The role of CDC42, 1RSP53 and its binding partners in filopodia formation
The role of CDC42, 1RSP53 and its binding partners in filopodia formation
... actin binding proteins (ABPs) which includes the sequestering proteins and the capping proteins Sequestering proteins inhibit polymerization by binding to monomeric G-actin, sequestering them ... modification of the actin network The ABPs have the following activities; Profilin and ADF cofilin bind G- and F-actin and they are mostly concentrated at the leading edge of the cell They promote the ... responsible for the crosslinking, severing, sequestering of monomeric actin subunits and capping of existing actin filaments This group of proteins is collectively known as actin binding proteins (see...
- 341
- 411
- 0
Báo cáo khoa học: "The role of Bcl-xL and nuclear factor-kB in the effect of taxol on the viability of dendritic cells" ppsx
... cytokines than the ContDCs, at 24, 48 h of incubation time (Fig 2) However, the taxol concentration used was critical for the level of cytokine production; μg/ml of taxol induced only marginal ... by that of the β-actin band, and the ratio at h was set at 100% (B) Fig NF-κB involvement in the taxol- induced effects on dendritic cells (DCs) The mobilization of NF-κB p65 molecules in DCs was ... may further confirm their role of taxol- treated DCs Although the expression of Bax was increased in TaxolDCs, the expression of Bax occurred later than that of Bcl-xL, which implies that the pro-apoptotic...
- 5
- 335
- 0
Báo cáo y học: "The role of synovial macrophages and macrophage-produced cytokines in driving aggrecanases, matrix metalloproteinases, and other destructive and inflammatory responses in osteoarthritis" pps
... overproduction of cytokines and growth factors from the inflamed synovium may play a role in the pathophysiology of OA The low-grade OA synovitis is itself cytokinedriven, although the levels of proinflammatory ... in synovial inflammation and in activation of chondrocytes These cytokines can stimulate their own production and induce synovial cells and chondrocytes to produce IL-6, IL-8, and leukocyte inhibitory ... between inflammatory and non -inflammatory OA [14] In mouse models of osteophyte formation induced by injections of transforming growth factor-beta or of collagenase, depletion of macrophages by injection...
- 12
- 325
- 0
The role of nitric oxide and other gaseous mediators in cardiovascular disease models; emphasis on septic shock
... THE ROLE OF NITRIC OXIDE AND OTHER GASEOUS MEDIATORS IN CARDIOVASCULAR DISEASE MODELS: EMPHASIS ON SEPTIC SHOCK FARHANA ANUAR B.Sc.(Hons.), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... pathogenesis of tissue damage incurred by the host in the course of severe sepsis and septic shock 2.3 Evidence for the involvement of NO in sepsis and septic shock 2.3.1 In vivo overproduction of NO in ... types of DNA damage namely (i) the modification of DNA bases via both oxidation and nitration reactions and, (ii) the induction of nicks and breaks in the DNA strand (Szabo & Ohshima, 1997) DNA single-strand...
- 222
- 297
- 0
The cult of guangze zunwang and its religious network in the chinese diaspora, 19th century 2009
... prompted the establishment of Guangze Zunwang temples in the two host countries This study examines the cult of Guangze Zunwang and its religious network connecting Southeast China and the Chinese ... examines the cult of Guangze Zunwang and its religious network connecting Southeast China and the Chinese communities in Singapore and Malaysia as they overlap with the larger forces of In this ... local cults in general and the cult of Guangze Zunwang in particular continue to be the bond between the ethnic Chinese overseas and their ancestral homeland in Southeast China This study examines...
- 133
- 1,627
- 0
Characterisation of the role of bifocal and its interacting partners in drosophila development
... interacting partners and their role in the developing cytoskeleton The work in this thesis focuses on the developing fly eye, the targeting of axons from the eye to the brain and the anchoring of posterior ... and embryonic development The work described in this thesis uses Drosophila as the model organism and deals with the characterisation of an actin binding protein, Bifocal (Bif), its interacting ... critical roles in regulating the guidance of both crossing and non-crossing axons at the ventral midline of the developing vertebrate spinal cord and the Drosophila ventral nerve cord For example, these...
