Cloning and characterization of the genes encoding toxic lectins in mistletoe ( Viscum album L) Alma G. Kourmanova 1,2 , Olga J. Soudarkina 1 , Sjur Olsnes 3 and Jurij V. Kozlov 1,2 1 Engelhardt Institute of Molecular Biology, Russian Academy of Sciences and 2 The University of Oslo Centre for Medical Studies in Moscow, Russia; 3 Institute for Cancer Research, The Norwegian Radium Hospital, Montebello, Oslo, Norway Leaves of mistletoe (Viscum album L) contain three toxic lectins (type 2 ribosome-inactivating proteins) MLI, MLII, and MLIII, differing in molecular mass and carbohydrate specificity. Clones, containing sequences of three gene vari- ants designated ml1p, ml2p,andml3p, were obtained using PCR amplification from cDNA and from mistletoe genomic DNA. The quantitative ratio of the ml1p, ml2p,andml3p genes in genomic DNA was found to be 1.5 : 1 : 4, respectively, whereas the ratio of their mRNA was 50 : 10 : 1. The quantitative prevalence of the ml1p tran- script correlates well with the observation that MLI is quantitatively dominant over MLII and MLIII in the mistletoe extract. The sequences of the proteins encoded by the ml1p, ml2p, and ml3p genes are identical to MLI by 98, 88, and 77%, respectively. The similarity to MLI of the amino acid sequence encoded by the gene ml1p, the quan- titative prevalent of its mRNA, as well as structural prop- erties of the B-chain indicate that the gene, ml1p, corresponds to MLI. Western blot analysis of recombinant A-chains encoded by the three variants of mlp genes with the monoclonal antibody MNA4 having differential affinity to MLI, MLII and MLIII A-chains suggests that the ml2p and ml3p genes correspond to MLII and MLIII, respectively. Structural differences in the carbohydrate-binding sites of the B-subunits of ML1p, ML2p, and ML3p probably explain the difference in sugar specificity of MLI, MLII and MLIII. Keywords: mistletoe; ribosome-inactivating protein; toxic lectin; Viscum album;viscumin. Investigations over the last decades have shown that extracts of several plants contain toxic proteins with lectin properties. They bind by their one subunit, the B-chain, to carbohydrate-containing structures at cell surfaces [1–3]. The other subunit of the toxins, the A-chain, then enters the cytosol and inactivates the ribosomes, leading to cell death. Such toxins are also found in mistletoe (Viscum album L). They are referred to as viscumins or mistletoe lectins (ML). We shall here use the latter designation. As the toxins inactivate ribosomes, they are often referred to as ribosome-inactivating proteins (RIP). Two major groups of plant RIPs are distinguished classically according to their molecular structure [2]. The type 1 RIPs are single chain proteins (with few exceptions) resembling the toxin A-chain in structure and function. They are essentially nontoxic and they are abundantly present in a wide variety of plants. The toxic type 2 RIPs are found only in few plants and are heterodimers consisting of structurally and func- tionally different A- and B-chains [2]. Type 3 was recently introduced for RIPs with quite different structures: a single- chain barley RIP, called JIP60, has an N-terminal domain resembling type 1 RIPs and C-terminal domain with unknown function [3]. The A-chain is a highly specific N-glycosidase that irreversibly inactivates eukaryotic ribosomes [4]. The effi- ciency of the A-chain is so high that penetration into the cytosol of a single A-chain molecule is sufficient to induce cell death [4]. The other polypeptide, the B-chain, is a lectin that is responsible for binding to eukaryotic cell surface receptors which induce endocytosis of the toxin and transfer of the enzymatic subunit to the endoplasmic reticulum, where penetration into the cytosol occurs [6,7]. The type 2 RIPs are synthesized as preprotoxins. The mature form emerges after removal of first, a leader sequence and then a linker that joins the A- and B- chains. Another typical feature is the intronless gene structure [2]. The total sequence homology of these proteins, which originate from taxonomically remote plant species, is not high but all proteins have a similar fold [2,8,9]. Extract of mistletoe leaves has been used in folk medicine since times immemorial. The toxic lectins MLI, MLII, and MLIII were found to be present in the commercial mistletoe preparation, Iscador, that is extensively used in paramedical adjuvant therapy of cancer and for general immunostimu- lation [10–12]. It was found previously that certain cancer cells are more sensitive to the two RIP toxins, abrin and ricin, than cells that were not able to generate tumors in animals [13]. As the extensive use of mistletoe extracts in alternative medicine, Correspondence to K. Jurij, Engelhardt Institute of Molecular Biology, Vavilov street 32, 119991, Moscow, Russia. Fax: + 00 7 95 1352266, Tel.: + 00 7 95 1359909, E-mail: Kozlov@genome.eimb.relarn.ru Abbreviations:IC 50 , 50% inhibitory concentration; MLI, MLII and MLIII, mistletoe lectins 1, 2, 3; RIP, ribosome-inactivating protein. Enzymes: N-riboside hydrolase (EC 3.2.2.22) (Received 27 February 2004, revised 19 March 2004, accepted 7 April 2004) Eur. J. Biochem. 271, 2350–2360 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04153.x it is important to obtain a clearer picture of the toxin content in mistletoe. The three toxic lectins MLI, MLII, and MLIII in mistletoe differ in molecular mass and carbohydrate specifi- city [14]. The most extensively studied one is MLI, whose primary [15] and tertiary [16,17] structures are known. No data are available on the primary structure of the two remaining toxic lectins, MLII and MLIII. It has been assumed that all three mistletoe toxins are encoded by the same gene, and that post-translational modifications cause the differences between the proteins [15]. The present work describes the full-size encoding sequences of the mistletoe toxic lectin genes. Analysis of the primary structure of the genes and the encoded proteins enabled us to isolate three gene variants in good agreement with the existence of three toxic lectins in mistletoe leaves. We have shown that gene ml1p, encoding MLI, is transcribed more efficiently than the other two genes, and that this is probably the reason for the quantitative prevalence of MLI in extract of mistletoe leaves [18]. The A-chains encoded by the three variants of the genes were expressed in Escherichia coli and their biological activity was shown. Interaction of the recombinant A-chains with monoclonal antibodies having differential affinity to MLI, MLII and MLIII A-chains suggests that the other two genes ml2p and ml3p correspond to MLII and MLIII, respectively. Materials and methods Plant material Young leaves