TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and Mikko Nikinmaa 1 1 Centre of Excellence in Evolutionary Genetics and Physiology, Department of Biology, University of Turku, Finland 2 Department of Biology, A ˚ bo Akademi University and Turku Centre for Biotechnology, University of Turku and A ˚ bo Akademi University, Finland Introduction Transcription factors are proteins that bind DNA to induce or suppress gene transcription. They function in virtually all biological processes, although their role in transcriptional regulation in eukaryotes is poorly understood [1]. Among the most intensively studied transcription factors is heat shock factor 1 (HSF1). HSF1 binding to its response elements in target gene promoters is an established model system of inductive transcriptional regulatory responses, and studies on HSF1 have yielded important insights into basic cellular and molecular biology and contributed to drug discovery [2–4]. As transcriptional regulation involving specific transcription factors has both basic biological and drug discovery ramifications, there is an increasing demand for quantitative, fast and high- throughput assays of transcription factor function with improved sensitivity and increased analytical range. Keywords DNA-binding activity; HSF1; transcription factor; TransLISA Correspondence K. A. Vuori, Centre of Excellence in Evolutionary Genetics and Physiology, Laboratory of Animal Physiology, Department of Biology, FI-20014, University of Turku, Finland Fax: +358 23336058 Tel: +358 23336263 E-mail: kristiina.vuori@utu.fi Website: http://www.coe.fi (Received 5 September 2009, revised 14 October 2009, accepted 19 October 2009) doi:10.1111/j.1742-4658.2009.07446.x Transcription factors are DNA-binding proteins that regulate key biologi- cal processes. Their interactions with DNA are commonly analyzed with gel-based electrophoretic mobility shift assay (EMSA) using radioactively labeled probes. Within various fields of research, there exists an increasing demand to develop assays with faster sample throughput combined with improved sensitivity, increased analytical range, and precise quantification. Here, we describe the development and performance of a 384-well plate immunoassay, termed TransLISA, which is a novel homogeneous assay for rapid and sensitive quantification of the DNA-binding activity of transcrip- tion factors in cell and tissue lysates. TransLISA outperforms EMSAs, because it eliminates the need to use radioactive chemicals and allows fast and precise quantification of DNA-binding activity of transcription factors from large number of samples simultaneously. We have used TransLISA to demonstrate the DNA-binding activity of heat shock factor 1, representing a well-known model of inductive transcriptional regulatory responses, but the method is easily adaptable for the study of any transcription factor. Thus, TransLISA can replace EMSAs and may be used in various applica- tions and research fields where quantitative, cost-effective and large-scale measurements of the DNA-binding activity of transcription factors are required, including screening of responses in multiple treatments in cellular and molecular biology, evolutionary research, environmental monitoring, and drug discovery. Abbreviations CV, coefficient of variation; EMSA, electrophoretic mobility shift assay; HSE, heat shock element; HSF1, heat shock factor 1; Hsp, heat shock protein; LOCI, luminescent oxygen channeling immunoassay; MEF, mouse embryonic fibroblast. 7366 FEBS Journal 276 (2009) 7366–7374 ª 2009 The Authors Journal compilation ª 2009 FEBS Currently, DNA-binding activities of transcription factors are generally analyzed with electrophoretic mobility shift assays (EMSAs) [5,6]. Cell or tissue extracts are mixed with a radiolabeled oligonucleotide probe containing the binding site for the transcription factor of interest. Binding reactions are run in non- denaturating polyacrylamide gels (PAGE). Gels are dried and exposed to X-ray film overnight or longer (Fig. 1A). The intensity of the resulting bands, gener- ally 15 per gel at most, can be quantified with imaging software. However, EMSA is time-consuming, does not allow high-throughput analysis, and provides only descriptive or semiquantitative results. In addition, it produces considerable