0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Highly sensitive and accurate screening of 40 dyes in soft drinks by liquid chromatography–electrospray tandem mass spectrometry

Highly sensitive and accurate screening of 40 dyes in soft drinks by liquid chromatography–electrospray tandem mass spectrometry

Highly sensitive and accurate screening of 40 dyes in soft drinks by liquid chromatography–electrospray tandem mass spectrometry

... appropriate for the screening of illegal dyes in foods Conclusion In summary, by combining SPE cleanup and HPLC-MS/MS, an accurate and highly sensitive method was developed to screen 40 dyes in foods Compared ... samples In China, only 10 dyes are permitted to be added to soft drinks (including Tartrazine, Allura Red AC, Erythrosine, Indigo Carmine, Brilliant Blue FCF, Sunset Yellow FCF, Amaranth, Carminic ... limits of detection, recoveries and relative standard deviations (RSDs) of dyes were determined The recoveries were evaluated by controlling the fortification level of each dye in negative soft drink...
  • 6
  • 442
  • 2
DETERMINATION OF ORGANIC COMPOUNDS IN DRINKING WATER BY LIQUID-SOLID EXTRACTION AND CAPILLARY COLUMN GAS CHROMATOGRAPHY/MASS SPECTROMETRY pdf

DETERMINATION OF ORGANIC COMPOUNDS IN DRINKING WATER BY LIQUID-SOLID EXTRACTION AND CAPILLARY COLUMN GAS CHROMATOGRAPHY/MASS SPECTROMETRY pdf

... METHOD 525.2 DETERMINATION OF ORGANIC COMPOUNDS IN DRINKING WATER BY LIQUID-SOLID EXTRACTION AND CAPILLARY COLUMN GAS CHROMATOGRAPHY/MASS SPECTROMETRY 1.0 SCOPE AND APPLICATION 1.1 This ... procedures for determination of organic compounds in finished drinking water, source water, or drinking water in any treatment stage The method is applicable to a wide range of organic compounds that ... portion of the sample into the solvent reservoir The water sample will drain into the cartridge, and from the exit into the suction flask Maintain the packing material in the cartridge immersed in water...
  • 60
  • 528
  • 0
báo cáo hóa học:

báo cáo hóa học: " Method optimization and validation for the simultaneous determination of arachidonic acid metabolites in exhaled breath condensate by liquid chromatography-electrospray ionization tandem mass spectrometry" doc

... screw-cap vial for HPLC analysis and 100 µL of the working solution of the internal standard were added to each sample Then the samples were vortex mixed and a 900 µL aliquot was injected into the LC/MS/MS ... some of the structural isomers of prostaglandins, which resulted in the same parent-daughter ion transitions The whole analytical run time, including the recondition step of the column for the ... to the slope and linearity of the calibration curve Due to the low content of matrix compounds in EBC in contrast to other matrix such as urine or plasma which could influence the response of the...
  • 8
  • 458
  • 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

... as an internal standard, because it was not hydrolysed by PrtA Peak areas were normalized with the internal standard, and the degree of cleavage was calculated from the reduction in the normalized ... position of cleavage sites (vertical arrows, a1 a3 ) and cleavage fragments (horizontal double arrows, A1 A5 ) in the sequence of insulin chain A (B) Change over time in the chromatographic peak area of ... selectively measure activity in biological samples Here we describe the development of such a substrate based on analysis of PrtA cleavage site specificity, and kinetic characterization of PrtA activity...
  • 11
  • 424
  • 0
Tài liệu Báo cáo khoa học: Competition between innate multidrug resistance and intracellular binding of rhodamine dyes pdf

Tài liệu Báo cáo khoa học: Competition between innate multidrug resistance and intracellular binding of rhodamine dyes pdf

... pumping of the agents out of the cells and their passive uptake [10,31] and (b) competition between the active pumping of the agents out of the cells and their intracellular binding to receptors and ... allowing the enhanced uptake of rhodamine dyes inhibited the efflux of these dyes from the cells The efflux of rhodamine 123 and TMRM was inhibited by NBD-Cl and MK571 and, to a lesser extent, by ... they are hydrophobic and negatively charged A comparison of rhodamine uptake, in the presence and the absence of uncouplers, allows the estimation of the effect of intracellular binding on the MDR...
  • 12
  • 651
  • 0
Báo cáo y học:

Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR was run for 35 cycles with each cycle ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofibrosis and ... Detection of the JAK2V617F mutation by asymmetric PCR and melt curve analysis Cancer Biomark 2007, 3:315-324 23 Rapado I, Albizua E, Ayala R, Hernández JA, Garcia-Alonso L, Grande S, Gallardo M, Gilsanz...
  • 7
  • 435
  • 0
báo cáo khoa học:

báo cáo khoa học: " Rapid and accurate pyrosequencing of angiosperm plastid genomes" doc

... Other ycf Pseudogene Figure Plastid genome map of Nandina domestica (Berberidaceae) Plastid genome map of Nandina domestica (Berberidaceae) Map of the plastid genome of Nandina domestica (Berberidaceae), ... (32 bp and 27 bp gaps, respectively) of each genome Genome characteristics The plastid genomes of both Nandina and Platanus possess the typical genome structure observed in most angiosperm plastids, ... generating highly accurate and essentially complete plastid genome sequences of both Nandina and Platanus, for a significant reduction in time and cost over traditional Sanger-based plastid genome...
  • 13
  • 241
  • 0
Báo cáo y học:

Báo cáo y học: "IA simple, fast, and accurate method of phylogenomic inference" docx

