we describe the cloning and expression of deoxyhypusine hydroxylase dohh
Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot
... present in the apical membranes of the oxyntic-peptic cells [37]. The distribution of the ecto-ATPDase on these epithelial cells is distinctly different fromtheotherATPDaseintheE-ATPasefamily,theCD39s[13,17,19].Molecular ... on the characterization of the E-ATPases in intact cells and plasma membranepreparations has accumulated since the 1970s (reviewed in[3]). Because of their low abundance and the lability of ... numbers are on the left side and amino-acid residue numbers are on the right side of the figure. The transmembranous domains of the protein at the N- and C-terminus areshaded. The five apyrase...
- 10
- 694
- 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... (ATTTA) were present in the 3¢-UTR as well as in the 5¢-UTR, and four potentialpoly(A) signals were found in the 3¢-UTR (Fig. 1), two of them just 14 or 23 bp upstream of the poly(A) tail. The remaining ... organizationresembles that of mammalian IL-11. The sequencesbetween the trout cDNA and genomic DNA in the coding region are identical, although there were differ-ences in both the 5¢- and 3¢-UTR. The major ... major differ-ences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG(31 bp) in the 3¢-UTR of the cDNA sequence...
- 12
- 511
- 0
Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx
... and plants (55±59%), sug-gesting that the bovine cDNA encodes D14-SR. Northernblot analysis of bovine tissues showed high expression of mRNA in liver and brain. The polypeptide encoded bytheclonedcDNAwasexpressedinCOS-7cells.Immu-no¯uorescence ... control cells. These results areconsistent with the known subcellular localization of the enzymes involved in cholesterol biosynthesis and with the puri®cation of the bovine protein from the ER.Determination ... [7±9] and fungi[10]. Gene c loning of D14-SR from Ara bidopsis thaliana and analysis o f m utants has h ighlighted the role of the protein in cell growth and embryonic development of the plant...
- 8
- 493
- 0
Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf
... speculated that the physical role of MeJA is tomobilize JA [ 19]. The proof of this hypothesis might comefrom a more detailed understanding of how plants formMeJA from JA, and vice versa. ... bands occur o wing to the presence of recognitionsites for the utilized restriction enzymes within introns (asassumed f or the HNL from Hevea) [30]. However, during the purification of MJE there ... evidence for the expression of isoenzymes, although, if present, they mighthave different catalytic properties.Northern blot analysis and induction of MJE expression in cell culturesNorthern blot...
- 8
- 458
- 1
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... codon and Xho I restriction site was introduced on the 5’ end of the proposed synthetic trypsin inhibitor gene. The sequences of the forward and reversed primers are shown on fig 3 and of the ... primers and the purified total MCo DNA as template. The conditions for this experiment were established as: 150ng of each primer; 200µM of dNTPs ;400ng of the purified total MCo DNA . Cloning of ... strain was used as the host for cloning and expression of the recombinant gene . The recombinant MCoTI-II was firstly synthesized in a 58kD fusion protein, then released from it and purified following...
- 9
- 497
- 0
Report of the Special Rapporteur on the promotion and protection of the right to freedom of opinion and expression, Frank La Rue* ppt
... technologies, for the exercise of the right to freedom of opinion and expression, including the right to seek, receive and impart information and the relevance of a wide diversity of sources, as well as ... freedom of opinion and expression, but also a range of other human rights, and to promote the progress of society as a whole. Chapter III of the report underlines the applicability of international ... their right to freedom of opinion and expression, the Internet also facilitates the realization of a range of other human rights. 23. The vast potential and benefits of the Internet are rooted...
- 22
- 400
- 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot
... intensity of the bandsmay be the result of a different copy number of the genes in the hybridizing fragments. If so, the number of the bands donot represent the family size. Thus, the mlp gene ... the biological role of the sequence (Fig. 2). The sequences of the catalytic A-chain of the MLptoxins were found to differ. However, the amino acidsforming the catalytically active center of ... the other two genes, and that this is probably the reason for the quantitativeprevalence of MLI in extract of mistletoe leaves [18]. The A-chains encoded by the three variants of the genes wereexpressed...
- 11
- 610
- 0
Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt
... the understanding of the proteinstructure and function, and lay a solid foundation forits application. This study reports the cloning and characterization of the A-chain gene that encodes the toxic ... controls. The reactions were stopped by the addition of 0.1 vol. of NH4OAc and 2.5 vol. of 100% ethanol and frozen beforecentrifugation for 1 h at 4 °C. The pellets were resuspendedin 15 lL of 60% ... The rPAB showed anapparent molecular mass of 60 kDa, similar to the native pulchellin. The toxic activities of the rPAB and native pulchellin were compared by intra-peritoneal injection of...
- 10
- 390
- 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt
... present in the othermembers of the APP superfamily, such as the absence of the exon encoding the KPI domain and the lack of a secondheparin-binding domain [3,4,13,26].Comparative analysis of the Xenopus and ... ubiquitously expressed and alternatively spliced formswere detected. However, the expression ratios between the mRNA forms in the various tissues examined were differentbetween Xenopus and mammals, most ... analysis of the APP superfamilyTo reveal the evolutionary history of the APP superfamily, we used maximum likelihood and Bayesian methods toconstruct a phylogenetic tree of the members of the APPsuperfamily...
- 7
- 405
- 0
The Design and Implementation of a Log-Structured File System
... shows the relative importance of the variouskinds of data written to disk, both in terms of how much of the live blocks they occupy on disk and in terms of howmuch of the data written to the ... sequen-tially, then writes 100 Mbytes randomly to the existing file, thenreads 100 Mbytes randomly from the file, and finally reads the filesequentially again. The bandwidth of each of the five phases ... cleaning the segment and chooses the segments with the highest ratio of benefit to cost. The benefit has twocomponents: the amount of free space that will bereclaimed and the amount of time the space...
- 15
- 1,434
- 0
- draganddrop tech chapter 1 adventuring into the mac world chapter 2 the nuts and bolts of your mac chapter 3 getting to the core of the apple
- the structure and functions of the red cell membrane macromolecules that carry them
- the life and times of an object
- development of a regional risk management framework for apec economies for use in the control and prevention of introduced marine pests
- the life and death of a rogue ap
- the detection and representation of ambiguities
- on the evaluation and comparison of taggers
- describe the history and use of android technology
- describe the evolution and importance of personal selling
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008