Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre ... anti-bodies for the transcription factor are available. The assay is the ﬁrst assay suitable for high-throughputmeasurements of transcription factor DNA interac-tions in biological samples. Therefore, ... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts...

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,andPDE1(Lys321–Thr620) was amplified with primers 5¢-GGGAATTCCATATGAAGAATGATCAATCTGGCTGCGGCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGGTTCCCTGTCCAGTGTTACC-3¢. ... African trypanosomeTrypanosoma brucei is the protozoon that causes the fatalhuman sleeping sickness, as well as Nagana, a devastatingdisease of domestic animals in large parts of sub-SaharanAfrica. ... truncated fragments of TbPDE1were also amplified using the same protocol and pET-PDE1as template. PDE1(Arg189–Thr620) was amplified using theprimer pairs 5¢-GGGAATTCCATATGAGAGACAATATTTCCCGTTTATCAAATC-3¢...

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... messages in microblogs. Our system can be regarded as a sentiment-driven, music-based sum-marization framework as well as a novel audiovis-ual presentation of art. MemeTube is designed as a ... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptually, ... In recent years, a number of studies have inves-tigated integrating emotions and music in certain media applications. For example, Ishizuka and Onisawa (2006) generated variations of theme...

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... text spans; for example, because, since, and for this reason are dif- ferent markers for causal relations. Discourse markers are a syntactically quite heterogeneous group of words, many ... found a cheap bar. If one accepts these sentences as paraphrases, then the various discourse markers all need to be associated with the information that they sig- nal a concessive relationship ... that a dedicated discourse marker lexicon holding this kind of information can serve as a valuable resource for natural language pro- cessing. Our efforts in constructing that lexicon are...

Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx

... general, a particular semantic interpretation of a sentence can be characterized by a set of lexical categories (or parts of speech), a syntactic struc- ture, and the semantic annotations associated ... information. Hence, we will show how to annotate a syntax tree so that various interpretations can be characterized differently. Semantic Tagging A popular linguistic approach to annotate a ... from a semantic representation. In general, a particular interpretation of a sentence can be represented by an annotated syntax tree (AST), which is a syntax tree annotated with fea- ture...

Tài liệu Báo cáo khoa học: Seed-based systematic discovery of speciﬁc transcription factor target genes pptx

... tailed primers DARSfw(5¢-ACTACGCGTAGTCCAAGAGAGGAGAAACC -3¢)and DARSrv (5¢-ACTCTCGAGCCCGGAGCGCTGGCGGCCGC-3¢), and NFKBIAfw (5¢-ACTGAGCTCCCGACGACCCCAATTCAAATCG-3¢) and NFKBIArv (5¢-ACTGAAGCTTTGTGGGCTCTGCAGCGCCGC-3¢).The ... expres-sion regulation. Nucleic Acids Res 29, 281–283.4 Sandelin A, Alkema W, Engstrom P, Wasserman WW& Lenhard B (2004) JASPAR: an open-access database for eukaryotic transcription factor binding ... transcription factor target genes that exploits thevast amount of expression information available in public databases today.AbbreviationsCASP4, caspase 4; ChIP, chromatin immunoprecipitation; GAPDH,...

Tài liệu Báo cáo khoa học: Topology, tinkering and evolution of the human transcription factor network doc

... H & Barabasi AL (2000) Error andattack tolerance of complex networks. Nature 406,378–382.36 Ravasz E, Somera AL, Mongru DA, Oltvai ZN & Bar-abasi AL (2002) Hierarchical organization ... Riechmann JL, Heard J, Martin G, Reuber L, Jiang C,Keddie J, Adam L, Pineda O, Ratcliffe OJ, Samaha RRet al. (2000) Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. ... data acquisitionHTFN was built using a speciﬁc transcription factor data-base (TRANSFAC 8.2 professional database) [31]. Werestricted our search to Homo sapiens using the databaseOS (organism)...

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth factor. ... Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane serine proteases (TTSPs) arestructurally ... sets: 5¢-TCCCATCTGTAGCAGCAACT-3¢ and 5 ¢-GGATTTTCTGAATCGCACCT-3¢ for TMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGGGCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢ for HAI-1 (26 cycles). The GAPDH-speciﬁc...

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep24, 1073–1109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... (Hartmann Analytic, Braunschweig, Germany) wasadded. The supernatants were extracted with XAD16 resinafter an additional 2 days of growth. The dried eluate wasdissolved in 10% methanol and analyzed ... on A- domain speciﬁcity prediction and the available tran-scriptome data, can be applied for the initial detectionand isolation of NRPs [20]. Furthermore, thisapproach substitutes the CAS assay- guided...

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... ChinaIntroductionIschaemic heart disease is a life-threatening conditionthat may cause sudden cardiac failure and death.Many researchers have investigated cell transplantationas an alternative treatment for ... Pesce JT, Ramalingam TR, Thompson RW,Kamanaka M, Flavell RA, Keane-Myers A et al. (2007)IL-13Ralpha2 and IL-10 coordinately suppress airwayinflammation, airway-hyperreactivity, and fibrosis ... researchershave suggested that adrenomedullin and hepatocytegrowth factor are paracrine factors secreted by trans-planted MSCs, decreasing myocardial fibrosis [7–9].Whether other paracrine factors...

Xem thêm