a simple fast and accurate method of phylogenomic inference
Báo cáo khoa học: "A Fast and Accurate Method for Approximate String Search" pptx
Ngày tải lên :
30/03/2014, 21:20
... Brill and Moore
(2000) proposed employing a generative model for
candidate generation and a hierarchy of trie struc-
tures for fast candidate retrieval. Our approach is
a discriminative approach and ... develop a data structure and
algorithm that can facilitate efficient retrieval of the
top k candidates.
In this paper, we propose a probabilistic approach
to the task. Our approach is novel and unique ... challenging when the
size of vocabulary is large, because there are a large
number of potential candidates to be verified.
In this paper, we propose a probabilistic approach
to candidate generation,...
- 10
- 507
- 0
Tài liệu Báo cáo khoa học: "Fast and Robust Part-of-Speech Tagging Using Dynamic Model Selection" pptx
Ngày tải lên :
19/02/2014, 19:20
... Ogren, Wayne
Ward, James H. Martin, Guergana Savova, and Martha
Palmer. 2010. An architecture for complex clinical
question answering. In Proceedings of the 1st ACM
International Health Informatics ... of the Associa-
tion for Computational Linguistics: Human Language
Technologies, ACL’11, pages 48–52.
Drahom
´
ıra ”johanka” Spoustov
´
a, Jan Haji
ˇ
c, Jan Raab,
and Miroslav Spousta. 2009. Semi-supervised ... in at
least 3 documents of the training data are used. For
a domain-specific model, we use a threshold of 1.
The generalized and domain-specific models are
trained separately; their learning parameters...
- 5
- 455
- 0
Báo cáo khoa học: On the mechanism of a-amylase Acarbose and cyclodextrin inhibition of barley amylase isozymes pdf
Ngày tải lên :
08/03/2014, 08:20
... a- amylases.
Materials and methods
Materials
Barley a- amylases, AMY1 and AMY2, were purified from
green and kilned malt, respectively, according to Svensson
et al. [33] and Ajandouz et al.[9].PurifiedAMY 1and
AMY2 ... AMY1 and AMY2 were thousand-fold
more active toward amylose than toward maltodextrin and
a million-fold more active than toward maltoheptaose.
AMY2 was slightly more active than AMY1. AMY1 and
AMY2 ... hydrolase of family 13
acting on a- 1,4 internal glycoside linkages in starch and
related sugars [1]. a- Amylases occur widely in higher plants,
animals, bacteria and fungi and are applied in several
important...
- 9
- 437
- 0
A meta analysis and risk assessment of heavy metal uptake in common garden vegestable
Ngày tải lên :
15/03/2014, 23:10
... acid (MMA) and dimethyl arsinic acid (DMA). MMA
and DMA are primarily used as agricultural pesticides. Data about the toxicity of organic forms
of arsenic are limited; however, based on available ... quality of data with respect to sample quantitation limits
4 Evaluate the quality of data with respect to qualifiers and codes
5 Evaluate the quality of data with respect to blanks
6 Evaluate ... use of commercially available fertilizers and the disposal of sewage sludges as soil
amendments (Baker et al. 1979; Garcia et al. 1979; Kosla 1986; Peles et al. 1998; Gallardo-Lara
et al. 1999)....
- 64
- 482
- 0
Báo cáo khoa học: "Fast and accurate query-based multi-document summarization" docx
Ngày tải lên :
17/03/2014, 02:20
... Computational Linguistics
FastSum:
Fast and accurate query-based multi-document summarization
Frank Schilder and Ravikumar Kondadadi
Research & Development
Thomson Corp.
610 Opperman Drive, Eagan, ... 2004. Rouge: a package for automatic evaluation
of summaries. In Proceedings of the Workshop on Text
Summarization Branches Out (WAS 2004).
A. Nenkova and L. Vanderwende. 2005. The impact of
frequency ... 2007), pages 757–766,
Banff, Canada.
B. Efron, T. Hastie, I.M. Johnstone, and R. Tibshirani.
2004. Least angle regression. Annals of Statistics,
32(2):407–499.
S. Gupta, A. Nenkova, and D. Jurafsky....
- 4
- 215
- 0
Báo cáo khoa học: "Using Lexical Dependency and Ontological Knowledge to Improve a Detailed Syntactic and Semantic Tagger of English" pot
Ngày tải lên :
17/03/2014, 04:20
... (POS) tagging has been one of the
fundamental areas of research in natural language
processing for many years. Most of the prior re-
search has focussed on the task of labeling text
with tags that ... Nat-
ural Language Processing (Japan), 5:1.
