Cloning and expression of sterol D14-reductase from bovine liver Rita Roberti 1 , Anna Maria Bennati 1 , Giovanni Galli 2 , Donatella Caruso 2 , Bruno Maras 3 , Cristina Aisa 4 , Tommaso Beccari 4 , Maria Agnese Della Fazia 4 and Giuseppe Servillo 4 1 Department of Internal Medicine, University of Perugia, Italy; 2 Department of Pharmacological Sciences, University of Milan, Italy; 3 Department of Biochemical Sciences ÔA. Rossi FanelliÕ, Universita Á ÔLa SapienzaÕ Roma, Italy; 4 Department of Biochemical Sciences and Molecular Biotechnology, University of Perugia, Italy Biosynthesis of cholesterol represents one of the funda- mental cellular metabolic processes. Sterol D14-reductase (D14-SR) is a microsomal enzyme involved in the con- version of lanosterol t o c holesterol i n mammals. A mino- acid sequence analysis o f a 38-kDa protein puri®ed from bovine live r in our laboratory r evealed > 90% similarity with a human sterol reductase, SR-1, encoded by the TM7SF2 gene, and with the C-terminal domain of human lamin B receptor. A cDNA encoding the 38-kDa protein, similar to human TM7SF2, was identi®ed by analysis of a bovine expressed sequence tag (EST) 1 database. The cDNA was synthesized by RT-PCR, cloned, and sequenced. The cDNA encodes a 418 amino-acid poly- peptide with nine predicted transmembrane domains. The deduced amino-acid se quence exhibits h igh similarity with D14-SR from yeasts, fungi, and plants (55±59%), sug- gesting that the bovine cDNA encodes D14-SR. Northern blot analysis of bovine tissues showed high expression of mRNA in liver and brain. The polypeptide encoded by theclonedcDNAwasexpressedinCOS-7cells.Immu- no¯uorescence analysis o f t ransfected cells revealed a distribution of the protein throughout the ER. COS-7 cells expressing the protein exhibited D14-SR activity about sevenfold higher than control cells. These results demonstrate that t he cloned b ovine c DNA encod es D14- SR and provide evidence t hat the human TM7SF2 gene encodes D14-SR. Keywords: sterol biosynthesis; sterol reductase; cloning; endoplasmic r eticulum. Sterol D14-reductase (D14-SR), an essential enzyme for sterol biosynthesis in eukaryotic cells, is an i ntegral protein of the ER that acts on D 14(15) -unsaturated sterols in different organisms. In mammalian cells the elimination of a 14a-methyl group from the C30 sterols, lanosterol and 24,25-dihydrolanosterol, during conversion to cholesterol (C27D 5 ) generates the intermediates 4,4-dimethyl-5a-cho- lesta-8,14,24-trien-3b-ol (C29D 8,14,24 ) and 4,4-dimethyl-5a- cholesta-8,14-dien-3b-ol [1] that are transformed into 4,4-dimethyl-5a-cholesta- 8,24-dien-3 b-ol (C29D 8,24 )and 4,4-dimethyl-5a-cholesta-8-en-3b-ol, respectively, by the action of D14-SR [2]. The saturation of the C14C15 double b ond may occur at different stages of the pathway leading from C30 to C27 sterols [3,4]. Biochemical c haracterization, solubilization, and puri®- cation of D14-SR from rat liver have been reported [5,6]. The liver enzyme is responsive to cholesterol lowering agents, as well as to changes in diet and circadian rhythm [6]. D14-SR h as been cloned from y east [7±9] and fungi [10]. Gene c loning of D14-SR from Ara bidopsis thaliana and analysis o f m utants has h ighlighted the role of the protein in cell growth and embryonic development of the plant [11,12]. Inherited human disorders caused by defects in choles- terol biosynthesis have been identi®ed, suggesting a major role for cholesterol a nd/or intermediates of biosynthesis in embryogenesis and morphogenesis [13]. Among these, the Greenberg skeletal dysplasia has been hypothesized to originate from D14-SR de®ciency [14]. In addition, interest in the C29D 8,14,24 and C29D 8,24 sterols has been consid- erably stimulated by the ®nding that they play a crucial role during meiosis in mammals [15]. The C29D 8,14,24 sterol is a positive regulator of the nuclear receptor L XRa [16]. These data indicate that D14-SR is one of the regulatory enzymes in the complex pathway of cholesterol biosynthesis. Recently t he human lamin B receptor (LBR), an integral protein of the inner nuclear membrane, has been shown t o exhibit D14-SR activity [17]. Two protein p aralogues of human LBR, sharing high similarity with plant and yeast sterol reductases, have been identi®ed. These proteins, sterol reductase 1 and 2 (SR-1 and SR-2), are encoded by TM7SF2 and DHCR7 genes, respectively [18±20]. SR-2 is sterol