of mistletoe (Viscum album L) were harvested at the end of May from plants growing on a poplar tree (Populus alba L) in the Poltavskaya region of South Ukraine. The leaves were frozen in liquid nitrogen and stored at )50 °C until use. Plant RNA isolation and cDNA synthesis Total RNA was prepared from young mistletoe leaves using the guanidine hydrochloride extraction method [19]. Poly (A) + -RNA was prepared from the total RNA using paramagnetic oligo(dT) beads (Promega). A Universal Riboclone cDNA Synthesis Kit (Promega) was used to convert poly(A) + -RNA into double-stranded cDNA. Oligo(dT) was used to prime the first strand. The primer was annealed to 1–2 lgofpoly(A) + -RNA. Amplification of genomic ML fragments using degenerate primers On the basis of the published amino acid sequences of the A- and B-chains of mistletoe lectin I (MLI) [20,21], three different degenerate primers were designed. Using primers 5¢-CAIACIACIGGNGARGARTA-3¢ and 5¢-ATIGGRT TITTIAAIACNCCRTC-3¢ it was possible to amplify a 650 bp fragment encoding part of the A-chain. Then, using primers 5¢-CTCGAGCTGGAGACGAGTTGGG-3¢ and 5¢-CKIATISWICCRTCICCRTA-3¢ an overlapping frag- ment encoding a 14 amino acids linker, the larger part of the B-chain was obtained. The sequences were different from MLI. On the basis of the sequences, a single-site polymerase chain reaction (PCR; via single oligonucleotide ligation) was performed according to Lin et al.[22].ThePstI-digested genomic mistletoe DNA was ligated to the PstI oligonucleo- tide (5¢-AGCGTTGACAGCCAGCTGCA-3¢). The first round of amplification was accomplished with the specific primer 5¢-GGTGAGAACGCAGTCAGATGCTAGG-3¢ and PstI, and the second round with another specific primer 5¢-GACCGGATCCCTCTGGGTAGAGAG-3¢ and PstI. The product of the second round of PCR was cloned and the 1066 bp sequence encoding 125 amino acids of the A-chain, the 19 amino acids linker, and 216 amino acidsoftheB-chainoftheml gene was obtained. The sequence was different from that obtained using degenerate primers. The obtained sequence data were used to design primers for RACE. 5¢ and 3¢ rapid amplification of cDNA ends (RACE) RACE was performed according to Frohman et al.[23]. The sequences of the primers used for 5¢ RACE were: 5¢-GCTCCACCAACACAAATC-3¢ for reverse transcrip- tion of poly(A) + -RNA with AMV-Reverse Transcriptase (USB, Cleveland, OH, USA) and 5¢-GGATCGTAGACT GACGCAAGAGTGG-3¢ with the Abridged Anchor Pri- mer (AAP) (Gibco BRL) for the following amplification. The sequences of the primers used for 3¢ RACE were: 5¢-TCTAGA(T) 20 -3¢ for the first cDNA strand priming, and 5¢-GCCCCTCGCGAGGTAACC-3¢ with 5¢-TCTA GA(T) 20 -3¢ or 5¢-CCGTAATCAATATTGTTAGCTGC AG-3¢ with 5¢-TCTAGA(T) 20 -3¢ for the following amplifi- cation. PCR reactions were set up in 20 lL using 5–15 ng cDNA as template, 0.25 l M of each primer, 0.2 m M dNTP, the buffer supplied with Taq DNA polymerase (Promega), 2.0 m M MgCl 2 and 1.0 unit of Taq DNA polymerase were added to the reaction. The thermal profile was 94 °C, 1 min; 55 °C, 1 min; 72 °C, 1 min; 30 cycles. The PCR products were analyzed on 2% agarose gels. Amplification of the full-length coding sequence of the mlp gene To amplify the full-length coding sequences a set of primers was derived from 3¢ and 5¢ untranslated regions (UTR) obtained by RACE. The sequences of the primers were: 5¢AAAATCTAGAGAAGCAAGGAACAATGAATG-3¢ (5¢UTR) containing the XbaI recognition site for cloning, 5¢-AAAAATGCATGAAGTTGATTGCTTGCATTAAC TCAT-3¢ (3¢UTR), 5¢-AAAAATGCATAGGGATGAA GTTGATTGCTTGCC-3¢ (3¢UTR) containing the NsiI recognition site for cloning, and 5¢-CACAAGGTGGC TAAGGCTTCTTCCG-3¢ (3¢UTR), SphI recognition site contained in all 3¢UTR clones was used for cloning in the latter case. PCR reactions (GeneAmp PCR System 2400; Perkin Elmer) were set up in 20 lL using 200 ng genomic DNA or 5–15 ng cDNA as template, 0.25 l M of each primer, 0.2 m M dNTP, the buffer supplied with Vent DNA polymerase (BioLab) and 1.0 U of Vent DNA polymerase. The thermal profile was: denaturation at 94 °C, 3 min; then 94 °C, 1 min; 54 °C, 1 min; 72 °C, 3 min for 5 cycles; 94 °C, 20 s; 58 °C, 40 s; 72 °C,3minplus10sforeach following cycle for 25–28 cycles. The amplified DNA Ó FEBS 2004 Structure of the mistletoe lectin genes (Eur. J. Biochem. 271) 2351 fragments were purified from agarose gel (GFX PCR DNA and Gel Band Purification Kit, USB) and cloned into pGEM7zf(+) or pGEM3zf(+) vector (Promega). DNA isolation and Southern blot analysis Whole genomic DNA was isolated from young leaves according to Murray & Thompson [24]. The DNA prepar- ation was treated with RNase to remove any contaminating RNA. Approximately 10 lg of DNA was digested with restriction endonucleases and subjected to electrophoresis in a 0.7% agarose gel. Southern transfer and hybridization were performed using Zeta-Probe Blotting membranes (Bio- Rad) according to the manufacturer’s recommendations. The blots were probed with the 32 P-radiolabelled 1 kb SmaI– PstI fragment of the ml2p clone. The fragment was labelled using the ÔNick translation kitÕ (Amersham Biosciences). Assessment of the quantitative ratio of the three variants of mlp genes in mistletoe genomic DNA and their transcripts in mRNA Two primers, universal for all obtained variants of ml gene sequences were designed. The primer sequences were: 5¢-TGCTTGAGCTGGAGACGAGTTGG-3¢ (M1) and 5¢-CCATTGGATCGAATGGTTCCATC-3¢ (M2), the PCR products being of 415 or 430 bp length. PCR reactions were set up in 20 lL using 200 ng genomic DNA or 5–15 ng cDNA as template, 0.25 l M of each primer, 0.2 m M dNTP, the buffer supplied with Pfu DNA polym- erase (Fermentas), 2.0 m M MgSO 4 , Pfu DNA polymerase 1.0 U added per 20 lL reaction mixture. The thermal profile was: 94 °C, 5 min for initial template denaturation; then 94 °C, 1 min; 50 °C, 1 min; 72 °C, 1 min for 3 cycles; 94 °C, 30 s; 57 °C, 40 s; 72 °C, 1 min; +2 s for each following cycle for 26 cycles. The amplified fragments (cDNA or genomic) were purified from agarose gel and labelled with [ 33 P]ATP[cP] using T4 polynucleotide kinase. The labelled DNA was purified from the unincorporated labelled nucleotides by gel filtration through Sephadex G-50 and concentrated by ethanol precipitation. Equal amounts (0.3 lg) of the fragment were digested with either SalIorPstI, or with both restriction endonucleases. The labelled digests were separated on 2% agarose gels and the bands corresponding to the three variants of mlp genes were excised. The slices were dissolved in 0.5 mL 2 M HCl, scintillation fluid Aquasol-2 (PerkinElmer) was added and the radioactivity was measured in a scintillation counter. The quantitative ratio of the amplification products of the three gene variants in the amplified fragment was assessed