amounts of radioactive and other waste. Recently, Iwasaki et al. [7] described a liquid chemiluminescent DNA pull-down assay. The method measures DNA binding of transcription factors, and can thus replace EMSA. However, the method uses previously tagged proteins, and cannot, therefore, be generally used in quantitative studies of transcription factor–DNA interactions in biological samples. A variety of other methods, such as DNase footprinting [8], chromatin immunoprecipitation [9], yeast one-hybrid screens [10], and protein binding microarrays [11], exist for investigating transcription factors and transcriptional regulation, but the main purpose of using these methods is not in quantifying transcription factor–DNA binding. Our goal was to develop a fast and versatile assay for detecting and quantifying transcription factor– EMSA AB TransLISA HSE P B 30 min 30 min Incubation 1.5 mL tube Incubation 1.5 mL tube 2 h + A 30 min PAGE Pipet to plate, add A beads and incubate +16 h D 1 h Autoradiography Add D beads and incubate D A O 2 Read AlphaLISA si g nal at 615 nm HSE Fig. 1. Comparison of EMSA and TransLISA for the detection of HSF1–DNA binding activity. (A) Schematic presentation of EMSA assay. Cell or tissue extracts or peptides are incubated with radioactively labeled (c 32 P) probe containing HSF1-binding sites. Binding reactions are run in nondenaturating polyacrylamide gel. Gels are dried and exposed to X-ray film overnight or longer. The amounts of DNA-bound HSF1 complexes in the samples are detected by band intensities in the autoradiograph. (B) Schematic presentation of TransLISA. Cell or tissue extracts or peptides are incubated with biotin-labeled probe containing HSE. Aliquots of binding reactions are pipetted into a 384-well plate, and acceptor beads containing antibody against HSF1 are added to the wells. After incubation, streptavidin-coated donor beads are added, and plates are covered and incubated at room temperature in the dark. When the acceptor beads are brought into proximity to the donor beads via HSF1–DNA interactions, singlet oxygen generated by excitation at 680 nm initiates a series of luminescent energy transfers between compounds in the acceptor beads. The resulting emission is read at 615 nm with a plate reader. K. A. Vuori et al. TransLISA FEBS Journal 276 (2009) 7366–7374 ª 2009 The Authors Journal compilation ª 2009 FEBS 7367 DNA binding in biological samples. Our assay is based on the no-wash ELISA platform AlphaLISA (ampli- fied luminescence proximity homogeneous) (Perkin- Elmer, Boston, MA, USA), which is an application of the luminescent oxygen channeling immunoassay (LOCI) technology [12,13]. The principle of Alpha- LISA is based on the proximity of ‘donor’ and ‘accep- tor’ beads coated with different biomolecules. When the acceptor beads are brought in proximity to the donor beads via molecular interactions, singlet oxygen generated in the donor bead by laser excitation at 680 nm initiates a series of luminescent energy trans- fers in the acceptor beads. This results in emission at 615 nm when the AlphaLISA acceptor beads are used. In the absence of biological interaction, the singlet oxygen molecules produced remain undetected. LOCI technology and AlphaLISA were initially applied in a configuration where the analyte was bound by anti- bodies on the beads bearing different epitopes [12]. The technology, however, is extremely versatile, and may be applied to the measurement of, for example, enzyme activity, receptor–ligand interactions, second messenger levels, DNA, proteins, and carbohydrates. We selected HSF1 as a model transcription factor for our assay development because the activation of the heat shock response has been extensively studied. The best known promoter among the HSF⁄ HSF1- responsive genes is the Hsp70 promoter, which is a well-characterized model for inductive transcriptional responses [2]. HSF1 is essential in many biological pro- cesses, and plays a significant role in cancer, neurode- generative diseases, aging, and longevity [3]. HSF1 belongs to an evolutionarily well-conserved family of transcription factors, with one HSF in yeast, nematode worms and fruit flies, and four members, HSF1–HSF4, in vertebrates. HSF1 is required for the heat shock response, which is triggered by proteotoxic