Ezra Black, Andrew Finch, and Hideki Kashioka.
1998. Trigger-pair predictors in parsing and tag-
ging. In Proceedings, 36th Annual Meeting of
the Association ... resampling.
References
E. Black and A. Finch. 2001. Developing and prov-
ing effective broad-coverage semantic -and- syntactic
tagsets for natural language: The atr approach. In
Proceedings of ICCPOL-2001.
E. Black,...
- 8
- 424
- 0
Báo cáo Y học: A comparative biochemical and structural analysis of the intracellular chorismate mutase (Rv0948c) from Mycobacterium tuberculosis H37Rv and the secreted chorismate mutase (y2828) from Yersinia pestis pptx
Ngày tải lên :
17/03/2014, 17:20
... the forward primer 5Â-GG
AATTC
CATATGCAACCCACTCATACGCTAACAAG-3Â
(with the NdeI restriction recognition sequence underlined)
and the reverse primer 5Â-CG
GGATCCTTATTTTAATT
TTACCTGATTGAAGGTTGAG-3Â ... recognition
sequences for cloning into pG58 was: 5 Â-GCTACG
TTTAAAGCGATGATGAGACCAGAACCCCCACATCA
CG-3Â (forward primer with DraI site underlined) and
5Â-CG
GAATTCTTAGTGACCGAGGCGGCCCCTGCC-3Â
(reverse primer ... between Cys148 and Asp155 are somewhat disor-
dered, particularly in the C and D chains, and conse-
quently have increased B-values.
Other methods
CM was assayed by the method of Davidson & Hudson
[34],...
- 12
- 513
- 0
Tuberculosis in Liver Transplant Recipients: A Systematic Review and Meta-Analysis of Individual Patient Data doc
Ngày tải lên :
29/03/2014, 03:20
... the case-fatality rate. For high-risk transplant candidates, isoniazid appears safe and is
probably effective at reducing MTB reactivation. All liver transplant candidates should receive a tuberculin ... Sugawara Y, Nakajima J, Kishi Y, Niiya T,
Kaneko J, Makuuchi M. Resection of a pulmonary lesion
after liver transplantation: report of a case. Surg Today
2005;35:976-978.
37. Alothman A, Al Abdulkareem ... B, Zhang DY.
Intracranial tuberculoma in a liver transplant patient:
first reported case and review of the literature. Am J
Transplant 2003;3:88-93.
43. Al-Moamary MS, Al-Baz S, Alothman A, Memish...
- 13
- 530
- 0
BUSINESS CYCLES: A Theoretical, Historical and Statistical Analysis of the Capitalist Process potx
Ngày tải lên :
29/03/2014, 19:20
... mean only what may be termed passive adap-
tation, i.e., adaptation within the fundamental data of the system. Ad-
aptation may, however, consist in altering some of those data, and
such creative ... Mar-
shallian tradition and to make use of time in order to define another
type of imperfection of equlibrium. What was meant above was the
case of a system so circumstanced as never to reach ... ne-
glected—fact about the capitalist machine.
Third, we will assume that innovations are always associated with
the rise to leadership of New Men, Again, there is no lack of realism
about this assumption,...
- 385
- 416
- 0
Báo cáo khoa học: Mode of action of the microbial metabolite GE23077, a novel potent and selective inhibitor of bacterial RNA polymerase docx
Ngày tải lên :
30/03/2014, 15:20
... bacterial R NA
polymerase.I.Taxonomy,isolation and characterization.
J. Antibi ot. 57, 2 10–217.
20. Plevani, P., Albertini, A .M., Galizzi, A. , Adamoli, A. , M astromei,
G., Riva, S. & Cassani, G. ... of ve subunits (a
2
bbÂx,witha
combined molecular m ass of % 400 kDa) and is capable of
elongation and termination. The initiation-competent Ôholo Õ
RNAP is compo sed of the core enzyme and of ... central role i n DNA transcription, RNAP
is an essential enzyme in bacterial cells and t he target of
different natural antibiotics. Rifampicin, a potent and
broad-spectrum anti-infective agent...