by calculation of the ratio of radioactivity of the corresponding bands. Quantitative PCR The quantity of mlp genes in mistletoe genomic DNA was assessed by quantitative PCR generally according to Diviacco et al. [25]. The competitor DNA was constructed by subcloning the HindIII-SalI fragment from the ml3.1p clone to the ml2p clone applying HindIII and AgeIsites. Obtained plasmid DNA was linearized before using as competitor template. The universal M1 and M2 primers were used for amplification of a fixed amount of mistletoe genomic DNA (200 ng) mixed with increasing amounts of competitor DNA (500–10 000 molecules). PCR reactions were set up in 20 lLusing0.25l M of each primer (half of the M2 primer being 33 P-end-labelled), 0.2 m M dNTP, the buffer supplied with Taq DNA polymerase (Promega), MgCl 2 added to a final concentration of 2.0 m M 1.0 U of Taq DNA polymerase was added per 20 lL reaction. The thermalprofilewas:94°C, 5 min for initial template denaturation; then 94 °C, 1 min; 50 °C, 1 min; 72 °C, 30 s; for 3 cycles then 94 °C, 30 s; 57 °C, 40 s; 72 °C, 30 s; for 26 cycles. PCR products were separated on 2% agarose gel and the bands corresponding to genomic fragment (length of 415/430 bp) and competitor fragment (length of 388 bp) were excised. Radioactivity of the bands was then measured as for the assessment of the quantitative ratio of the three variants of mlp genes. The background measure- ment was performed for each lane by taking a slice of gel just below the competitor band. The equivalence of competitor and genomic template was reached when the competitor DNA input was 4000 molecules. Sequence analysis DNA sequencing was performed with commercial systems T7 Sequenase version 2.0 DNA Sequencing Kit and Thermo Sequenase Cycle Sequencing Kit (Amersham Biosciences). Construction of expression plasmids for the recombinant A-chains of MLp The mlp gene sequences encoding A-chains were subcloned into the pET-28b(+) vector (Novagen). The sequences were amplified with primers introducing restriction endonuclease recognition sites (for the subcloning that followed), trans- lation stop codons and some nucleotide changes replacing codons of low usage in E. coli. Sequences of the primers and pET28b(+) vector sites used for the subcloning are presented in Table 1. The ligated DNA was transformed by electroporation into competent E. coli DH10 cells and the positive transformants were selected by restriction analysis of plasmid DNA minipreparations of five to six clones. The entire A-chain-coding sequences of selected positive clones were checked by DNA-sequencing. For subsequent affinity purification, all the expression plasmids encode the MLp A-chains fused with vector-encoded His-tag peptide on the N-terminus. Expression of A-chains in E. coli Recombinant plasmids were introduced into E. coli strain BL21(DE3)pLysS (Novagen) by calcium chloride-medi- ated transformation. Optimal growth and expression conditions for the recombinant proteins were established. Overnight culture (2 mL) was grown at 37 °CinLuria– Bertani medium (LB) containing kanamicin (30 lgÆmL )1 ) and chloramphenicol (34 lgÆmL )1 ). The next day, cells were harvested and resuspended in 2 mL fresh LB medium and used to inoculate 200 mL medium containing the antibiotics. Cultures were grown at 30 °CuntilA 600 reached 0.6–0.7 ( 3 h). Then, recombinant protein 2352 A. G. Kourmanova et al. (Eur. J. Biochem. 271) Ó FEBS 2004 expression was induced by addition of 1.0 m M isopropyl thio-b- D -galactoside. Cells were harvested 2.5–3 h after induction by centrifugation at 4000 g. Isolation of recombinant A-chains Purification of soluble His-tagged recombinant MLp A-chains was performed using HisTrap Kit (Amersham Biosciences). Elution was performed according to the manufacturer’s instruction by adjusting the washing and elution parameters. Fractions were analyzed by SDS/ PAGE, pooled and dialyzed against PN buffer (20 m M sodium phosphate buffer pH 7.2, 0.5 M NaCl). Protein concentration was determined by measuring the A 280 . SDS/PAGE and Western blotting Samples were boiled for 5 min in 1.0% SDS/50 m M dithiothreitol and run on 15% SDS/PAGE. Before electro- phoresis, holotoxins MLI, MLII and MLIII [kindly provi- ded by A. G. Tonevitsky (Institute of Transplantology and Artificial Organs, Moscow, Russia)] were incubated with dithiothreitol (50 m M )in20m M Tris, pH 8.0, 60 m M NaCl at 37 °C for 30 min to reduce toxins. Proteins were visualized with 0.1% Coomassie Blue R-350 in 10% methanol (v/v)/10% acetic acid (v/v). For Western blots, proteins were transferred to a Hybond-P membrane (Amersham Biosciences) and the membranes were blocked with 5.0% nonfat dry milk in TBS-T buffer (20 m M Tris/ HCl, 137 m M NaCl, pH 7.6, 0.1% Tween 20) overnight at 4 °C. The membranes were then incubated with MNA4 (2 lgÆmL )1 )orTA7(2lgÆmL )1 ) monoclonal antibodies (kindly provided by A. G. Tonevitsky, Institute of Trans- plantology and Artificial Organs, Moscow, Russia) for 3 h at room temperature. Then the antibody–antigen complexes were probed with sheep anti(mouse IgG) Ig, horseradish peroxidase linked whole antibody (Amersham Biosciences), at 1 : 1000 dilution for 2 h at room temperature. Labelled bands were detected using standard protocols of ECL Western Blotting Detection Reagents kit (Amersham Bio- sciences) and then exposed to film. Activity of recombinant A-chains in reticulocyte lysate The biological activity of the recombinant MLp A-chains was determined by their ability to inhibit [ 3 H]Leu incorporation into protein in a cell-free system (Rabbit Reticulocyte Lysate, Nuclease Treated from Promega). Cell-free protein synthesis was performed according to the manufacturer’s instructions. Reaction samples not containing template RNA were incubated with recombinant A-chains for 20 min at 37 °C and chilled to 0 °C. Then, template RNA was added and translation reactions were carried out over 20 min at 30 °C. Ranges of recombinant A-chain concentrations (0.1–60 ngÆmL )1 )were assayed with respect to controls. Each concentration was assayed in triplicate. Results The nomenclature of the mistletoe toxic lectins and their genes Toxic lectins isolated from mistletoe were designated as mistletoe lectins (ML) [14]. The abbreviation ML is followed by the Roman numerals I, II, and III (MLI, MLII, MLIII) and refer to different carbohydrate specificity and molecular mass of each of the proteins. MLI is also called viscumin. The full-size coding sequence of the mlI gene was cloned [15] and designated rML. The same designation was used for the protein encoded by this gene. The sequenced mistletoe toxic lectin genes are designated as ml1p, ml2p and ml3p and the respective encoded proteins as ML1p, ML2p and