stressors such as elevated temperature and heavy metals. Upon activation, HSF1 trimerizes, undergoes hyperphosph- orylation, and binds to heat shock elements (HSEs) in the promoters of heat shock genes, which code for heat shock proteins (Hsps), molecular chaperones that facilitate correct folding of nascent and misfolded proteins [2]. Here, we describe the development and performance of a 384-well plate immunoassay, named TransLISA, for measuring the DNA-binding activity of a transcrip- tion factor (Fig. 1B). This assay is the first homoge- neous, nonradioactive assay for rapid and sensitive quantification of the DNA binding of transcription factors in cell and tissue lysates. Although we have developed the assay using HSF1, it can easily be adapted for the study of any transcription factor. The method can thus replace EMSA whenever oligonucleo- tides containing response elements and specific anti- bodies for the transcription factor are available. The assay is the first assay suitable for high-throughput measurements of transcription factor–DNA interac- tions in biological samples. Therefore, it can be used in various research applications, especially when mea- surements of tens, hundreds or thousands of samples are needed. Such applications may include screening of cellular responses in multiple treatments, drug discov- ery, evolutionary research on transcriptional regula- tion, and monitoring of transcription factor–DNA binding in environmental samples. Results Optimization of probe and protein extract concentrations Optimal assay conditions were established for both the biotinylated HSE1 oligonucleotide probe and protein extract concentrations. First, increasing concentrations (working concentration 1–250 nm; 0.05–12.5 nm in the incubation reaction) of biotinylated oligonucleotide probe were applied to 20 lL of incubation reactions containing 10 lg of control or heat-shocked HeLa or mouse embryonic fibroblast (MEF) protein extracts. For HeLa cells, the optimal probe concentrations were determined to be 30, 100 or 150 nm, at which the dif- ferences between the HeLa cell control and heat- shocked samples were greatest: 5.0-fold, 4.6-fold, and 4.8-fold, respectively (Fig. 2A). For MEFs, the optimal probe concentrations were determined to be 100 or 150 nm, at which the differences between the MEF control and heat-shocked samples were 3.0-fold and 3.4-fold, respectively (Fig. 2B). For clarity, a 150 nm working concentration of the probe was selected for use in all assays. The optimal protein extract concentrations in the first incubation reaction were tested with the HeLa cell and MEF control and heat-shocked samples by adding 1, 5 or 10 lg of protein extract to the 20 lL reactions. The greatest difference between HeLa cell control and heat-shocked samples (11.2-fold) was obtained with 5 lg of total protein (Fig. 3A), and the greatest difference between MEF control and heat-shocked samples (17.4-fold) was achieved with 10 lg of total protein (Fig. 3B). As the HeLa cell incubation reac- tions with 5 and 10 lg of protein gave very similar results, 11.2-fold or 10.4-fold difference, respectively, between control and heat-shocked samples, 10 lgof total protein in a 20 lL initial binding reaction was selected for use in all assays. TransLISA K. A. Vuori et al. 7368 FEBS Journal 276 (2009) 7366–7374 ª 2009 The Authors Journal compilation ª 2009 FEBS We also tested the default assay protocol in which 2.5 lL of sample, 2.5 lL of probe and 10 lL of accep- tor beads were first added to the plate wells and incu- bated for 30 min at 4 °C, and this was followed by addition of 10 lL of donor beads and 1 h of incuba- tion at room temperature before reading. This type of assay setup, however, resulted in only 4.1-fold and 6.3- fold differences between HeLa cell and MEF control, respectively, and heat-shocked samples (Fig. 3A,B). Therefore, we concluded that the best resolution of the assay is achieved by including the first 30 min incuba- tion step, which allows the protein–DNA complexes to form, as in EMSA. Competition experiments Competition experiments are used to confirm the speci- ficity of the DNA-binding reaction in EMSA. In our competition experiments, both unlabeled HSE probe and blocking of the antibody with HSF1 peptide abolished the signal in a dose-dependent