- 9
- 339
- 0
báo cáo hóa học:" A Population-Based and Longitudinal Study of Sexual Behavior and Multidrug-Resistant HIV Among Patients in Clinical Care" pdf
Ngày tải lên :
20/06/2014, 08:20
... cross-sec-
tional and nonquantitative resistance and risk stud-
ies,[9,12,18] and makes it clear that patients' sexual
behavior is not static and changes over time. Some
patients moved in and out of ... sexual behav-
ior and events all vaginal, anal, and oral insertive sexual
events, protected (condom used) and unprotected; and
(3) unprotected sexual behavior and events: unprotected
vaginal, anal, ... both
behavioral and virologic data were available. Seventy-
eight patients contributed 4 matched behavioral and
resistance and viral load results obtained within the same
time period, 99 patients had...
- 8
- 432
- 0
Báo cáo hóa học: " Weak reverse Hölder inequality of weakly A-harmonic sensors and Hölder continuity of A-harmonic sensors" potx
Ngày tải lên :
20/06/2014, 22:20
... each
point a Î D and r <δ(D)/2 the equality
B (a, r)
|du|
p
≤ Cr
n−p+
α
Wang and Bao Journal of Inequalities and Applications 2011, 2011:99
http://www.journalofinequalitiesandapplications.com/content/2011/1/99
Page ... isoperimetric inequality (2.12) for the admissible
pair (F, Ψ), we obtain that
Wang and Bao Journal of Inequalities and Applications 2011, 2011:99
http://www.journalofinequalitiesandapplications.com/content/2011/1/99
Page ... Hölder inequality of weakly A- harmonic sensors and Hölder
continuity of A- harmonic sensors. Journal of Inequalities and Applications 2011 2011:99.
Submit your manuscript to a
journal and benefi...
- 10
- 231
- 0
Báo cáo hóa học: " A simple route to vertical array of quasi-1D ZnO nanofilms on FTO surfaces: 1D-crystal growth of nanoseeds under ammonia-assisted hydrolysis process" pptx
Ngày tải lên :
20/06/2014, 22:20
... ammonia-assisted hydrolysis
process
Akrajas Ali Umar
1*
, Mohd Yusri Abd Rahman
2*
, Rika Taslim
2
, Muhamad Mat Salleh
1
and Munetaka Oyama
3
Abstract
A simple method for the synthesis of ZnO nanofilms ... Universiti
Kebangsaan Malaysia, 43600, Bangi, Selangor, Malaysia
2
College of Engineering, Universiti Tenaga Nasional, 43000, Kajang, Selangor,
Malaysia
Full list of author information is available at the ... SEM) machine model ZEISS SUPRA 55VP that
was operated at an acceleration voltage of 3 kV. The struc-
ture and phase purity of the as prepared and the annealed
samples were characterised using a Bruker...
- 12
- 419
- 0
Báo cáo hóa học: "Simple two-step fabrication method of Bi2Te3 nanowires" pdf
Ngày tải lên :
21/06/2014, 04:20
... during a 10-h annealing at the
Figure 3 Composition analysis of a Bi
2
Te
3
nanowire (a)
A HAADF image of the Bi
2
Te
3
nanowire. (b) EDS line scan profiles
showing the distributions of Bi (cyan, ... Education,
Science and Technology.
Authors’ contributions
J.K carried out this nanowire growth experiment and character analysis and
drafted the manuscript. J-S.N participated in the design of the experiment
and ... manuscript. These whole experiment, analysis, and
manuscript are totally directed by Prof. W.L. All authors read and approved
the final manuscript.
Competing interests
The authors declare that...
- 4
- 225
- 0
Báo cáo hóa học: " Research Article Fast and Accurate Video PQoS Estimation over Wireless Networks" pot
Ngày tải lên :
21/06/2014, 22:20
... for estimating the PQoS
index in a fast and easy way. The proposed analytical model
has an average pearson correlation coefficient of 0.986, as
proof of its robustness and reliability in many network
0.35
0.45
0.55
0.65
0.75
0.85
0.95
1.05
1.15
1.25
1.35
Analytical ... considered also the data traffic generated from other
mobile devices within the AP coverage area; this aggregated
data traffic represents a set of different applications such as
download of audiovideo ... with a
handled device.
(iii) We design an accurate analytical model for real-time
estimation of the perceived quality according to the
network and video parameters. Finally, we verify the
quality...
- 10
- 416
- 0