ML3p. The letter ÔpÕ refers to the geographic origin of the plant (Poltavskaya region of the Ukraine). The geographic origin of the plant may be associated with minor differences in the primary structure of the proteins. The ml1p gene corresponds to MLI. As no structural data for MLII and MLIII were available, ml2p and ml3p genes were brought into correlation with MLII and MLIII by an immunological approach (see below). The ml3.1p gene encodes a protein that differs from ML3p by 14 amino acid residues, but has common structural features with ML3p that distinguish it from ML1p and ML2p. Therefore we consider ml3.1p as a gene that encodes an isoform of the protein encoded by ml3p. Cloning of the sequences of mlp genes Approximately 2 kbp products were obtained by PCR with several pairs of specific primers complementary to 5¢-and 3¢-untranslated regions of 5¢-and3¢-RACE clones using Table 1. Primers used for MLp A-chain coding sequence amplification and pET28b(+) vector sites used for the following subcloning. Restriction endonuclease recognition sites (bold) and translation stop codons (underlined) introduced by primers are indicated. MLp chain Primers pET-28b(+) vector sites used for cloning ML1p A-chain 5¢- GATATA CATATG TACGAGCGTCTTCGTCTTCGTGTTACGCATC -3¢ 5¢- CACAC CTCGAG TTATTAAGAAGAAGACGGACGCTCACCGCA -3¢ NdeI and XhoI ML2p A-chain 5¢- GATATA CATATG TACGAGCGTCTTCGTCTTCGTGTTACGCATC -3¢ 5¢- CACAC CTCGAG TTATTAAGAAGAAGACGGACGGTCCCGGCATAC -3¢ NdeI and XhoI ML3p A-chain 5¢- GATATA CATATG TACCGTCGTATTAGCCTTCGTGTCACGGAT -3¢ 5¢- CACAC GAATTC TTATTAAGAAGAAGAAGAACGGTCCCTGCATAC -3¢ NdeI and EcoRI ML3.1p A-chain 5¢- GATATA CATATG TACGAGCGTCTTCGTCTTCGTGTTACGCATC -3¢ 5¢- CACAC GAATTC TTATTAAGAAGAAGAAGAACGGTCCCTGCATAC -3¢ NdeI and EcoRI Ó FEBS 2004 Structure of the mistletoe lectin genes (Eur. J. Biochem. 271) 2353 genomic DNA or cDNA as a template. The PCR products were cloned and sequenced. Partial sequencing of more than 40 cDNA and genomic clones revealed three groups of the sequences according to the extent of similarity. Thus, sequencing of a region of about 200 bp gave either identical sequences or the sequences differing by 1–2 bases, or the sequences to differ markedly by 10–20 bases. In the first and second cases, the clones were ascribed to one group and in the latter case, to different groups. One genomic and cDNA clone from each group was taken for complete sequencing. Another genomic clone (ml3.1p) bearing a substitution in the region of the A-chain active site was also taken. Here we report the structure of four genomic clones ml1p, ml2p, ml3p and ml3.1p containing full-size coding sequences of mistletoe lectin genes. The proteins encoded by genomic (ml1p, ml2p, ml3p) and cDNA clones (cml1p, cml2p and cml3p) of the same group are identical by 96–97% and have the same structural features (see below). By combining overlapping RACE-clones and cDNA we obtained full-size transcripts of the mistletoe toxic lectin genes. Like other type 2 RIPs (such as ricin and abrin) [2], the mlp genes do not contain introns and they encode the toxic lectins in the form of a single chain precursor (Fig. 1). The ML1p precursor, like the rML-precusor [15], is 564 amino acids in length. The ML2p and ML3p precursors are 569 and 567 amino acids in length, respectively. The precursors contain a 33 amino acid N-terminal leader peptide and a small linker peptide joining the A- and B-chains – these are removed during protein maturation. Comparison of amino acid sequences of the MLp precursors with that of rML revealed a marked difference for the three variants. ML1p have the highest percentage of identity (similarity) to rML: 98(99%), the similarity value additionally includes similar amino acid positions so that it is higher then that of identity. ML2p, ML3p and ML3.1p are identical (similar) to rML by 88(91%), 78(87%) and 77(86%), respectively. A-chains The A-chain of the translation products of three mlp gene variants, like the rML A-chain, consists of 254 amino acids. The ML1p, ML2p and ML3p A-chains are identical (similar) to the rML A-chain by 98(99%), 91(94%) and 83(90%), respectively. Sequence analysis suggests that the A-chains are hetero- geneous in the number of potential N-glycosylation sites having either none (ML2p) or one site (ML1p, ML3p, ML3.1p (Figs 1 and 2). B-chains The ML1p and ML2p B-chains, like the rML B-chain, are 263 amino acids in length and the ML3p B-chain is 266 amino acids in length owing to the insertion of RGT(128- 130). The ML1p, ML2p and ML3p B-chains are identical (similar) to the rML B-chain by 98(98%), 86(90%) and 71(82%), respectively. The MLp B-chains have different patterns of potential N-glycosylation sites (Figs 1 and 2). The ML1p B-chain has thesamesitesasrML.TheML2pB-chainhasthree potential N-glycosylation sites, two of which are homolog- ous to that of ML1p, while the ML3p B-chain has three sites which are homologous to that of ML2p. The ML3.1p B-chain has one site. The linker between the A- and B-chains The linker peptide of ML1p, ML3p and ML3.1p corres- ponds to 14 amino acid residues, whereas for ML2p it corresponds to 19 residues. Comparison of the amino acid sequences of the MLp variants and ricin The MLp variants have a high overall sequence similarity to structurally and biologically related ricin D [26]. The A-chains of ML1p, ML2p and ML3p have 40(54–57%) of identity (similarity) to the ricin A-chain. The invariant amino acid residues involved with the structure or action of the A-chain catalytic site [27] are conserved in the MLp variants: Tyr17, Arg25, Tyr76, Tyr115, Glu165, Arg168, Trp199 of the MLp A-chains correspond to Tyr21, Arg29, Tyr80, Tyr123, Glu177, Fig. 1. Schematic structure of preproricin [26,28] and mature lectins encoded by mlp genes. Domain structure of the B-chain and position of the carbohydrate-binding sites are indicated. Each B-chain domain is composed of three homologous subdomains a, b, c and linking k subdomain which joins the B-chain to the A-chain or the first B-chain domain to the second one. Potential N-glycosylation sites (NXS or NXT) and disulfide bonds are marked. 2354 A. G. Kourmanova et al. (Eur. J. Biochem. 