... performance of the phylogeny based and the similarity based phylotyping, we carried out a simulation study We determined the sensitivity and specificity of the taxonomic assignments made by AMPHORA and ... 0.1 0.1 0 phylum class order family genus species phylum class order family genus species Figure Comparison of the phylotyping performance by AMPHORA and MEGAN Comparison of the phylotyping performance ... the sensitivity and specificity of phylotyping methods were calculated as described in the report by Krause and coworkers [39] Briefly, for a taxon i, let Pi be the number of query sequences from...
  • 11
  • 453
  • 0
Fast and accurate mapping of next generation sequencing data

Fast and accurate mapping of next generation sequencing data

... due to sequencing errors For NGS sequencers like Illumina and SOLiD, the majority of sequencing errors are of this type The first contribution of this thesis is the introduction of a fast and memory-efficient ... overview of the importance and applications of genomic sequencing We will now present a review of the technologies behind genome sequencing 2.4.1 Sanger Sequencing Sanger sequencing uses the idea of ... from an algorithmic point of view, processing the output of sequencing machines pose two distinct challenges; the volume of the data and sequencing errors The volume of the data will keep on increasing...
  • 185
  • 324
  • 0
Construction of bacterial artificial chromosome library for kineosphaera limosa strain lpha5t and screening of genes involved in polyhydroxyalkanoate synthesis

Construction of bacterial artificial chromosome library for kineosphaera limosa strain lpha5t and screening of genes involved in polyhydroxyalkanoate synthesis

... CONSTRUCTION OF BACTERIAL ARTIFICAL CHROMOSOME LIBRARY FOR Kineosphaera limosa STRAIN Lpha5T AND SCREENING OF GENES INVOLVED IN POLYHYDROXYALKANOATE SYNTHESIS JI ZHIJUAN ... (BAC) library of Kineosphaera limosa strain Lpha5T was constructed in vector pBeloBAC11 Lpha5T BAC library contains 7680 BAC clones with an average insert of 23.5 kb BAC library of Kineosphaera limosa ... isolate and further investigate the genes involved in the metabolisms of PHA in EBPR systems The bacterial isolate was Kineosphaera limosa strain Lpha5T isolated from an inefficient EBPR reactor Lpha5T...
  • 116
  • 492
  • 0
Environmental and Social Impacts of Shrimp farming in Tam Giang lagoon, Vietnam-Local perception

Environmental and Social Impacts of Shrimp farming in Tam Giang lagoon, Vietnam-Local perception

... aquaculture in three coastal shrimp farming communes: Phu An, Phu Da and Vinh Ha in Phu Vang district The links between the impacts of shrimp farming and policies, institutions and farming practices ... Numbers of shrimp households and jobs related to shrimp farming in Phu Vang district, Tam Giang lagoon 44 Table 25 Numbers of jobs in different shrimp farming systems in Tam Giang area ... (1996 cited in CRC, 1998) has summarised major environmental and socioeconomic impacts of shrimp farming in Latin America Many of these same impacts were observed in our study in Tam Giang lagoon,...
  • 130
  • 696
  • 2
UN-REDD programme and the progress of implementing REDD in Vietnam

UN-REDD programme and the progress of implementing REDD in Vietnam

... such as further capacity development and policy and institutional strengthening ⌂ About UN -REDD Vietnam Programme: The question is just focus on the progress of implementing REDD in Vietnam, but ... Meeting, UN -REDD PROGRAMME, 4-5 November 2010, Washington D.C., USA Assessing the Effectiveness of Training and Awareness Raising Activities of the UNREDD Programme in Viet Nam (2009-2011), UN -REDD PROGRAMME, ... research, development and decision- making processes in REDD+ Readiness Which difficulties have been generating in the process of implementing REDD? In the process of implementation of REDD at site,...
  • 6
  • 579
  • 0
English morpheme system and some applications of learning morpheme in establishing words

English morpheme system and some applications of learning morpheme in establishing words

... have introduced some features of English morpheme system as well as its importance in learning English in general and spelling, developing vocabulary in particular It’s also play an 17 English morpheme ... much in learning English Exercise I Count the number of morphemes in each word Underline the bound morphemes alligator calmly running blindness stapler bargain regrouping 18 English morpheme system ... with • Definition, types of English morpheme • Definition, types of Vietnamese morpheme Some suggestions in forming words English morpheme system Luong Thuan & Kim Phuong The methods of the study...
  • 22
  • 2,325
  • 6

Xem thêm

Từ khóa: analysis of the cattle liver proteome by high sensitive liquid chromatography coupled with mass spectrometry methodalzheimer s disease and aged nondemented patients by gas chromatography amp 8211 mass spectrometrya simple fast and accurate method of phylogenomic inferencea simple fast and accurate method of phylogenetic inferencehighly efficient and ultraprecision fabrication of structural ceramic parts with the application of electrolytic in process dressing grindingqpcr assay targeting prot6e and inva genes for fast and accurate detection of salmonella enteritidissong taijun hang 2006 determination of oleanolic acid in human plasma and study of its pharmacokinetics in chinese healthy male volunteers by hplc tandem mass spectrometry journal of pharmaceutical and biomedical analysis 40 1 pphighly sensitive detection of hbv rna in liver tissue by in situ hybridizatione horowitz and sahni fundamentals of data structures in c 2nd editionexplanation of fertilization implantation and the development of the embryo in humanslist and exemplify types of word formation in englisheconomic growth and the balance of payments constraint in latin americadescribe biotic and abiotic parts of an ecosystem in which organisms interactinput and output devices of computer pdf in hindiexample since everyone has sold an item we will get a listing of all of the owners in alphabetical order by last name for future reference and in case anyone asks this type of join is considered to be in the category of inner joins pleaNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015