manner (Fig. 4A,B). EC50 values for unlabeled HSE probe and blocking of the antibody with HSF1 peptide were 1.05 and 2.59 nm, respectively. Furthermore, replacing the correct HSE probe with mutated probe or with a nonsense ‘scrambled’ probe [14] (Table 1) did not result in any signal (Fig. 4C). These experiments thus confirm that the assay specifically measures HSF1 DNA-binding activity. Analytical range and precision The analytical range of the assay was evaluated using known concentrations of recombinant human HSF1 instead of cell extract in the assay. It has previously been demonstrated that recombinant HSF1 can form DNA-bound complexes [15]. The signal increased in a dose-dependent manner from 0.1 to 10 nm of recombi- nant HSF1 in the binding reaction, indicating that the assay can detect up to 100-fold differences in HSF1 0 5 10 15 20 25 30 35 40 110 Counts ×10 3 HeLa Control Heat shock 0 5 10 15 20 25 30 35 10 Counts ×10 3 MEF Control Heat shock 0.01 0.1 nM Probe 0.01 0.1 1 nM Probe A B Fig. 2. Optimization of probe concentrations. Increasing concentra- tions (working concentration of 1–250 n M; 0.05–12.5 nM in the incu- bation reaction) of biotinylated oligomer probe were applied to incubation reactions containing 10 lg of control and heat-shocked HeLa cell (A) and MEF (B) protein extracts. Circles represent the mean counts of triplicate wells, and the error bars represent stan- dard deviations of triplicate well counts. The concentrations on the x-axes are concentrations in the incubation reaction. 150 MEF 200 HeLa 50 100 100 150 1 µg protein 5 µg protein 10 µg protein Default 0 Counts ×10 3 0 50 Control Heat shock Control Heat shock Counts ×10 3 1 µg protein 5 µg protein 10 µg protein Default A B Fig. 3. Optimization of protein extract amounts. The optimal pro- tein extract amounts in the first incubation reaction were tested with the HeLa cell (A) and MEF (B) control and heat-shocked sam- ples by adding 1, 5 or 10 lg of protein extract to the reactions. In addition, testing of the default protocol using the same samples without the initial incubation step was included. The probe concen- tration was the same (working concentration of 150 n M; 0.75 nM in the well) for all of the optimizations. The bars represent the mean counts of triplicate wells, and the error bars represent standard deviations of triplicate well counts. K. A. Vuori et al. TransLISA FEBS Journal 276 (2009) 7366–7374 ª 2009 The Authors Journal compilation ª 2009 FEBS 7369 DNA-binding activity (Fig. 5). The signal decreased in 50 and 500 nm recombinant HSF1 when compared to the counts of 10 nm HSF1 peptide sample. This is due to the ‘hook effect’, whereby the signal increases with increasing target molecule concentration up to a cer- tain point, after which the target molecule becomes inhibitory in the reaction because of the saturation of the available binding sites [16]. The dissociation con- stant, K d , determined from the recombinant HSF1 DNA-binding experiment was 6.27 nm. The sample-specific intraplate variability was assessed by pipetting specific samples in different, ran- domly selected positions within the plate. In eight of 11 cases, the total coefficient of variation (CV) value of the wells was less than 10%, and in only one of 11 cases was the CV value of the wells unacceptably high (19.3%) (Table 2). The interassay variation was assessed by using the same samples in three or four independent assays on different days. The interassay variation in sample- 100 120 A B C Heat shock 120 140 Heat shock 40 60 80 40 60 80 100 0 20 nM Unlabeled HSE 0 20 nM HSF1 100 120 140 160 20 40 60 80 Counts ×10 3 Counts ×10 3 Counts ×10 3 0 0.1 1 10 100 0.01 0.1 1 10 100 Heat shock Mutated Scrambled Fig. 4. Competition experiments. (A) Unlabeled HSE probe in the incubation reaction abolished the signal of HeLa cell heat-shocked sample in a dose-dependent manner. The units on the x-axes are concentrations in the incubation reaction. The signal level of untreated sample is indicated by the label ‘Heat shock’ on the graph. (B) Blocking the antibody with recombinant HSF1 peptide abolished the signal of HeLa cell heat-shocked sample in a dose-dependent manner. The units on the x-axes are concentrations in the acceptor bead preincubation reaction. The signal level of untreated sample is indicated by the label ‘Heat shock’ on the graph. (C) Replacing the correct HSE probe with mutated probe or with a nonsense ‘scram- bled’ probe resulted in an absence of signal. The circles represent the mean counts of triplicate wells, and the error bars represent standard deviations of triplicate well counts. Table 1. 