D7-reductase, a Smith±Lemli±Opitz syndrome-related Correspondence to R. Roberti, Department of Internal Medicine, Laboratory of Biochemistry, University of Perugia, Via del Giochetto, 06122 Perugia, Italy. Fax: + 39 0755857428, Tel.: + 39 0755857426, E-mail: robe rti@unipg.it Abbreviations: D14-SR, sterol D14-reductase; SR-1, sterol reductase 1; LBR, lamin B receptor; C29D 8,14,24 , 4 ,4-d imethyl-5 a-cholesta-8,14,24- trien-3b-ol; C29D 8,24 , 4,4-dimethyl-5a-cholesta-8,24-dien-3b-ol; C27D 8,14 ,5a-cholesta-8,14-dien-3b-ol; C27D 8 ,5a-cholesta-8-en-3b-ol; C27D 5 ,cholesterol;E-64,N-[N-( L -3-trans-carboxyrane-2-carbonyl)- L - leucyl]-agmantine; EST, expressed sequence tag; DMEM, Dulbecco's modi®ed Eagle's medium; PVDF, poly(vinyiledene di¯uoride); FITC-conjugated, ¯uorescein isothiocyanate-conjugated; EPT, ethanolaminephosphotransferase. Note: the nucleotide sequence reported in this pap er has been submittedtoGenBankandisavailableunderaccessionnumber AY039681. (Received 2 August 2001, revised 26 October 2001, accepted 31 October 2001) Eur. J. Biochem. 269, 283±290 (2002) Ó FEBS 2002 protein [19±22], whereas no functional characterization of the TM7SF2 gene product has been reported. It has been hypothesized that human TM7SF2 encodes D14-SR [13,23], but upon expression in yeast, no sterol D14-, D7-, or D24- reductase activities were detected [13]. We isolated a 38-kDa protein from bovine liver ER with a high degree of identity with bo th human SR-1 and human LBR. A cDNA encoding this protein was identi®ed b y bovine expressed sequence tag (EST) analysis, cloned, and expressed as a functional D14-SR. MATERIALS AND METHODS Chemicals M-MLV reverse transcriptase, lipofectamine reagent, Dul- becco's modi®ed E agle's medium ( DMEM), and foetal bovine serum were purchas ed from Gibco-BRL (Milan, Italy). TOPO-cloning kit was from Invitrogen (Leek, the Netherlands). RNAse inhibitor was from Ambion (Austin, TX, USA). The Expand Long Template PCR System, Staphylococcus aureus V8 protease, N-[N-( L -3-trans-carb- oxyrane-2-carbonyl)- L -leucyl]-agmantine (E-64), leupeptine, phenylmethylsulfonyl ¯uoride (PMSF), and thesit were all purchased from Roche Molecular Biochemicals (Milan, Italy). Q-Sepharose fast ¯ow, 5a-cholestane, glucose oxi- dase, reduced glutathione, NADPH, commercial antibod- ies, protein A-Sepharose CL 4B, SDS/PAGE reagents, and enhanced chemiluminescence reagents were from Sigma (Milan, Italy). Biogel HTP was from Bio-Rad (Milan, Italy). Poly(vinylidene di¯uoride) (PVDF) membranes (Immobilon P SQ ) w ere purchased from Millipore (Bedford, MA, USA). 5 a-cholesta-8,14-dien-3b-ol (C27D 8,14 )was synthesized according to F ieser & Ourisson [24]. D iacyl- glycerol was prepared from egg yolk as described previously [25]. Other reagents were from Gibco-BRL and Sigma. Isolation of sterol D14-reductase Bovine D14-SR was co-puri®ed from liver ER together with the previously reported ethanolaminephosphotransferase (EPT) [25]. Brie¯y, microsomes (3 mg proteinámL )1 )were solubilized with 1.5% thesit in the presence of 1 m M NaCl and diacylglycerol (0.3 mgámL )1 ). The puri®cation proce- dure i ncluded chromatography o n Biogel HTP and t wo chromatographic steps on Q-Sepharose, performed at pH 7.0 and pH 8.5, as described previously [25]. The protein preparation was concentrated and f reed of lipids as follows. The sample was dialysed extensively against distilled water and freeze-dried. The residue was suspended in a 10-mL mixture of chloroform/methanol (1 : 9, v/v) for 10 min at 37 °C. The insoluble protein pellet was recovered by centrifugation and the extraction was repeated twice. The protein pellet was vacuum dried, resuspended in 5 % SDS and adjusted to 100 m M Tris/HCl (pH 6.8), 1% SDS (w/v), 10% glycerol (v/v), and 100 m M dithiothreitol 2 (SDS/PAGE sample buf fer). Sequence analysis of sterol D14-reductase A 20-lg aliquot of lipid-free protein was subjected to SDS/ PAGE, electroblotted on a PVDF membrane, and stained with Co omassie blue. The N-terminal amino-acid sequence was determined by automated Edman degradation using a PerkinElmer model AB 476A sequencer. For internal sequence determination th e protein (30 lg) was subjected to SDS/PAGE. After staining the gel with Coomassie blue, the 38-kDa band was cut and equilibrated for 10 min with 100 m M Tris/HCl (pH 6.8) c ontaining 12% (v/v) glycerol, 50 m M 2-mercaptoethanol, and 2% (w/v) SDS (buffer A ). The slice was then