271) Ó FEBS 2004 Arg180, Trp211 of the ricin A-chain (Fig. 2). One other highly conserved residue Arg166 involved in the catalytic site structure (corresponding to Arg178 of the ricin A-chain) is also conserved in all MLp variants except ML3.1p, which has the substitution of Arg166fiVal. The B-chains of ML1p, ML2p and ML3p have 63(75%), 65(77%)and55(70%)ofidentity(similarity)tothericin B-chain, respectively. The residues forming the sugar-binding sites in the ricin B-chain are generally conserved in the structure of the MLp B-chains: Asp23, Gln36, Trp38, Asn47, Gln48 of the MLp B-chains (with one exception for ML2p) correspond to Asp22, Gln35, Tyr37, Asn46 and Gln47 of the ricin B-chain in the first sugar-binding site. Asp235 (238 for ML3p), Ile247 (250 for ML3p), Tyr249, Asn256 (259 for ML3p), Gln257 (260 for ML3p) of the MLp B-chains (with one exception for ML3p) correspond to Asp234, Ile246, Tyr248, Asn255 and Gln256 of the ricin B-chain in the second sugar binding site [28]. The exceptions are the replacement of Trp38 fi Ser in the ML2p B-chain and Tyr252 fi Phe in the ML3p B-chain (Fig. 2). The highly conserved amino acid residues forming the hydrophobic core of the ricin B-chain domains [28] are fully conserved in the MLp B-chains, reflecting the similarity of the tertiary structure of type 2 RIPs (Fig. 2). Thus, positions corresponding to the ricin B-chain Trp49, 90, 131, 173, 216, 258 and Ile57, 98, 181, 223 are occupied by Trp and Ile, respectively, in the MLp B-chains. The ricin B-chain Val21, Leu46, 117, 152, 191, 233 may be replaced in the MLp B-chains by related Leu (Leu22 of the ML3p B-chain corresponding to the ricin B-chain Val21), Ile (Ile118 of the ML3p B-chain corresponding to the ricin B-chain Leu117) or Met (Met153 of the ML1p and ML2p B-chains and Met156 of the ML3p B-chain corresponding to the ricin B-chain Leu152; and Met234 of the ML1p and ML2p B-chains corresponding to the ricin B-chain Leu233). Estimation of the quantitative ratio of the three mlp gene variants in genomic DNA and their transcripts in mRNA The ratio estimation was performed based on the principles of competitive PCR [25]. If the primers M1 and M2 are universal for all obtained variants of mlp genes, and the sequences flanked by the primers are similar and do not differ much in length, then equal amplification of the variants should be expected, and the ratio between the amplification products should correspond to that between gene variants in the DNA template. The difference between the restriction maps of the three mlp gene variants by SalIandPstI in the region flanked by the universal primers allowed separation of the amplifica- tion products (Fig. 3A). Before cutting, a terminal radio- active label was introduced into the amplified fragments. Fig. 2. Comparison of amino acid sequences of ricin [26], mistletoe lectin I (rML) [15] and deduced amino acid sequences of mlp genes. The signal peptide, mature A-chain, linker and B-chain sequences are marked. Sequences of A- and B-chains are numbered to the right. Conserved amino acid residues forming the active site of the A-chain are marked with asterisks [27]. The residues participating in galactose binding in the 1a and 2c subdomains of the B-chain [28] are marked with m. d Denotes highly conserved residues forming the hydrophobic core of the B-chain domains. Residues forming the active site of the A-chain and those participating in galactose binding, but distinct from the conserved ones, are marked in bold. Joined arrows mark Cys residues that form intrachain disulfide bonds. n Shows the bond between the ricin B-chain domains. s Mark Cys residues forming an interchain disulfide bond. Potential N-glycosylation sites are enboxed. The numbers above the sequences refer to the positions of some residues along the A- and B-chains of ricin, which are discussed in the text. Sequences were aligned using the MULTALIGN software in the default setup [44]. Ó FEBS 2004 Structure of the mistletoe lectin genes (Eur. J. Biochem. 271) 2355 Thus, specific restriction fragments used for estimation of the ratio were labelled at a single end. The quantitative ratio of amplification products of three mlp gene variants was calculated as the ratio of radioactivity of the corresponding restriction fragments. Such estimations will be correct if the genomic DNA and mRNA contain no ml gene variants with sequences that are not fully complementary to the primers used. Such variants will amplify at a lower efficiency. To correct partly for such a possibility, a lowered annealing temperature was used in the first cycles of amplification. Presence of gene variants with different restriction maps would produce additional fragments, or the amplification product would not be cut. As a whole, the pattern of fragments formed by cutting the amplification product was similar in genomic DNA and cDNA. Restriction fragments corresponding to all three mlp gene variants can be seen in Fig. 3B. However, their amounts were quite different in genomic DNA and cDNA. In genomic DNA, three mlp gene variants are present in the ratio 1.5 : 1 : 4 for ml1p, ml2p and ml3p, respectively. Fig. 3. Quantitative ratio assessment for the three mlp gene variants in mistletoe genomic DNA and their transcripts in mRNA. (A) Restriction maps of the mlp gene variants in the region amplified with the universal M1 and M2 primers. Positions of the primers are marked by arrows. The SalIand PstI restriction endonuclease digests of the PCR product, amplified with M1 and M2 primers and mistletoe genomic DNA or cDNA as template, were used for the ratio assessment. PstI cuts only the M1-M2 amplification product of ml1p variants giving 169 and 246 bp fragments. SalI cuts the amplification product of ml2p, giving 66, 121 and 243 bp fragments, and the amlpification product of ml3p and ml3.1p, giving 50 and 365 bp fragments. The 246 bp PstI restriction fragment, 243 bp and 365 bp SalI restriction fragments were used for the ratio assessment. (B) Equal amounts of the 33 P-end-labelled M1-M2 amplification product were subjected to complete digestion with SalI, PstIorbothsimultaneously.The digestion products were analyzed by 2% agarose gel electrophoresis in the presence of ethidium bromide. Lanes M, size markers; lanes 1, uncut PCR products; lanes 2, PstI digests; lanes 3, SalIdigests;lanes4,SalI/PstI digests; lane 5, the triple amount of SalI digest for the 365 bp digestion fragment (marked by a solid arrow to the right) may be seen clearly. An additional SalI restriction fragment corresponding to none of mlp genes is marked by an open arrow to the right. The bands corresponding to the above-mentioned fragments were excised and their radioactivity was measured. Background measurements were performed on a slice of agarose gel approximately between the 400 and 240 bp bands in the lane with the SalIorPstI digest. (C) The quantitative ratio of amplification products of the three gene variants in the amplified fragment is presented. 2356 A. G. Kourmanova et al. (Eur. J. Biochem. 