGAAC-3¢ DNA was isolated ... Fig Steady-state kinetic analysis of BPL substrate binding The activity of A aeolicus BPL was measured under steady-state conditions at 70 °C Two substrates were kept at constant saturating levels ... in the absence and presence of saturating amounts of biotin and MgATP (Fig 5C) This demonstrates that the active lysine residue does not take part in the cross-linking reaction and saturating amounts...
- 11
- 578
- 0