inserted into a gel well and covered w ith buffer A containing 20% g lycerol (v/v). Staphylococcus aureus V8 protease solution (2 lgin10lL of buffer A) was layered onto the top [26]. The separating gel contained 15% (w/v) polyacrylamide (acrylamide/bisacrylamide 30 : 0.8, w/w). After the sample had been stacked with a 4-mA constant current, the power was turned off for 2 h at room temperature to a chieve proteolysis. Fragments were separated by applying a 30-mA constant current and electroblotted o n P VDF membrane. Bands w ere excised and amino-acid sequence analysis was performed as described above. The amino-acid sequences were analysed using t he BLAST search program (National Center f or Biotechnology Infor- mation; http://www.ncbi.nlm.nhi.gov) [27]. Antibody production Polyclonal antibodies against D14-SR were raised in rabbits by multiple subcutaneous injections of a solution containing  50 lg of lipid-free protein preparation in 0.9% NaCl mixed with an equal v olume of Freund's complete adjuvant. Boost injections of 50-lg protein were performed 21 and 42 d ays after the initial administration. The IgG fraction was puri®ed on a protein A±Sepharose CL 4B column equilibrated w ith 0.1 M Tris/HCl (pH 8.0) and eluted with 0.1 M glycine buffer (pH 3.0) [28]. RT-PCR cloning of the bovine cDNA encoding sterol D14-reductase BLASTN search of the bovine EST database was performed to identify bo vine cDNA clones homologous to human SR-1 cDNA [27]. The putative bovine cDNA was used to design PCR primers for ampli®cation of the ORF. Total RNA (5 lg), puri®ed from liver as described below, was used to synthesize ®rst-strand cDNA using a reaction mixture containing 50 m M Tris/HCl (pH 8.3), 40 m M KCl, 6m M MgCl 2 ,1m M dithiothreitol, 40 UámL )1 of RNase inhibitor, 2.5 m M dNTP, 0.2 m M oligo-dT 15±18mer, and 200 U of M-MLV reverse transcriptase. First-strand syn- thesis was performed at 42 °C for 45 min a nd then the enzyme was inactivated at 90 °C for 5 min. Following ®rst- strand synthesis, PCR of D14-SR cDNA was carried out using appropriate primers and the Expand Long Template PCR System. The two primers used were the sense primer (5¢-AT TCTAGAAGCGGAGACCATGGCCCCTCCTC AG-3¢) and the antisense primer (5¢-AT TCTAGATAG GGTACAGGCCCTTGTGTCCCG-3¢), both bearing the XbaI restriction site (underlined). PCR conditions were as follows: 4 min at 94 °C (1 cycle); 1 min at 94 °C, 1 min at 65 °C, 1 m in at 68 °C (30 cycles); 5 min at 68 °C(1cycle). The RT-PCR product was cloned into the pCR2.1 vector by TOPO-cloning kit and bidirectionally sequenced at MWG Biotech (Mu È nchen, Germany). The PCR product (1370 b p) was used as a probe for Northern blot analysis. 284 R. Roberti et al. (Eur. J. Biochem. 269) Ó FEBS 2002 RNA isolation and Northern blot analysis Total RNA was isolated from different bovine tissues (liver, brain, lung, skeletal muscle, heart, adrenal, and testis) by homogenizing the samples in guanidium isothiocyanate solution (100 mg tissueámL )1 ) followed by CsCl step gradient centrifugation [29]. RNA was denatured in formamide, separated in denaturing agarose gel (1% agarose/2.2 M formaldehyde), and blotted onto a nitrocel- lulose ®lter. The R NAs ( 20 lg) ext racted f rom d ifferent tissues were hybridized with random priming 32 P cDNA speci®c for bovine D14-SR [30]. Expression of sterol D14-reductase in COS-7 cells Bovine D14-SR cDNA was subcloned in the XbaIsiteofthe eukaryotic expression vectors pCS2-myc-tag, containing the CMV promoter [31], and modi®ed pMT2, containing the SV40 promoter [32], kindly provided b y N. S. Foulkes (IGBMC of Strasbourg, France) and F. Grignani (Univer- sity of Perugia, Italy), respectively. The cDNA was subcl- onedinpCS2-myc-tag 3¢ to a sequence encoding six copies of a 13-residue c-myc epitope. COS-7 cells were grown in a 5% CO 2 incubator a t 37 °C i n DMEM supplemented with 10% foetal bovine serum and 2 m M glutamine. Cells were cultured in 10-cm Petri dishes until 50±80% con¯uence and transfected for 5 h with the two plasmids (4 lg) separately, using lipo fectamine in serum-free DMEM. Con trol cells were transfected with empty p MT2 or pCS2-myc-tag vectors. After transfection, the medium was replaced with complete DMEM and cells were incubated for 35 h at 37 °C. Transfected cells were recovered with 0.9% NaCl containing 1 m M EDTA, 1 l M leupeptine, 0.1 m M PMSF, 0.3 l M E-64 and then sonicated three times for 10 s. The microsomal fraction