271) Ó FEBS 2004 In contrast, in cDNA the ratio of the three gene variants was 50 : 10 : 1 for ml1p, ml2p and ml3p, respectively. No additional bands appeared after cutting the fragment amplified on cDNA. However, an additional restriction fragment of  380 bp was observed after hydrolysis by SalI of the product amplified from genomic DNA (Fig. 3B). Restriction analysis of this fragment using NruI, AatII, AgeI, NarI, and VneI did not reveal similarity with any of the mlp gene variants. This fragment is probably the product of unspecific amplification or it corresponds to unexpressed pseudogene material. After combined treatment with SalI and PstI of the product amplified from genomic DNA, only a small portion of smear that was excised from gel with the specific M1-M2 fragment was observed as uncut material ( 400 bp) (Fig. 3B, lane 4). From the ratio of the three gene variants in the cDNA, gene ml1p is transcribed more efficiently than genes ml2p and ml3p. This result correlates well with the observation that MLI is quantitatively prevalent over MLII and MLIII in mistletoe extracts [18]. It is interesting to note that mapping of the 5¢ ends of the mRNA revealed three bands of different intensity (two minor ones and one major one) corresponding to 39–41 bases upstream from the initiator AUG codon (data not shown). This could mean that there is a unique transcription start site characteristic for each gene variant or mlp genes are able to use more than a single transcription start site. Sizing of the family of toxic lectin genes in mistletoe Assuming that there is a single copy of the ml2p gene per haploid genome, then it follows from the ratio of three gene variants that the size of the gene family makes up 6–7 genes (1,5 : 1 : 4 then 1/2 +1 + 4 ¼ 6/7). Attempts to estimate the size of the mistletoe lectin gene family using genome Southern blot analysis did not give informative results. Only restriction enzymes that did not cut any of the obtained mlp gene variants in the region homologous to the probe were used for the analysis. Therefore, it may be expected that the number of hybrid- izing fragments in the digests represents approximately the sizeofthegenefamily.TheBglII, EcoRI (and also XbaI, NcoI, data not shown) digests gave two hybridizing fragments, one of which (the smaller) was represented by a more intensive band (Fig. 4). At the same time, the AflII, NsiI(andBclI, data not shown) digests gave a very similar pattern of five bands, one of which was also more intensive than the others. Thus, the different intensity of the bands may be the result of a different copy number of the genes in the hybridizing fragments. If so, the number of the bands do not represent the family size. Thus, the mlp gene family size may be more than five genes, confirming the value obtained based on the quantitative ratio of the three mlp gene variants. Large genome size frequently occurrs in plants [29]. We made attempts to determine the size of the genome using competitive quantitative PCR. This may give an accurate value provided that all variants of mlp genes in the genome are fully complementary to the universal M1 and M2 primers used. If otherwise, the efficiency of the amplification will be lower than that of the considered variants, and this will result in an overestimation of the amount of genomic DNA containing one copy of the mlp gene. Nevertheless, taking into account the possible size of the mlp gene family and the number of gene variants considered in the construction of the M1 and M2 primers, the error may be not large. In our estimate, one copy of the mlp gene is contained in 50 pg (5 · 10 10 bp) genomic DNA. Assuming thesizeofthemlp gene family is six to seven genes, the genome size is 5 · 10 10 · 6–7 ¼ 3–3.5 · 10 11 bp, that is, the mistletoe genome may be one of the largest known eukaryotic genomes. It is probable that the failure of our attempts to obtain positive clones by screening the genomic library is due to the huge size of the mistletoe genome. Expression and biological activity of the recombinant MLp A-chains The 762 bp DNA fragments encoding the MLp A-chains were subcloned into the pET-28b(+) expression vector and expressed in E. coli host strain BL21(DE3)pLysS. The major part of the recombinant A-chains appeared in insoluble cytoplasmic fraction but significant amounts were found as soluble material. The soluble recombinant A-chains were purified to homogeneity by a single round of affinity chromatography applying the His-tag sequences. On Coomassie Blue R-350-stained SDS/polyacrylamide gels, the recombinant ML1p and ML2p A-chains could be seen as a single band  30 kDa. The recombinant ML3p and ML3.1p A-chain preparations always gave an addi- tional band of  60 kDa (which may be seen on Western immunoblots with TA7 monoclonal antibody, see below) as if a dimerization of the chains takes place. The additional band also appeared when the ML1p and ML2p recombin- ant A-chain preparations have been stored for a while. The identity of the bands was confirmed by Western blot analysis. The yield of recombinant MLp A-chains was 6, 4.4, 0.35 and 0.3 mg per litre of culture for ML1p, ML2p, Fig. 4. Estimation of the size of the mistletoe lectin gene family. Sam- ples (10 lg) of high-molecular mass mistletoe genomic DNA were digested with either BglII, NsiI, AflII or EcoRI and the resulting fragments were separated by electrophoresis on a 0.7% agarose gel and Southern-blotted onto a nylon membrane. The membrane was probed with a radiolabelled SmaI–PstIfragmentofml2pcloneandwashed under low stringency conditions. Positions of the DNA size markers are shown by arrows. Ó FEBS 2004 Structure of the mistletoe lectin genes (Eur. J. Biochem. 271) 2357 ML3p and ML3.1p A-chains, respectively. The activity of the four recombinant A-chains was assessed by their inhibitory effects on the protein synthesis in rabbit reticu- locyte cell-free system (Fig. 5). All the A-chains appeared to be fully active in translation inhibiting excepting the ML3.1p A-chain which was noticeably less (> 10·) active than the others. The IC 50 values for the four proteins were about 1ngÆmL )1 (ML1p A-chain), 4 ngÆmL )1 (ML2p A-chain), 0.35 ngÆmL )1 (ML3p A-chain), 50 ngÆmL )1 (ML3.1p A- chain). The IC 50 valuefortheML1pA-chainintheassay, thus, coincides with that for the ricin A-chain [30]. It is interesting to note that according to our preliminary results (data not shown) the native reduced ML toxins have generally the same relative inhibitory activity: MLIII > MLI > MLII (the IC 50 values are 0.5, 0.7 and 0.2 lgÆmL )1 for MLI, MLII and MLIII, respectively). Immunological identification of the recombinant MLp A-chains Western blot analysis was performed in order to correlate the ml2p and ml3p genes with MLII and MLIII. Two monoclonal antibodies (MNA4 and TA7) with differential specificity against MLI, MLII and MLIII were used. The monoclonal antibody TA7 interacts with A-chains of MLI, MLII and MLIII [31]. MNA4 possesses the specificity to MLI and MLII A-chains and