5¢-Biotinylated and standard oligonucleotides used in TransLISA development. The core DNA-binding sequences are indi- cated with underlining and mutated nucleotides with bold letter. Oligonucleotide Sequence (5¢-to3¢) HSE sense Biotin-TCGACTA GAAGCTTCTAGAAGCTTCTAG HSE antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ×10 3 0 20 0.01 0.1 1 10 100 nM HSF1 Fig. 5. The analytical range of the assay was evaluated using known concentrations of recombinant human HSF1 protein instead of cell extract in a normal assay procedure. The circles represent the mean counts of triplicate wells, and the error bars represent standard deviations of triplicate well counts. The units on the x-axis are concentrations in the incubation reaction. TransLISA K. A. Vuori et al. 7370 FEBS Journal 276 (2009) 7366–7374 ª 2009 The Authors Journal compilation ª 2009 FEBS specific signal (counts) is shown in the top panel of Fig. 6. All of the results obtained from independent assays were in line with each other, indicating good reproducibility of the assay. The CV values of within- assay triplicates for each sample on different days (dots) and the percentage variation between different assays (line) are shown in the bottom panel of Fig. 6. The within-assay triplicate CV values were consistently below 10%. The percentage interassay variation of sig- nals (sample-specific CV values between assays run on different days) was 8.3–15.1%, with the exception of one sample, where the variation was 22.5%. Measurements of biological samples We measured three biological replicates of control, heat-shocked and recovering HeLa cell and MEF sam- ples (Fig. 7A,B). The results show, on average, 8.4-fold induction of HSF1 DNA-binding in heat-shocked HeLa cells, and, on average, 25.8-fold induction of HSF1 DNA-binding in heat-shocked MEFs when compared to the untreated cells. The results are well in line with the results obtained from EMSA (representa- tive images of HeLa cell and MEF control, heat shock and recovery are shown in Fig. 7A,B, top left panels), and with previously published results [17]. We also examined the time course of induction of HSF1 DNA-binding activity in HeLa cells and MEFs 140 40 60 80 100 120 20 30 0 20 01234567891011 Counts ×10 3 Samples 0 10 Fig. 6. The interassay variation in sample-specific signals. The inter- assay variation was assessed using the same samples in three or four independent assays performed on different days. The circles in the top panel represent the mean counts of triplicate wells in one assay. The results of independent assays for specific samples indi- cated by different colors. All of the results given by independent assays are in line with each other. (B) The circles in the bottom panel represent the CV values of within-assay triplicates for each sample on different days, and the lines represent percentage varia- tion between different assays for each sample. 100 120 140 HeLa 60 70 80 90 MEF C A B HS R CHSR 40 60 80 Counts ×10 3 30 40 50 Counts ×10 3 0 20 0 10 20 Control Heat shock Recovery Control Heat shock Recovery Fig. 7. The DNA-binding activity of HSF1 in biological samples. Three biological replicates of control, heat-shocked and recovering HeLa cell samples (A) and MEF samples (B) were measured with TransLISA. The bars represent the mean counts of triplicate wells, and the error bars represent standard deviations of triplicate well counts. The results of three replicates are shown in different col- ors. Representative EMSA autoradiographs of HeLa cell and MEF control (C), heat shock (HS) and recovery (R) are shown in the top left panels. Table 2. The sample-specific intraplate variability was assessed by pipetting specific samples at different, randomly selected positions within the plate. Sample Intraplate averages CV% Wells S1 56 612 7.6 9 S2 73 727 5.7 9 S1 53 686 6.9 9 S1 48 659 4.4 9 S3 18 010 12.5 9 S4 3534 3.7 8 S5 22 490 10.2 8 S2 80 224 6.3 6 S4 3871 19.3 6 S2 67 068 5.1 6 S6 93 760 4.5 6 K. A. Vuori et al. TransLISA