was prepared by centrifugation of the 500 g supernatant at 100 000 g for 1 h at 4 °C. The pellet was resuspended in 10 m M K-phosphate/0.05 m M EDTA (pH 7.4). Protein concentration was determined by the method of Bradford [33], using BSA as a standard. Microsomal proteins separated by SDS/PAGE were blotted o n P VDF m embranes and incubated w ith poly- clonal rabbit anti-(D14-SR) Ig or monoclonal mouse anti- (c-myc-tag) Ig, as indicated. Peroxidase-conjugated goat anti-(rabbit IgG) Ig or anti-(mouse IgG) Ig were used as secondary antibodies. The protein was detected by the enhanced chemiluminescence assay. Indirect immuno¯uorescence Transfected COS-7 cells, grown on coverslips, were washed with NaCl/P i and ® xed in ice-cold methanol for 10 min at )20 °C. Cells were subsequently permeabilized by treatment with 0.1 % Triton X-100 i n NaCl/P i for 5 min at room temperature, washed with NaCl/P i , blocked w ith 3% BSA in NaCl/P i , and incubated for 60 min a t r oom temperature with rabbit anti-(D14 -SR) IgG. After washing with NaCl/P i containing 0.1% Tween-20, cells were incubated for 60 min at room temperature with Cy3-conjugated sheep anti- (rabbit IgG) Ig. Cells transfected with the pCS2-myc-ta g vector were subsequently treated with monoclonal mouse anti-(c-myc-tag) Ig and ¯uorescein isothiocyanate-conjugat- ed (FITC-conjugated) goat anti-(mouse IgG) Ig. The cells were examined by ¯uorescence microscopy and the images were acquired by using a Spot-2 cooled camera (Diagnostic Instruments). Sterol D14-reductase assay D14-SR activity was assayed in microsomes prepared from D14-SR cDNA-transfected COS-7 cells and from bovine liver, using 5a-cholesta-8,14-dien-3b-ol (C27D 8,14 )asa substrate [5]. The sterol was added as a 0.3-m M suspension in 0.8% Tween-80, at 60 l M ®nal concentration (13.5 lg) to 0.5 mL of a mixture containing 0.1 M K-phosphate buffer (pH 7.4), 0.5 m M EDTA, 1 m M reduced glutathione, 2 m M NADPH, 0.14 M glucose, and 10 U of glucose oxidase, that had been preincubated for 4 min at 37 °C under N 2 atmosphere. Incubation was carried out under N 2 for 30 min at 37 °C with 0.24 mg of microsomal proteins and terminated by the addition of 1 mL of 20% KOH in 50% methanol, followed by additional 30 min incubation at 37 °C. After the addition of 5a-cholestane (5 lg) as an internal standard, sterols were extracted three times with 3 mL of petroleum ether and the o rganic phases were evaporated to dryness under nitrogen stream. The sterol extracts were acetylated with acetic anhydride- pyridine, 2 : 1 (v/v) for 1 h at 60 °C. The samples were taken to dryness and th e residues were dissolved in ethyl acetate. Aliquots of the samples were analysed by GC-MS in multiple ion detection m ode 3 using a Varian Saturn 2100T apparatus with a Varian CP-Sil8 CB low bleed/MS column. Temperature was programmed from 150 to 300 °Cat 12 °Cámin )1 . Sterol retention times were: 14.5 min, 5a- cholestane (M +  372); 18.2 min, cholesterol (M +  368); 18.3 min, C27D 8,14 (M +  426); 18.5 min, 5a-cholesta- 8(9)-en-3b-ol ( C27D 8 ,M +  428). D14-SR activity was evaluated on the basis of peak area ratios between m/z 426 and m/z 372 ions (C27D 8,14 /5a- cholestane) or m/z 428 and m/z 372 ions (C27D 8 /5a- cholestane) at the expected retention time. RESULTS AND DISCUSSION Isolation of sterol D14-reductase During the preparation and delipidation of a bovine liver 38-kDa protein exhibiting EPT activity [25], a protein co- migrating in SDS/PAGE was revealed by amino-acid sequence a nalysis. The determined N-terminal s equence of the protein, APPQGSRAPLEFGGPLGAAALML, was 87% identical to residues 2±24 of human SR-1 (GenBank accession no. AF096304) [18]. The digestion of the 38-kDa band with S. aureus V8 protease produced three major fragments with molecular masses of  27, 19.5, and 9.5 kDa. The 27- a nd 9.5-kDa fragments con®rmed the N-terminal sequence, whereas the sequence of the 19.5-kDa fragment was AVLTTMDIIHDGFGFMLAF, 95% iden- tical to residues 243±261 of human SR-1 and 440±458 of human LBR (GenBank accession no. L25931). Human SR-1 has been reported to be a sterol reductase, based on similarities with sterol reductases from y east, f ungi, and plants, although its catalytic activity has not been identi®ed [18]. Moreover, human SR-1 exhibits 58% identity with the C-terminal domain (residues 197±615) of human LBR [18], which possesses D14-SR activity [17]. For this reason we hypothesized that the puri®ed 38-kDa bovine protein is a Ó FEBS 2002 Bovine sterol D14-reductase cloning (Eur. J. Biochem. 