reacts weakly with MLIII A-chain [32]. Western blot analysis has shown that MNA4 efficiently binds to ML1p and ML2p A-chains and reacts poorly with the ML3p A-chain (Fig. 6). Binding of the recombinant MLp A-chains with TA7 was detected in all samples. Interaction of the native A-chains with TA7 and MNA4 in comparison with recombinant A-chains showed the same binding. Discussion The present work reports the cloning and characterization of three genes from mistletoe that encode toxic lectins that are related to ricin. We were unable to obtain the clones by screening genomic and cDNA libraries and we have therefore used a PCR approach instead. Three toxic lectins, MLI, MLII and MLIII, differing in sugar specificity are isolated from mistletoe by affinity chromatography [14]. Based on the amino acid sequence of MLI, cloning of full-length coding sequences of mistletoe lectin genes has revealed three variants. One of the genes, ml1p, obviously corresponds to MLI whose structure is known at the protein and nucleotide level. Other two genes, ml2p and ml3p encode proteins mark- edly differing from that of ml1p: the ML2p and ML3p precursors are 87(91%) and 77(86%) identical (similar) to the ML1p precursor. The ML2p and ML3p B-chains also Fig. 5. Biological activity of the recombinant MLp A-chains. Recom- binant ML1p (j), ML2p (m), ML3p (s) and ML3.1p (n)A-chains were tested for their ability to inhibit cell-free protein synthesis in the rabbit reticulocyte assay. The IC 50 values for the four proteins were  1ngÆmL )1 (ML1p A-chain), 4 ngÆmL )1 (ML2p A-chain), 0.35 ngÆmL )1 (ML3p A-chain), 50 ngÆmL )1 (ML3.1p A-chain). Fig. 6. Western immunoblot analysis of the recombinant MLp A-chains. From left to right: a dilution series of recombinant ML1p (lanes 1–3), ML2p (lanes 4–6), ML3p (lanes 7–9) A-chains and reduced native MLI (lanes 10–11), MLII (lanes 12–13), MLIII (lanes 14–15) were electrophoresed on 15% SDS/polyacrylamide gel. Recombinant or native proteins (1.0 lg) were loaded on lanes 1, 4 and 7; 0.7 lg on lanes 2, 5, 8, 10, 12 and 14; 0.35 lg on lanes 3, 6, 9, 11, 13 and 15. Separated proteins were then transferred onto Hybond-P membrane (Amersham Biosciences). The blot was probed with monoclonal antibodies TA7 or MNA4 followed by anti-mouse IgG–HRP (Amersham Biosciences). The blots were developed by the enhanced chemiluminescence (ECL) method (Amersham Biosciences). 2358 A. G. Kourmanova et al. (Eur. J. Biochem. 271) Ó FEBS 2004 lack the structural feature of the MLI B-chain allowing its reversible dimerization (not characteristic for MLII and MLIII) – the loss of one disulfide bridge in the first domain of B-chain after Ser40 fi Cys, corresponding to Cys39 in ricin [33]. The protein structure of MLII and MLIII is not known to date but they can be identified by sugar specificity and by immunological methods. The last approach has been used here to help reveal the relationship of ML2p and ML3p to MLII and MLIII. The ML1p, ML2p, ML3p and ML3.1p A-chains were expressed in E. coli in soluble and biologic- ally active form. The recombinant ML3p A-chain was recognized by the monoclonal antibody, TA7, which is specific for all the MLI, MLII and MLIII A-chains [31] and was not recognized by the specific for the MLI and MLII A-chains monoclonal antibody MNA4 [32]. The data suggest that ML3p corresponds to MLIII and ML2p to MLII. Further evidence for the correspondence would be the sugar specificity of ML2p and ML3p. Like other type 2 RIPs, the mistletoe toxic lectins are synthesized in the form of a single chain precursor. The N-terminal leader sequence directs the toxic lectin precursor to the endoplasmic reticulum, where it is split off [34] and the linker peptide (reported to contain a signal for toxin transport into vacuoles) is then excised [35,36]. The overall sequence homology of the MLp linker peptide is low except for the central region containing the sequence LVIRPV which is of high homology to ricin and may reflect the biological role of the sequence (Fig. 2). The sequences of the catalytic A-chain of the MLp toxins were found to differ. However, the amino acids forming the catalytically active center of the A-chains of the MLp toxins are fully conserved and retained in corresponding positions, as in the A-chain of ricin [27] and MLI [16,17,37], but with one exception, the Val166 fi Ala substitution (corresponding to Ala178 of ricin) was found in ML3.1p. It has been shown that Ala178 in ricin located in the region of the catalytic site of the A-chain plays a structural role and any larger residue would interfere with one of the bonds of the invariant Tyr21 involved in stabilization of the active center structure [27]. The substitution possibly causes the low inhibitory activity of the recombinant ML3.1p A-chain in cell-free translation systems when compared with the other variants of the recombinant MLp A-chains. As for ricin, the C-terminal region of the MLp A-chains contains a highly hydrophobic stretch of amino acids (residues 236–246). This hydrophobic tail could function as a signal peptide and initiate A-chain translocation across the intracellular membrane [38]. An important role of the Pro250 residue in the membrane translocation of ricin A-chain was demonstrated using site-directed mutagenesis [39]. A toxin containing the Pro250 fi Ala mutation showed a dramatic effect, with 170-fold reduction in cytotoxicity to Vero cells. In the hydrophobic region of the MLp, A-chains only ML3p contains the corresponding Pro residue, whereas the others contain Ala (Fig. 2). The mistletoe toxic lectins are known to differ in their sugar specificity. Thus, MLI is specific for D -galactose (Gal), MLIII has higher affinity for N-acetyl- D -galactosamine (GalNAc) than for Gal, and MLII binds to both sugars with approximately equal affinity [14]. The comparison of the sequences of ML2p, ML3p and ML3.1p with the sequence of ricin also revealed a difference in the residues forming the carbohydrate binding site. Thus, the conserved residue Trp38 in the first site, corresponding to Trp37 in ricin, is replaced by Ser. Such a substitution may result in a marked lowering in affinity for Gal in ML2p, as it was shown by site-directed mutagenesis for ricin [40]. The introduced mutation of Trp37 fi Ser noticeably decreased the efficiency of its binding to Gal. In the second binding site of the ML3p and ML3.1p B-subunits, the replacement of the conserved Tyr252 fi Phe, corresponding to Tyr248 in ricin, is observed. A similar conversion is present in the structure of the second carbohydrate-binding site of SNAV [type 2 RIP from bark of elderberry (Sambucus nigra)], having a 20-fold higher affinity for GalNAc when compared with Gal [41]. The substitutions of amino acid