FEBS Journal 276 (2009) 7366–7374 ª 2009 The Authors Journal compilation ª 2009 FEBS 7371 after 0 to 40 (HeLa) or 0 to 60 (MEF) min of heat shock (Fig. 8A,B). The results indicate a very fast response in both HeLa cells and MEFs; the DNA- binding activity of HSF1 increased markedly already after 10 or 15 min when cells were exposed to heat shock. These results agree with those of earlier studies [17,18]. Discussion In this study, we have established a 384-well plate, nonradioactive, homogeneous immunoassay for quan- tifying the DNA-binding activity of the transcription factor HSF1 in cell extracts. In comparison with the traditional method, EMSA, the novel TransLISA assay is superior in many ways. This assay eliminates the use of radioactivity and the need to run gels, and gives results much more rapidly; also, the plate format enables cost-effective high-throughput sample analysis. The homogeneous assay format excludes the need for any washing steps between the addition of reagents. The broad analytical range of the assay allows quanti- tation of large differences in the DNA-binding activity of transcription factors. This is precluded in EMSA analysis, owing to overexposure of the autoradiograph when visualizing both strong and weak signals at the same time. In addition, given the versatility of the AlphaLISA platform, the detection of DNA-bound transcription factors can easily be modified by using different antibodies to either full-length or specific epitopes of the protein, or to different tags. The anti- bodies may be either directly coated on the acceptor beads or indirectly captured with protein A on the acceptor bead. The optimal assay conditions may natu- rally vary, and need to be determined for each tran- scription factor specifically. The assay conditions selected and interpretation of the results also depend on the research application, e.g. screening or determin- ing binding affinities for transcription factor–DNA binding. The results of measurements of HSF1 DNA-binding activity from HeLa cells and MEFs are in line with results reported in several other papers. The DNA binding is induced within minutes of heat shock and, depending on the temperature, is sustained during pro- longed heat treatment for up to 3 h [18]. Attenuation of the DNA binding is caused by acetylation of HSF1 and increased Hsp expression in a negative feedback loop [3,19,20]. HSF1 binds to DNA in trimer form, whereby an individual HSF1 recognizes a pentameric sequence nGAAn through the DNA-binding domain. Stable binding requires simultaneous binding of all DNA-binding domains in a trimer to three adjacent nGAAn repeats. Therefore, a functional HSE contains at least three nGAAn repeats. The promoters of most Hsp genes contain more than one HSE, allowing for multiple HSF1 molecules to bind simultaneously. In addition, HSF1 molecules bind to HSEs in a coopera- tive manner, so that binding of one trimer facilitates the binding of the next [2]. In this study, we have specifically analyzed the DNA-binding activity of HSF1 as a quantitative model. However, it is possible to establish TransLISA assays for any transcription factor from any species when the consensus binding sites are known and spe- cific antibodies for the transcription factor are avail- able. The assay described here may thus serve to initiate further development of quantitative, cost-effec- tive and large-scale measurements of the DNA binding of transcription factors in biological samples, both in basic research and drug discovery. Experimental procedures Cell culture, treatments and sample preparation HeLa cells were cultured in DMEM supplemented with 10% fetal bovine serum, 2 mml-glutamine, penicillin, and streptomycin, and MEFs were maintained in DMEM sup- plemented with 10% fetal bovine serum, 1.2 mm sodium pyruvate, l-glutamine, penicillin, and streptomycin. All cells were maintained at 37 °C in a humidified 5% CO 2 atmo- sphere. Heat shock treatment was performed in a 42 °C (HeLa cells) or 43 °C (MEFs) water bath for the indicated times. The recovery samples were heat-shocked for 1 h, and then incubated at 37 °C for 3 h. Sample preparation and EMSA were performed as described previously [5]. The protein contents of samples were determined with the Bradford method, using the BioRad Protein Assay (BioRad, Espoo, Finland) with BSA (Sigma-Aldrich, St Louis, MO, USA) as the standard. Assay components Streptavidin-coated donor beads and protein A-coated AlphaLISA acceptor beads were from PerkinElmer (Bos- ton, MA, USA). The polyclonal rabbit HSF1 antibody (SPA-901) and HSF1 peptide (SPP-900) were from Stress- gen (Ann Arbor, MI, USA). Low-crosstalk white 384-well Optiplates were from PerkinElmer. 