269) 285 Fig. 1. Amino-acid sequence alignment of sterol D14-reductase and related sterol reductases. Alignment was perfo rmed using the OMIGA 2.0 p rogram run with the default parameters. Positions with consensus residues present in all se quence s are boxed. Positions with consensus residues present in at least three sequences are shaded. Bovine D14-SR (b 14 sr); human SR-1 (h SR-1); residues 197±615 of human lamin B receptor (h lbr197); A. thaliana D14-SR (at 14 sr) (GenBank accession no. AF256535); S. cerevisiae D14-SR (sc 14 sr) (GenBank accession no. S69420). For bovine D14-SR, regions of the deduced amino-acid sequence corresponding to the N-terminal and V8 peptide sequences determined in the sequencing experiments of the protein puri®ed from b ovine liver are underlined. TMPRED program (ExPASy Molecular Biology Server, http://www.expasy.ch/) was used to predict transmembrane domains, indicated by thick lines on top. 286 R. Roberti et al. (Eur. J. Biochem. 269) Ó FEBS 2002 D14-SR. To verify our hypothesis, bovine cDNA encoding the 38-kDa protein was cloned to iden tify the catalytic activity of the expressed protein. Cloning of the cDNA encoding bovine sterol D14-reductase Bovine cDNA clones, similar to human SR-1 (TM7SF2), were retrieved by a BLASTN search in the EST database. The putative cDNA o f the bovine D14-SR was obtained by aligning four different clones (GenBank accession nos. BE756766, BE756734, BE754556 and AW427392) [34]. The bovine cDNA was synthesized by RT-PCR using synthetic primers based on the EST sequences, cloned into the pCR2.1 vector, and sequenced on both strands. The cloned cDNA was 1370 bp long and contained an ORF of 1257 bp, encoding a protein of 418 amino a cids with a calculated molecular mass of 46 751 Da. The N-terminal amino-acid sequence of the protein puri®ed from liver and the amino-acid sequence of the 19.5- kDa fragment generated by S. aureus V8 protease digestion corresponded to residues 2±24 and 243±261, respectively, of the putative protein (Fig. 1). In the puri® ed protein, the N-terminal methionine was cleaved out, as previously described for most eukaryotic proteins [35]. Moreover, the sequenced 27- and 19.5-kDa fragments appeared to origi- nate from cleavage of the protein i n two parts ( Fig. 1), which accounted for the calculated molecular mass of  46.7 kDa. Therefore, the discrepancy between the appar- ent molecular mass of 38 kDa estimated by SDS/PAGE and the calculated molecular mass may be due to an aberrant electrophoretic migration, as reported for other structurally related proteins [19,36]. The putative protein was rich i n leucine (19.1%) and highly hydrophobic, with nine predicted membrane-span- ning domains (Fig. 1). The deduced amino-acid sequence displayed similarity to putative h uman SR-1 (92%), the 197±615 domain of human LBR (71%), A. thaliana D14-SR (59%), Saccharomyces c erevisiae D14-SR (55%) (Fig. 1), and o ther sterol reductases [50% and 49% similarit y to human and A. thaliana sterol D7-reductases, respectively, and 44% to S. cerevisiae sterol D24(28)-reductase]. The EFGGx(2)G signature of sterol D24(28)-reductase and D14-SR and the LLxSGWWGx(2)RH signature of sterol reductases family [37] were present at positions 12±18 and 337±348 of the deduced amino-acid sequence, respec- tively. Ergosterol b iosynthesis ERG4/ERG24 f amily signa- tures, Gx(2)[LIVM][YH]Dx[FYV]xGx(2)LNPR and [LIVM](2)HRx(2)R D x(3)Cx(2)KYG [38] were found at positions 167±182 and 383±399 of the deduced amino-acid sequence, respectively. A leucine-zipper region was present at position 139±160. The presence of signature patterns conserved from yeast D14-SR (ERG24 gene) and sterol D24(28)-reductase (ERG4 gene), as well as the degree of similarity with human LBR and D14-SR from plants and yeast, strongly suggest that the cloned cDNA corresponds to D14-SR. Sterol D14-reductase mRNA expression in bovine tissues Northern blot analysis of bovine tissues was performed with D14-SR cDNA. A single transcript of  1.8 kb was detected in different tissues. H igh levels of mRNA expression were found in liver and brain (Fig. 2). No transcript was detected in the heart, contrary to TM7SF2, highly expressed in t he human tissue [18]. Expression of sterol D14-reductase cDNA in transfected COS-7 cells Western blot analysis. Immunoblot analysis of the ex- pressed D14-SR cDNA was performed using a polyclonal antibody raised against the bovine liver D14-SR. The antibody recognized a single band of  38 kDa both in D14-SR transfected cells and i n bovine liver microsomes (Fig. 3 ). No protein was detected in cells transfected with control vector. The expressed myc-tag-D14-SR was detected by both anti-(D14-S R) Ig and anti-(c-myc)Igasaproteinof  56 kDa, consistent with the fusion of six myc epitopes ( 9.3 kDa) at the N-terminus of the protein (Fig. 3). Cellular localization. The c ellular localization of myc-tag- D14-SR was examined in transiently t ransfected COS-7 cells. Double immuno¯uorescence analysis of cells showed a similar l abelling pattern with anti-(myc-tag)Igandanti- (D14-SR) Ig (Fig. 4). The images showed that the newly formed protein was distributed throughout the ER in the proximity of the nucleus. The same localization was observed i n t ransfected cells over-expressing D14-SR; no label was observed in control cells. These results are consistent with the known subcellular localization of the enzymes involved in cholesterol biosynthesis and with the puri®cation of the bovine protein from the ER. Determination of D14-SR activity. To demonstrate that the cloned bovine liver cDNA encodes a protein with D14- SR activity, cDNA was c loned i n t he expression vector pMT2 and transfected into COS-7 cells. Microsomes prepared from transfected ce lls were assayed f or D14-SR Fig. 2. Northern blot analysis of bovine tissues. Th e RNAs ( 20 lg) extracted from dierent tissues were b lotted onto a nitrocellulose ®lter and hybridized by 32 P-labelled cDNA speci®c for bovine D14-SR. (A) Hybridized D14-SR transcript (arrow). (B) Nitrocellulose ®lter show- ing total RNA (28S and 18S rRNAs are indicated). Ó FEBS 2002 Bovine sterol D14-reductase cloning (Eur. J. Biochem. 269) 287 activity by incubation with C27D 8,14 sterol. C27D 8 sterol was undetectable at the beginning of incubation both in COS-7 cells and bovine liver microsomes. Endogenous D14-SR activity of microsomes obtained from control COS-7 cells, measured on the basis of C27D 8 formation and C27D 8,14 disappearance, was much lower than that observed in bovine liver microsomes (Fig. 5). COS-7 c ells expressing D14-SR cDNA exhibited D14-SR microsomal activity sixfold to sevenfold higher than that of control cells and comparable to that of bovine liver microsomes (Fig. 5). These results indicate that the cloned bovine cDNA encodes a functional D14-SR. The present study describes t he cloning and functional characterization of bovine D14-SR, thus providing evi- dence that the previously cloned human TM7SF2 corre- sponds to D14-SR. Identi®cation of TM7SF2 as the human gene encoding D14-SR paves the way for studies on molecular regulatory mechanisms of the D14-SR gene expression and its possible role in the metabolism of meiosis activating sterols. Mutation analysis of TM7SF2 will clarify whether a defect in this gene underlies the Greenberg skeletal dysplasia. Fig. 5. Sterol D14-reductase activity of transfected COS-7 cells. Microsomes (0.24 mg protein), prepared from cells transfected with the empty pMT2 vector (control) or with D14-SR cDNA (D14-SR) and bovine liver microsomes (0.24 mg protein), were assayed for sterol D14-reductase activity by incubation for 30 min with C27D 8,14 in the conditions described i n Materials and methods. Enzymatic activity was evaluated on the basis of peak area ratios between m/z 426 and m/z 372 ions (C2 7D 8,14 /5a-cholestane) or m/z 428 and m/z 372 ions (C27D 8 /5a- cholestane) a t th e exp ected retention time. At z ero in cubation time the C27D 8,14 /5a-cholestane peak area ratio determined for control cells, transfected cells, and liver microsomes was 4.23  0.56. Data shown are mean  SD (n  3). Fig. 3. Immunoblot analysis of bovine sterol D14-reductase expressed in COS-7 cells. Micro somal proteins were sep arated on a 12% (w/v) SDS gel and transferred to PVDF membranes. Lane A, bovine liver (40 lg protein); lanes B and D, COS-7 cel ls tran sfec ted with myc-tag-D14-SR cDNA (5 lg protein); lane C, COS-7 cells transfected with D14-SR cDNA (5 lg protein). Blots were probed with speci®c antibodies: anti- (bovine liver D14-SR) Ig (lanes A±C) and anti-(myc-tag)Ig(laneD). Detection was performed by the enhanced chemiluminescence proce- dure. Molecular size markers are shown on the right. Fig. 4. Cellular localization of sterol D14-reductase. (A) and (B) I mmuno¯u orescence photomicrographs of transfected COS-7 cells expressing myc-tag-D14-SR. Cells were labelled with rabbit anti-(D14-SR) Ig and secondary Cy3-conjugated sheep anti-(rabbit IgG) Ig (A) and then with mono clonal mouse anti-(myc-tag) Ig and secondary FITC-conjugated goat anti-(mouse IgG) Ig (B). (C) Immuno¯urescence photomicro- graphs of transfected COS-7 cells expressing D14-SR. Cells were labelled with rabbit a nti-(D14-SR) Ig and secondary Cy3-conjugated sheep anti-(rabbit IgG) Ig. 288 R. Roberti et al. (Eur. J. Biochem. 