residues which are responsible for carbohydrate binding may change the sugar-binding specificity of ML2p and ML3p compared to MLI. The different lectin specificity of MLI, MLII and MLIII is probably the result of different structures of the carbohydrate-binding sites of these toxic lectins. Formation of gene families is a characteristic feature of many known RIPs [2]. Thus, although the extent of homology in ricin and ricinus hemagglutinin is very high [42], they are encoded by different genes. The ricin-like gene family is probably comprises about eight members [43]. Different genes appear to encode the mistletoe toxic lectins. As it was estimated using the quantitative ratio of the three mlp gene variants in genomic DNA and Southern blot analysis the size of the gene family is about six/seven genes. Acknowledgement This work was supported by the Russian Foundation for Basic Research (project no. 04-04-49854). References 1. Olsnes, S. & Pihl, A. (1982) Toxic lectins and related proteins. In Molecular Action of Toxins and Viruses (Cohen, P & van Hey- ningen, S., eds). pp. 51–105. Elsevier Biomedical Press, New York. 2. Barbieri, L., Batelli, M.G. & Stirpe, F. (1993) Ribosome- inactivating proteins from plants. Biochim. Biophys. Acta. 1154, 237–282. 3. Peumans, W.J., Hao, Q. & Van Damme, E.J.M. (2001) Ribo- some-inactivating proteins from plants: more then RNA N-gly- cosidases? FASEB J. 15, 1493–1506. 4. Endo, Y. & Tsurugi, K.&.Lambert, J.M. (1988) The site of action of six different ribosome- inactivating proteins from plants on eucaryotic ribosomes. Biochem. Biophys. Res. Commun. 150, 1032–1036. 5. Eiklid,K.,Olsnes,S.&Pihl,A.(1980)Entryoflethaldosesof abrin, ricin and modeccin into the cytosol of Hela cells. Exp. Cell. Res. 120, 321–326. 6. Rapak, A., Falnes, P.O. & Olsnes, S. (1997) Retrograde trans- port of mutant ricin to the endoplasmic reticulum with sub- sequent translocation to cytosol. Proc. Natl Acad. Sci. USA 94, 3783–3788. 7. Wesche, J., Rapak, A. & Olsnes, S. (1999) Dependence of ricin toxicity on translocation of the toxin A-chain from the endo- plasmic reticulum to the cytosol. J. Biol. Chem. 274, 34443–34449. 8. Rutenber, E., Ready, M. & Robertus, J.D. (1987) Structure and evolution of ricin B chain. Nature 326, 624–626. Ó FEBS 2004 Structure of the mistletoe lectin genes (Eur. J. Biochem. 271) 2359 [...]... Characterization and molecular cloning of Sambucus nigra agglutinin V (nigrin b), a GalNac- specific type-2 ribosome-inactivating protein from the bark of elderberry (Sambucus nigra) Eur J Biochem 237, 505–513 42 Roberts, L.M & Lord, J.M (1981) The synthesis of Ricinus communis Agglutinin Eur J Biochem 119, 31–41 43 Tregear, J.W & Roberts, L.M (1992) The lectin gene family of Ricinus communis: cloning. .. Rothe, M., Zinke, H & ¨ Lentzen, H (1999) Cloning of mistletoe lectin gene and characterization of the recombinant A-chain Eur J Biochem 264, 775–784 16 Sweeney, E.C & Palmer, R.A (1981) Crystallization of the ribosome- inactivating protein MLI from Viscum album (Mistletoe) complexed with b-D-Galactose J Mol Biol 234, 1279–1281 17 Krauspenhaar, R., Echenburg, S., Perbandt, M., Kornilov, V., Konareva, N.,... Y.-L & Lin, J.-Y ˚ (1995) Crystal structure of abrin-at 2.14 A J Mol Biol 250, 354–367 10 Holtskog, R., Sandvig, K & Olsnes, S (1988) Characterization of a toxic lectin in Iscador, a mistletoe preparation with alleged cancerostatic properties Oncology 45, 172–179 11 Jung, M.-L., Baudino, S., Ribereau-Gayon, G & Beck, J.-P (1990) Characterization of cytotoxic proteins from mistletoe (Viscum Album L.)... (2000) Immunotoxins Expert Opin Pharmacother 1, 1117–1129 13 Lin, J.-Y., Tsern, K.-Y., Chen, C.-C., Lin, L.-T & Tung, T.-C (1970) Abrin and ricin: new anti-tumor substances Nature 227, 292–293 14 Franz, H., Ziska, P & Kindt, A (1981) Isolation and properties of three lectins from mistletoe (Viscum album L.) Biochem J 195, 481–484 15 Eck, J., Langer, M., Mockel, B., Baur, A., Rothe, M., Zinke, H & ¨ Lentzen,... J.M & Roberts, L.M (1995) Point mutation in hydrophobic C-terminal region of ricin a chain indicate that P250 plays a key role in membrane translocation Eur J Biochem 232, 458–463 40 Frankel, A.E., Burbage, C., Fu, T., Tagge, E., Chandler, J & Willingham, M.C (1996) Ricin toxin contains at least three galactose-binding sites located in B chain subdomane 1a, 1b and 2c Biochem 35, 14749–14756 41 Van Damme,... isolation of RNA from plant tissues Anal Biochem 163, 16–20 20 Soler, M.H., Stoeva, S., Schwamborn, C., Wilhelm, S., Stiefel, Th & Voelter, W (1996) Complete amino acid sequence of the A chain of mistletoe lectin I FEBS Lett 399, 153–157 21 Soler, M.H., Stoeva, S & Voelter, W (1998) Complete amino acid sequence of the B chain of mistletoe lectin I Biochem Biophys Res Commun 246, 596–601 22 Lin, Z., Zhu,... (2000) Unfolding of subunit A during the intracellular transport of Mistletoe Lectin I Mol Biol [Russian] 34, 152–159 33 Sweeney, E.C., Tonevitsky, A.G., Palmer, R.A., Niwa, H., Pflueller, U., Eck, J., Lentzen, H., Agapov, I.I & Kirpichnikov, M.P (1998) Mistletoe lectin I forms a double trefoil structure FEBS Lett 432, 367–370 34 Lord, J.M (1985) Precursors of ricin and Ricinus communis agglutinin Eur J... T., Singh, T., Mikhailov, A., Voelter, W & Betzel, C (1999) Crystal structure of mistletoe lectin I from Viscum album Biochem Biophys Res Commun 257, 418–424 18 Olsnes, S., Stirpe, F., Sandvig, K & Pihl, A (1982) Isolation and characterization of viscumin, a toxic lectin from Viscum album L (Mistletoe) J Biol Chem 257, 13263–13270 19 Logemann, J., Schell, J & Lothar, W (1987) Improved method for the. .. of a functional ricin gene and three lectin pseudogenes Plant Mol Biol 18, 515–525 44 Corpet, F (1988) Multiple sequence alignment with hierarchical clustering Nucleic Acids Res 16,10881–10890 Supplementary material The following material is available from http://www blackwellpublishing.com/products/journals/suppmat/EJB/ EJB4153/EJB4153sm.htm Fig S1 Mapping of the transcription start sites in the mistletoe. .. L.M (1998) Free ricin A chain, proricin, and native toxin have different cellular fates when expressed in tobacco protoplasts J Biol Chem 273, 14194–14199 36 Frigerio, L., Jolliffe, N.A., Di Cola, A., Felipe, D.H., Paris, N., Neuhaus, J.M., Lord, J.M., Ceriotti, A & Roberts, L.M (2001) The internal propeptide of the ricin precursor carries a sequencespecific determinant for vacuolar sorting Plant Physiol . and the 1066 bp sequence encoding 125 amino acids of the A-chain, the 19 amino acids linker, and 216 amino acidsoftheB-chainoftheml gene was obtained. The sequence. Cloning and characterization of the genes encoding toxic lectins in mistletoe ( Viscum album L) Alma G. Kourmanova 1,2 , Olga J. Soudarkina 1 ,