- 187
- 385
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W, Thanki N, Jaenicke R & Wierenga RK (1997) A double mutation at the tip of the dimer interface loop of triosephosphate isomerase generates active Effect of mutation on the dimer interface of...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... both the wild-type protein and mutants E142O and K13 3A Thermal analysis of protein unfolding The DSC curves of the wild-type protein and the mutants K13 3A, E142O, W14 0A and W140O are shown in Fig ... Our CD and DSC data show that the W140 in SNase is the amino acid responsible for the stability of the whole protein However, in comparison with the wild-type protein, the mutant W14 0A retains significant...
- 7
- 551
- 0
Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx
... case of the more general principle of flux minimization It has to be noted, furthermore, that minimization of fluxes in a metabolic system is closely linked to minimization of enzyme levels, because ... protein, protein interactions, enzymes, metabolites) can be used to build up mathematical models of the gene-regulatory, signal-transducing and metabolic networks of a cell and to integrate them into ... given total flux is obviously equivalent to maintaining a given rate of biomass production at a minimum of the total flux Insofar, the principle of maximal biomass production is a special case of...
- 18
- 799
- 0
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786 2957 84 6 3.91 ± 1.06 3.76 ± 1.61 2 .82 ± 0.92 ... Faussner et al Role of helix and C-termini in bradykinin receptors Fig Schematic representation of the C-terminal B1wt and B2wt sequences and chimera thereof The C-terminal sequences beginning at transmembrane...
- 12
- 595
- 0
Báo cáo "The role of color luminescence centers Mn, Cu, Co in the semicondutors with wide band gap ZnS, ZnO and their applications " pptx
... by Cu2+, Mn2+, Co2 + ions [7-11] In this paper, we study the role of color luminescence centers Cu, Mn, Co in the semiconductors with wide band gap of ZnS, ZnO and test application of ZnS:Cu material ... band is greater than that of the blue band As increasing the concentration of Cu, the intensity of the blue band decreases while the intensity of the green band increases and reaches to maximum ... shows the PL spectra of bulk sample ZnO :Co with variation of Co concentration When Co (xCo = 2.10-2 mol%) was doped in ZnO, the presence of Co2 + ions resulted in change in the PL spectrum of ZnO...
- 7
- 466
- 0
Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf
... determined and quantied To ll these gaps, residues Y3 31, R97 and E187 of Sfbgly50 were replaced through site-directed mutagenesis by phenylalanine (Y331F), methionine (R97M), lysine (R97K) and ... stability of the recombinant Sfbgly50 (n) was checked by incubating the enzyme in the same buers for an equal length of time and determining the remaining activity in the pH optimum Fig Inactivation of ... 97 and 3 31 side chains are conserved in the mutants R97M and Y331F, but the hydrogen bond-forming atoms have been removed In mutant E187D, the distance between the catalytic nucleophile and the...
- 10
- 522
- 0
Báo cáo khoa học: Dissecting the role of protein–protein and protein–nucleic acid interactions in MS2 bacteriophage stability potx
... protein–RNA and protein–protein interactions in virus stability, measuring the effects of urea, GdnHCl and high pressure on the structure and stability of whole particles (bacteriophage MS2 and ... the role of protein–protein and protein–RNA interactions in virus stability is not completely understood, and we have investigated these questions in this work We sought to determine the role of ... [5,14] To understand the importance of capsid protein–protein contacts for the stability of coat protein, we determined the stability of dlFG and compared it with the stability of the genetically...
- 13
- 448
- 0
Từ khóa: the role of mtor inhibitors and p13k pathway blockade in rccwhat is the meaning of vocabulary words and its exampleenos uncoupling in cardiovascular diseases the role of oxidative stress and inflammationthe role of teachers schools and communities in quality educationexplain the role of art music and dance in african societythe role of students attitudes and motivation in second language learning in online language coursesthe role of sound music and sound effect in the film industrythe role of oxidative stress and inflammation in dry eye diseasethe role of effective communication and interpersonal interaction in health and social careanalyze the role of critical thinking and education for lifewhat is the role of effective communication and interpersonal interaction in health and social carethe role of oxidative stress and antioxidant treatment in experimental diabetic neuropathythe role of oxidative stress and endothelial injury in diabetic neuropathy and neuropathic painthe role of effective communication and interpersonal interaction in health and social care contextthe role of critical thinking and communication in the construction industryNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