269) Ó FEBS 2002 ACKNOWLEDGEMENTS We are grateful to Prof. D. Barra and Prof. L. Binaglia for critical reading of the manuscript and helpful suggestions. Th anks are extended to D. Piobbico and A. Toia for excellent technical assistance. This stud y was supported by grants from the University of Perugia, Italy. REFERENCES 1. Canonica, L., Fiecchi, A., Galli Kienle, M., Scala, A., Galli, G., Grossi Paoletti, E. & Paoletti, R. (1968) The fate of the 15b hydrogen of lanosterol in cholesterol biosynthesis. J. Am. Chem. Soc. 90, 3597±3598. 2. Fiecchi, A., Canonica, L., Scala, A., Cattabeni, F., Grossi Paoletti, E. & Paoletti, R. (1969) 4,4-Dimethyl-5a-chole sta- 8,14-dien -3b-ol a new precursor of cholesterol in mammalian tissues. Life Sci. 8, 629±634. 3. Canonica, L., Fiecchi, A., Galli Kienle, M., Scala, A., Galli, G., Grossi Paoletti, E. & Paoletti, R. (1968) Evidence for the biological conversion of D 8,14 sterol dien es into cholesterol. J. Am. Che m. Soc. 90, 6532±6534. 4. L utsky, B.N. & Schroepfer, G.J. (1970) Studies on the enzymatic conversion of 5a-cholesta-8,14-dien-3b-ol to cholesterol. J. Biol. Chem. 245, 6449±6455. 5. Paik, Y K., Trzaskos, J.M., Sha®ee, A. & Gaylor, J.L. (1984) Microsomal enzymes o f cholesterol biosynthesis from lanosterol. Characterization, solubilization, and partial puri®cation of NADPH-dependent D 8,14 -steroid 14-reductase. J. Biol. Chem. 259, 13413±13423. 6.Kim,C K.,Jeon,K I.,Lim,D M.,Johng,T N.,Trzaskos, J.M., G aylor, J.L. & Paik, Y K. (1995) Cholesterol biosynthesis from lanosterol: regulation an d puri®cation of rat he patic sterol 14-reductase. Biochim. Biophys. Acta 1259, 39±48. 7. Lorenz, R.T. & Parks, L.W. (1992) Cloning, sequencing, and disruption of the gene encoding sterol C-14 reductase in Sac- charomyces cerevisiae. DNA Cell Biol. 11 , 685±692. 8. Marcireau, C., Guyonnet, D. & K arst, F. (1992) Construction and growth pro perties of a yeast strain defec tive in sterol 14-red uctase. Curr. Genet. 22, 267±272. 9. Smith, S. (1995) Cloning and sequence analysis of an ERG24 homolog from Schizosaccharomyces pombe. Gene 155, 139±140. 10. P apavinasasundaram, K.G. & Kasbekar, D.P. (1994) The Neu- rospora crassa e rg3 gene encodes a protein with sequence homol- ogy to both y east sterol C-14 reductase and chicken lamin B receptor. J. Genet. 73, 33±41. 11. S chrick, K., Mayer, U., Horrichs, A., Kuhnt, C., Bellini, C., Dangl,J.,Schmidt,J.&Ju È rgens, G. (2000) FACKEL is a sterol C- 14 reductase required for organized cell division and expansion in Arabidopsis embryogenesis. Genes Dev. 14, 1471±1484. 12. Jang, J.C., Fujioka, S., Tasaka, M., Seto, H., Takatsuto, S., Ishii, A., Aid a, M., Yoshida, S. & S heen, J. (2000) A critic al role of sterols in embryonic p atterning and meristem programming revealed by the fackel mutants of Arabidopsis thaliana. Genes Dev. 14, 1485±1497. 13. Waterham, H.R. & W anders, R.J.A. (2000) Bioc hemical and genetic aspects o f 7- dehydrocholesterol reductase and Smith± Lemli±Opitz syndrome. Biochim. Biophys. Acta 1529, 340±356. 14. Opitz, J.M. (1999) RSH (so-called Smith±Lemli±Opitz) syndrome. Curr. Opin. Pediatr. 11, 353±362. 15. B yskov, A.G., Andersen, C.Y., Nordholm, L., Thùgersen, H ., Guoliang, X., Wassmann, O., Andersen, J.V., Guddal, E . & Roed, T. (1995) Chemical structure of sterols that activate oocyte meiosis. Nature 374, 559±562. 16. J anowski, B.A., Willy, P.J., Rama Devi, T., Falck, J.R. & Man- gelsdorf, D.J. (1996) An oxysterol signalling pathw ay mediated by the nuclear receptor LXRa. Nature 383, 728±731. 17. Silve,S.,Dupuy,P H.,Ferrara,P.&Loison,G.(1998)Human lamin B receptor exhibits sterol C14-reductase activity in Saccharomyces cerevisiae. Biochim. Biophys. Acta 1392, 233±244. 18. Holmer, L., Pezhman, A. & Worman, H.J. (1998) The human lamin B receptor/sterol reductase multigene family. Genomics 54, 469±476. 19. Moebius, F.F., Fitzky, B.U., Lee, J.N., Paik, Y K. & Glossmann, H. (1998) Molecular cloning and expression of the human delta7- sterol reductase. Proc.NatlAcad.Sci.USA95, 1899±1902. 20. F itzky, B.U., Witsch-Baumgartner, M., Erdel, M., Lee, J.N., Paik, Y K., Glossmann, H., Utermann, G. & Moebius, F.F. (1998) Mutations in the D7-sterol reductase gene in patients with the Smith±Lemli±Opitz syndrome. Proc. Natl Acad. Sci. USA 95, 8181±8186. 21. W assif, C.A., Maslen, C., Kachilele-Linjevile, S., Lin, D., Linck, L.M.,Connor,W.E.,Steiner,R.D.&Porter,F.D.(1998)Muta- tions in the human sterol D 7 -reductase gene at 11q12-13 cause Smith±Lemli±Opitz syndrome. Am.J.Hum.Genet.63, 55±62. 22. W aterham, H.R., Wijburg, F.A., Hennekam, R.C.M., Vreken, P., Poll-The Á , B.T., Dorland, L., Duran, M., Jira, P.E., Smeitink, J.A.M., Wevers, R.A. & Wanders, R.J.A. (1998) Smith±Lemli±Opitz syndrome is caused by mutations in the 7-dehydrocholesterol reductase gene. Am.J.Hum.Genet.63, 329±338. 23. Prakash, A., Sengupta, S., Aparna, K. & Kasbekar, D.P. (1999) The erg -3 (sterol D 14,15 -reductase) gene o f Neuros pora crassa : generation of null mutants by repeat-induced point mutation and complementat ion by proteins chimeric for human lamin B recep- tor sequences. Microbiology 145, 1443±1451. 24. F ieser, L.F. & Ourisson, G. (1953) Cholesterol and compan ion. IV. Oxidation of D7 sterol with selenium dioxide. J. Am. Chem. Soc. 75, 4404±4414. 25. M ancini, A., Del Rosso, F., Roberti, R., Orvietani, P., Coletti, L. & Binaglia, L. (1999) Puri®cation of ethanolaminephosphotrans- ferase from bovine liver microsomes. Biochim. Biophys. Acta 1437, 80±92. 26. C leveland, D.W., Fischer, S.G., Kirschner, M.W. & Laemmli, U.K. (1977) Peptide mapping by limited proteolysis in sodium dodecylsulfate and a nalysis by gel electrop horesis. J. Biol. Chem. 252, 1102±1106. 27. A ltschul, S. F., Madden, T.L., Scha È er, A.A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D.J. (1997) Gapped BLAST and PSI- BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389±3402. 28. Harlow, E. & Lane, D. (1988) Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY, USA. 29. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. & Rutter, W.J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294±5299. 30. D ella Fazia, M.A., Servillo, G. & Viola Magni, M . (1992) Dif- ferent expression of tyrosine aminotransferase an d serine d ehy- dratase in rat livers after partial hepatectomy. Biochem. Biophys. Res. Commun. 182, 753±759. 31. Rupp, R.A., Snider, L. & Weintraub, H. (1994) Xenopus embryos regulate the nuclear localization of XMyoD. Genes Dev. 8, 1311± 1323. 32. S ambrook, J., Fritsch, E.F. & Maniatis, T. ( 1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N Y, USA. 33. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation o f m icrogram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248± 254. 34. S mith, T.P., Grosse, W.M., Freking, B.A., Roberts, A.J., Stone, R.T., Casas, E., Wray, J.E., White, J., Cho, J. & Fahrenkrug, S.C., et al. (2001) Sequence evaluation of four pooled-tissue normalized Ó FEBS 2002 Bovine sterol D14-reductase cloning (Eur. J. Biochem. 269) 289 bovine c DNA libraries and construction o f a gene index for cattle. Genome Res. 11, 626±630. 35. Polevoda, B. & Sherman, F. (2000) N a -terminal acetylation of eukaryotic proteins. J. Biol. Chem. 275, 36479±36482. 36. Worman, H.J., Evans, C.D. & Blobel, G. (1990) The lamin B receptor of t he nuclear envelope inner membrane: a polytopic protein with eight potential t ransmembrane domains. J. Cell. Biol. 111, 1535±1542. 37. Lecain, E., Chenivesse, X., Spagnoli, R. & Pompon, D. (1996) Cloning by metabolic interference in yeast and enzymatic c har- acterization of Arabidopsis thaliana sterol D7-re ductas e. J. Biol. Chem. 271, 10866±10873. 38. Lai, M.H., Bard, M., Pierson, C.A., Alexander, J.F., Goebl, M., Carter, G.T. & Kirsch, D.R. (1994) The identi®cation of a gene family in th e Saccharomyces cerevisiae ergosterol biosynthesis pathway. Gene 140, 41±49. 290 R. Roberti et al. (Eur. J. Biochem. 269) Ó FEBS 2002 . Biotechnology, University of Perugia, Italy Biosynthesis of cholesterol represents one of the funda- mental cellular metabolic processes. Sterol D14-reductase (D14-SR). the bovine cDNA encodes D14-SR. Northern blot analysis of bovine tissues showed high expression of mRNA in liver and brain. The polypeptide encoded by theclonedcDNAwasexpressedinCOS-7cells.Immu- no¯uorescence