5¢-Biotinylated and standard oligonucleotides (Table 1) were purchased from Oligomer (Helsinki, Finland). The assay buffer (pH 7.4) contained 25 mm Hepes (Sigma-Aldrich, St Louis, MO, USA), 1 mgÆmL )1 Dextran T-500 (Sigma-Aldrich), 0.1% Triton X-100 (SERVA Electrophoresis GmbH, Heidelberg, Germany), and 0.1% casein (Pierce, Rockford, IL, USA). All of the other chemicals were of analytical grade. TransLISA K. A. Vuori et al. 7372 FEBS Journal 276 (2009) 7366–7374 ª 2009 The Authors Journal compilation ª 2009 FEBS Probe preparation Sense and antisense oligonucleotides were both added to Tris ⁄ EDTA buffer (pH 8.0) to a final concentration of 150 nm, denatured for 10 min at 95 ° C on a heat block, and allowed to anneal until the block temperature had decreased to room temperature. Assay procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads in the plate wells, and addition of donor beads with incubation (Fig. 1B). The assay started with a 30 min initial incubation of samples with biotinylated oligo- nucleotide probe on ice in Eppendorf tubes for formation of transcription factor–DNA complexes. First, for optimiza- tion, 1–10 lg of protein extracts was incubated with 1 lLof 1–250 nm biotinylated oligonucleotide probe in a 20 lL reac- tion in binding buffer (containing 10 mm Tris, pH 7.5, 50 mm NaCl, 4 mm EDTA, 20% glycerol), and 1 lgof poly(dIdC) (Sigma-Aldrich, St Louis, MO, USA). After opti- mization (see Results), 10 lg of protein and 150 nm probe were selected for use in the consecutive assays. After the ini- tial incubation step, 2 lL of protein extract ⁄ probe mix was pipetted into the plate wells in triplicate, and 9 lL of protein A acceptor beads (working concentration of 50 lgÆmL )1 ) preincubated for 1 h with antibody against HSF1 (working concentration of 2 lgÆmL )1 ) was added. The plates were cov- ered and incubated at 4 °C in the dark for 30 min. Nine microliters of streptavidin-coated donor beads (working con- centration of 50 lgÆmL )1 ) was then added, and the plates were covered and incubated at room temperature in the dark for 1 h. The plates were read with an Envision Xcite instru- ment (PerkinElmer Wallac, Turku, Finland). The final con- centrations of the assay components in the wells were as follows: probe, 0.75 nm; antibody, 0.8 lgÆmL )1 ; acceptor and donor beads, both 20 lgÆmL )1 . The amounts of protein extract and poly(dIdC) in the wells were 1 lg and 0.1 lg, respectively. Competition experiments For competition experiments with unlabeled probe, 1.5 lm (10-fold excess) of unlabeled sense and antisense oligonucle- otides were mixed, and the probe was prepared as described above. Selected protein extracts were first incubated with 0.75–75 nm unlabeled probe on ice for 30 min, as described above, and this was followed by addition of 1 lLof 150 nm biotinylated oligonucleotide probe and an addi- tional 30 min incubation on ice. Two microliters of protein extract ⁄ probe mix was pipetted into the plate wells. Subse- quent bead addition and incubation steps were as described above. For competition experiments with the antibody- blocking HSF1 peptide, selected protein extracts were incu- bated with biotinylated probe and pipetted into the plate wells as described above. Nine microliters of protein A acceptor beads (working concentration of 50 lgÆmL )1 ) preincubated for 1 h with antibody against HSF1 (working concentration of 2 lgÆ mL )1 ) and 0.06–312.5 nm HSF1 pep- tide was then added to the wells. Thereafter, the assay was continued as described above. Acknowledgements This work was supported by Center of Excellence Grants from the Academy of Finland and University of Turku (M. Nikinmaa and K. A. Vuori), the Academy of Finland and A ˚ bo Akademi University 120 140 A B 70 80 0102040 0153060 60 80 100 30 40 50 60 0 20 40 Counts ×10 3 0 10 20 0 102040 0153060 Counts ×10 3 Minutes Minutes Fig. 8. Time course of HSF1 DNA-binding activity in HeLa (A) and MEF (B) cell samples. The length of heat shock treatment in min- utes is indicated on the x-axis. The bars represent the mean counts of triplicate wells, and the error bars represent standard deviations of triplicate well counts. Representative EMSA autoradiographs of corresponding samples are shown in the top left panels. The num- bers above the autoradiograph indicate the length of heat shock treatment in minutes. K. A. Vuori et al. TransLISA FEBS Journal 276 (2009) 7366–7374 ª 2009 The Authors Journal compilation ª 2009 FEBS 7373 (L. Sistonen), and the Turku Graduate School of Biomedical Sciences (J. K. Ahlskog). References 1 Wray G, Hahn M, Abouheif E, Balhoff J, Pizer M, Rockman M & Romano L (2003) The evolution of transcriptional regulation in eukaryotes. Mol Biol Evol 20, 1377–1419. 2 Anckar J & Sistonen L (2007) Heat shock factor 1 as a coordinator of stress and developmental pathways. Adv Exp Med Biol 594, 78–88. 3 Morimoto R (2008) Proteotoxic stress and inducible chaperone networks in neurodegenerative disease and aging. Genes Dev 22, 1427–1438. 4 Akerfelt M, Trouillet D, Mezger V & Sistonen L (2007) Heat shock factors at a crossroad between stress and development. Ann NY Acad Sci 1113, 15–27. 5 Mosser D, Theodorakis N & Morimoto R (1988) Coor- dinate changes in heat shock element-binding activity and HSP70 gene transcription rates in human cells. Mol Cell Biol 8, 4736–4744. 6 Kerr L (1995) Electrophoretic mobility shift assay. Methods Enzymol 254, 619–632. 7 Iwasaki T, Miyazaki W, Rokutanda N & Koibuchi N (2008) Liquid chemiluminescent DNA pull-down assay to measure nuclear receptor–DNA binding in solution. BioTechniques 45, 445–448. 8 Galas D & Schmitz A (1978) DNAse footprinting: a simple method for the detection of protein–DNA binding specificity. Nucleic Acids Res 5, 3157–3170. 9 Orlando V (2000) Mapping chromosomal proteins in vivo by formaldehyde-crosslinked-chromatin immunoprecipitation. Trends Biochem Sci 25, 99–104. 10 Fields S & Song O (1989) A novel genetic system to detect protein–protein interactions. Nature 340, 245–246. 11 MacBeath G & Schreiber S (2000) Printing proteins as microarrays for high-throughput function determina- tion. Science 289, 1760–1763. 12 Ullman E, Kirakossian H, Singh S, Wu Z, Irvin B, Pease J, Switchenko A, Irvine J, Dafforn A & Skold C (1994) Luminescent oxygen channeling immunoas- say: measurement of particle binding kinetics by chemiluminescence. Proc Natl Acad Sci USA 91, 5426–5430. 13 Ullman E, Kirakossian H, Switchenko A, Ishkanian J, Ericson M, Wartchow C, Pirio M, Pease J, Irvin B, Singh S et al. (1996) Luminescent oxygen channeling assay (LOCI): sensitive, broadly applicable homo- geneous immunoassay method. Clin Chem 42, 1518–1526. 14 Anckar J, Hietakangas V, Denessiouk K, Thiele D, Johnson M & Sistonen L (2006) Inhibition of DNA binding by differential sumoylation of heat shock fac- tors. Mol Cell Biol 26, 955–964. 15 Sarge K, Murphy S & Morimoto R (1993) Activation of heat shock gene transcription by heat shock factor 1 involves oligomerization, acquisition of DNA-binding activity, and nuclear localization and can occur in the absence of stress. Mol Cell Biol 13, 1392–1407. 16 Tate J & Ward G (2004) Interferences in immunoassay. Clin Biochem Rev 25, 105–120. 17 Abravaya K, Phillips B & Morimoto R (1991) Attenua- tion of the heat shock response in HeLa cells is medi- ated by the release of bound heat shock transcription factor and is modulated by changes in growth and in heat shock temperatures. Genes Dev 5, 2117–2127. 18 Abravaya K, Phillips B & Morimoto R (1991) Heat shock-induced interactions of heat shock transcription factor and the human hsp70 promoter examined by in vivo footprinting. Mol Cell Biol 11, 586–592. 19 Westerheide S, Anckar J, Stevens SJ, Sistonen L & Morimoto R (2009) Stress-inducible regulation of heat shock factor 1 by the deacetylase SIRT1. Science 323, 1063–1066. 20 Shi Y, Mosser D & Morimoto R (1998) Molecular chaperones as HSF1-specific transcriptional repressors. Genes Dev 12, 654–666. TransLISA K. A. Vuori et al. 7374 FEBS Journal 276 (2009) 7366–7374 ª 2009 The Authors Journal compilation ª 2009 FEBS . TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea. Biotin-TCGACTA GAAGCTTCTAGAAGCTTCTAG HSE antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts