TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei Stefan Kunz 1 , Thomas Kloeckner 2 , Lars-Oliver Essen 3, *, Thomas Seebeck 1 and Michael Boshart 2 1 Institute of Cell Biology, University of Bern, Switzerland; 2 Department of Biology I, University of Munich, Germany; 3 Max Planck Institute for Biochemistry, Martinsried, Germany Cyclic nucleotide specific phosphodiesterases (PDEs) are important components of all cAMP signalling networks. In humans, 11 different PDE families have been identified to date, all of which belong to the class I PDEs. Pharmaco- logically, they have become of great interest as targets for the development of drugs for a large variety of clinical condi- tions. PDEs in parasitic protozoa have not yet been exten- sively investigated, despite their potential as antiparasitic drug targets. The current study presents the identification and characterization of a novel class I PDE from the para- sitic protozoon Trypanosoma brucei, the causative agent of human sleeping sickness. This enzyme, TbPDE1, is encoded by a single-copy gene located on chromosome 10, and it functionally complements PDE-deficient strains of Sac- charomyces cerevisiae. Its C-terminal catalytic domain shares about 30% amino acid identity, including all functionally important residues, with the catalytic domains of human PDEs. A fragment of TbPDE1 containing the catalytic domaincouldbeexpressedinactiveforminEscherichia coli. The recombinant enzyme is specific for cAMP, but exhibits a remarkably high K m of > 600 l M for this substrate. Keywords: African trypanosomes; cAMP signaling; class I phosphodiesterase; sleeping sickness. Cyclic AMP is involved in the regulation of numerous biological functions, such as the control of metabolic pathways in eubacteria [1], differentiation and virulence in fungi [2], cell aggregation in Dictyostelium [3], transduction of gustatory and olfactory signals [4], the control of rhythmic oscillations in heart and brain [5] and learning and long-term memory formation [6] in multicellular organisms. In eukaryotic cells, hydrolysis of cAMP by cyclic nucleotide specific phosphodiesterases (PDEs) is the only means of rapidly inactivating the cAMP signal. PDEs represent a large and divergent group of enzymes, and two distinct PDE classes have been identified [7,8]. Class I enzymes include all currently known families of mammalian PDEs,aswellasanumberofPDEsfromlowereukaryotes, such as PDE2 from the yeast Saccharomyces cerevisiae [8] or the product of the regA gene of Dictyostelium discoideum [9]. In mammals, 11 distinct class I PDE families have been identified, based on DNA sequence analysis and on the pharmacological profiles of the enzymes [10,11]. At the amino acid level, family members exhibit > 50% sequence identity within a conserved catalytic core of about 250 amino acids. Between families, the sequence identity drops to 30–40% in the same region [12], and no significant similarity is found outside the catalytic domain. Considering the importance of the PDEs for signal transduction, it is not unexpected that mutations in PDE genes have been recognized as the underlying cause of several genetic diseases [13–15]. In clinical pharmacology, the PDEs have also become highly attractive targets for drug development, and a large number of highly family- specific inhibitors have been developed. PDE inhibitors are under exploration, or already in clinical use, for ailments as diverse as autoimmune diseases, arthritis, asthma, impo- tency and as anti-inflammatory agents (reviewed in [16–18]). In view of the spectacular success of PDE inhibitors as chemotherapeutics, it is surprising how little effort has been made so far to explore the PDEs of parasites as potential targets for antiparasitic drugs. The African trypanosome Trypanosoma brucei is the protozoon that causes the fatal human sleeping sickness, as well as Nagana, a devastating disease of domestic animals in large parts of sub-Saharan Africa. While many aspects of trypanosome cell biology have been extensively studied, very little is still known about cAMP signalling [19–22]. Early work has shown that the steady-state concentration of cAMP varies during the life cycle of the parasite in its mammalian host [23]. Vassella et al. have provided evidence for a crucial role of cAMP in triggering population-density induced differentiation of long-slender to short-stumpy bloodstream forms in culture [24]. An early study on PDEs demonstrated PDE activity in cell lysates of the bloodstream form of T. brucei [25]. Recently, a small gene family coding for class I PDEs (TbPDE2) was identified in T. brucei,andtheirgene products were characterized as cAMP-specific PDEs [26– 28]. The current study describes the identification of a novel class I PDE from T. brucei, TbPDE1. This enzyme bears no sequence similarity to any of the other class I PDE families Correspondence to T. Seebeck, Institute of Cell Biology, Baltzerstrasse 4, CH-3012 Bern, Switzerland. Fax: + 41 31 631 46 84, Tel.: + 41 31 631 46 49, E-mail: thomas.seebeck@izb.unibe.ch Abbreviations: PDE, cyclic-nucleotide specific phosphodiesterase; IBMX, isobutyl-methyl-xanthine; IC 50 , 50% inhibitory concentrations. Note: A web site is available at http://www.izb.unibe.ch *Present address: Department of Chemistry, Hans Meerwein-Strasse, Philipps University, D-35032 Marburg, Germany. (Received 16 October 2003, revised 10 December 2003, accepted 16 December 2003) Eur. J. Biochem. 271, 637–647 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2003.03967.x outside of the catalytic domain. Sequence comparisons indicate that TbPDE1 of T. brucei is different from all PDE families of its potential mammalian hosts. In agreement with these sequence data, TbPDE1 is also pharmacologi- cally quite distinct from its mammalian counterparts, as judged from its sensitivity to a number of established PDE inhibitors. Finally, TbPDE1 is a nonessential enzyme under culture conditions or during the midgut infection of tsetse flies, as was demonstrated earlier with deletion mutants for this gene [29]. Materials and methods Materials 5-Fluoroorotic acid monohydrate was from American Bioorganics. SuperTaq polymerase was from Anglia Bio- tech. Benzamidine, antipain, leupeptin, phenylmethane- sulfonyl fluoride, and Ba(OH) 2 solution (Cat. number 14-3) were from Sigma. Adenosine-3,5¢-cyclic monophos- phate and adenosine-5¢-monophosphate were from Roche Molecular. The radiochemicals [2,8- 3 H]adenosine-3¢5¢-cyclic monophosphate (25–40 · 10 10 BqÆmmol )1 )and[ 3 H]adeno- sine-5¢-monophosphate (15–30 · 10 10 BqÆmmol )1 )were from NEN. PDE inhibitors were from the following sources: isobutyl-methyl-xanthine (IBMX), Sigma; etazolate, Calbi- ochem; IBMQ and rolipram were generous gifts from Glaxo Wellcome and Smith Kline Beecham, respectively. Trypanosomes Procyclic trypanosomes (stock 427) were grown in SDM-79 medium containing 5% fetal bovine serum [30]. A mono- morphic variant of AnTat1.1 [31] was cultivated as described by Hesse et al. [32]. Yeast strains Strain PP5-12 (MATa leu2-3 leu2-112 ura3-52 his3-532 his4 cam pde1::ura3 FOA–Res pde2::HIS3) was derived from strain PP5 [33]; a gift of J. Colicelli (UCLA) by selection on 5-fluoroorotic acid [34]. Strain YMS5 (MATa leu2 ura3 his4 lys2 pde1::LYS2 pde2::LEU2 pep4::ura3 FOA– Res35 was kindly provided by P. Engels (Novartis Ltd). Complementation screening The phosphodiesterase-deficient, uracil auxotroph yeast strain PP5-12 was transformed with a trypanosome expression library. The selectable phenotype of PP5-12 is heat-shock sensitivity. The library (a kind gift of R. Schwartz, University of Marburg) contained cDNA from bloodstream form trypanosomes of stock 427, clone 221 in the yeast expression vector p426MET [35], which is a 2l plasmid with the repressible MET25 promotor and the URA3 selection marker. The cloning site of this plasmid was derived from pBS SK(–) (Stratagene). The cDNA library was inserted via the XhoIandEcoRI sites, and the MET25 promotor (381 bp) was introduced between the XbaIandtheSacI sites. Yeast transformation was carried out exactly as described [36]. Transformants were grown for 3 days on selective medium lacking methionine and uracil (SC–met–ura) to maintain the plasmid and to derepress the expression of the cDNA. In order to select for complementation, the transformants were replica-plated onto plates prewarmed to 55 °C and incubated at this temperature for 15 min. Plates were then cooled and incubated at 30 °C for 3 days. Heat-shock resistant colon- ies were rescreened for heat-shock sensitivity. Patches were replica-plated onto YPD plates prewarmed to 55 °C, and the heat shock was continued for 15 min. After cooling the plates to room temperature, they were incubated for 2–3 days at 30 °C. Candidate clones were subjected to segregation analysis, and positive plasmids were finally used to retransform PP5-12 in order to confirm the phenotype carried by the plasmid. Direct PCR screening of plasmids Screening of large numbers of yeast colonies for the presence of a plasmid insert was done by a rapid PCR procedure. Colonies were picked and grown at 30 °Cin 5 mL selective medium to high density (18–24 h). Cell culture (1.5 mL) was pelleted and resuspended in 100 lL H 2 O. The suspension was boiled for 5 min and then centrifuged for 30 s at 8400 g Five microlitres of the supernatant were taken as input into 50 lLPCRreac- tions. Plasmid inserts were amplified using primers derived from the pBS SK(–) multicloning site: primer BS(+) forward: 5¢-GTTTTCCCAGTCACGACGTTG-3¢;and primer BS(+) back: 5¢-ACCATGATTACGCCAAGC GCG-3¢. Amplification was performed in a Perkin-Elmer thermal cycler using the following conditions: One cycle of 5 min at 94 °C, 1 min at 50 °C, 2 min at 72 °C, followed by 30 cycles of 1 min at 94 °C, 1 min at 55 °C, 2 min at 72 °C, followed by a final extension step of 5 min at 72 °C. Cloning and expression of the TbPDE1 locus A genomic DNA fragment containing TbPDE1 was isolated from a k-DASH TM library constructed from genomic DNA of strain AnTat 1.1 which had been partially digested with Sau3A and packaged with the GigapackÒ II kit (Stratagene) (R. Kraemer, unpublished results). The restriction map of subclones pCK16-1 and pCK59-1 matched the map of the genomic TbPDE1 locus derived from Southern blot analysis (T. Kloeckner, unpublished results). Genomic Southern blots were hybridized with a PCR-amplified subfragment of plasmid pCK16-1 repre- senting amino acids 177–602 of TbPDE1. Identification of 5¢ and 3¢ termini of the TbPDE1 mRNA The mini-exon addition site was mapped by RT/PCR using primer 16-SP13 (5¢-ATTCGCTCGTTGATTTC-3¢) for reverse transcription (RT), and a mini-exon primer M4 (5¢-GGGAATTCCGCTATTATTAGAACAGTTTCT-3¢, added EcoRI site shown in bold) together with the TbPDE1-specific antisense primer 16-SP14 (5¢-AGC AGTTTGAAGCATTG-3¢) for amplification. The prod- ucts were cloned via the EcoRI site in the M4 primer and an internal XbaI site, and they were analysed by sequencing. 638 S. Kunz et al. (Eur. J. Biochem. 271) Ó FEBS 2004 Expression of TbPDE1 in S. cerevisiae The ORF of TbPDE1 was cloned into the pLT1 expression vector. This vector was derived from p425CYC1 by replacing the CYC1 promotor by the much stronger TEF2 promotor [35] followed by the original Kozak sequence 5¢-CTAAAC-3¢ and a start codon. The complete TbPDE1 ORF was expressed either containing a His 6 tag at its N terminus, or a His 6 tagfollowedbyahaemag- glutinin tag to facilitate detection of the recombinant protein. Transformants were selected on synthetic minimal medium containing 0.67% (w/v) yeast nitrogen base without amino acids (DIFCO) and 2% (w/v) glucose, supplemented with an amino acid mixture lacking leucine (SC–leu). For the preparation of lysates from cells expressing TbPDE1, yeast cells grown to mid- to end-log phase in SC–leu medium were collected, resuspended quickly in the original volume of prewarmed YPD medium and incuba- ted for an additional 3 h at 30 °C in order to maximize protein expression. Cells were then harvested, washed once in H 2 O and once in HHB buffer (Hank’s balanced salt solution, containing 50 m M Hepes, pH 7.5). The washed cell pellet was suspended in an equal volume of HHB containing a protease inhibitor cocktail (Complete TM , Roche Molecular Biochemicals). Cells were lysed by grinding with glass beads (425–600 lm; Sigma) in 2 mL Sarstedt tubes using a FastPrep FP120 cell disruptor (3 · 45 s at setting 4). After cell breakage, a hole was punched in the bottom of the tube with a needle, the tube was placed on top of a 5 mL plastic tube and was centrifuged in an SS34 rotor for 6 min at 4340 g and 4 °C. This step left the glass beads in the Sarsted tube while the cell lysate was collected in the plastic tube, where unbroken cells and large cell fragments formed a pellet. The supernatant was transferred to a fresh tube, clarified by centrifugation for 15 min at 15 000 g and the clarified supernatant was used for the assays. Expression of TbPDE1 in E. coli The gene encoding full-length TbPDE1 (residues Met1– Thr620) was amplified from of T. brucei 927 genomic DNA (kindly provided by S. Melville, Cambridge University) using Takara Taq polymerase (BioWhittaker) and 30 cycles of 30 s at 94 °C, 2 min at 58 °C and 5 min at 72 °C. For amplification, the primer pairs 5¢-GGGAATTCCATA TGCTTGAGGCTTTGCGAAAGTGCCCGACCATGT TTG-3¢ (NdeI site in bold) and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢ (XhoI site in bold) were used. The resulting 1.86-kbp fragment was subsequently cloned into the NdeI/XhoI-cut expression vector pET28a (Novagen; kanamycin-resistance marker), resulting in plasmid pET-PDE1. Two gene fragments coding for N-terminally truncated fragments of TbPDE1 were also amplified using the same protocol and pET-PDE1 as template. PDE1(Arg189–Thr620) was amplified using the primer pairs 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. The resulting DNA fragments (1.29 and 0.90 kbp) were digested with NdeI and XhoI and cloned into pET-28a. The constructs pET- PDE1, pET-PDE1(R189–T620) and pET-PDE1(K321– T620) were verified by DNA sequencing. Expression and purification of full-length and truncated PDE1/His 6 -fusion proteins The plasmid constructs pET-PDE1, pET-PDE1(R189– T620) and pET-PDE1(K321–-T620) were transformed into E. coli BL21(DE3) cells. For protein expression, overnight cultures were grown at 37 °C in Luria–Bertani medium containing 50 lgÆmL )1 kanamycin. Fresh over- night cultures were inoculated at a dilution of 1 : 50 into TB medium [1.2% (w/v) Bacto-Tryptone, 2.4% (w/v) Bacto yeast extract, 0.4% (v/v) glycerol, 0.017 M KH 2 PO 4 ,0.072 M K 2 HPO 4 , pH 7.5] containing 50 lgÆmL )1 kanamycin. Cultures were incubated on a rotary shaker at 25 °C at 220 r.p.m. until D 595 of 0.6–0.9 was reached (about 4 h). The cultures were induced by the addition of 0.5 m M isopropyl thio-b- D -galactoside and were shaken at 25 °C for a further 4 h. Cells were harvested by centrifugation and washed once in NaCl/P i . The washed cell pellet was frozen in liquid nitrogen and stored at )70 °C. For protein purification, the frozen cell pellet was suspended in 1/40–1/30 of culture volume in extraction buffer [50 m M Na/phosphate buffer, pH 7.0, 300 m M NaCl, 5 m M MgCl 2 , 0.1% (v/v) Tween-20] containing a protease inhibitor cocktail (CompleteÒ, Roche Molecular Biochemicals). Cells were lysed by sonication (four pulses of 15 s with intermittant cooling in an ice/water bath). The lysate was clarified by centrifugation at 16 000 g for 20 min at 4 °C. Of the supernatant, 1.2 mL were added to a tube containing 250 lLbedvolumeofTalonÒ resin (Clontech) preequili- brated with extraction buffer. The tube was rotated for 30 min on a rotary shaker at 4 °C. The resin was then washed once with 1.5 mL of wash buffer 1 (extraction buffer) and twice with 1.5 mL wash buffer 2 (extraction buffer containing 5 m M imidazole). The washed resin was then packed by gravity flow into an 8 mm diameter column, washed with 2.5 mL wash buffer 2, followed by elution of bound protein with elution buffer (extraction buffer containing 150 m M imidazole). Fractions (250 lL) were collected and 1 lLofeachfractionwerespotted onto nitrocellulose and stained with amido black to visualize the protein. Fractions containing the recombin- ant protein were pooled (750–1000 lL total) and fractionated over a Sephadex G-25 column (NAPÒ, Pharmacia Biotech) preequilibrated with 15 mL NSP buffer (50 m M sodium phosphate buffer, pH 7.5, 300 m M NaCl, 5 m M MgCl 2 ). The fractions containing the eluted protein were analysed spectrophotometrically to ascertain that their imidazole concentration was below 1m M and were then pooled. Finally, the purified protein was mixed with an equal volume of 50% (v/v) glycerol, 0.2% (v/v) Tween-20, 5 m M MgCl 2 , and aliquots were shock-frozen in liquid nitrogen and stored at )70 °C. Protein concentrations were determined using the Brad- ford reagent (Bio-Rad) and BSA as a standard. Ó FEBS 2004 Class I phosphodiesterase from T. brucei (Eur. J. Biochem. 271) 639 PDE assays PDE activity was assayed by a modification of the procedure of Schilling et al. [37] as described [26]. All assays were performed at 30 °Cin25m M Tris/HCl, pH 7.4, 0.5 m M EDTA, 0.5 m M EGTA, 10 m M MgCl 2 and using 1 l M [ 3 H]cAMP as the substrate. After addition of Ba(OH) 2 , the samples were allowed to precipitate on ice for 30 min. The precipitate was filtered onto GF/C glass fibre filters, and radioactivity was measured by scintillation spectrometry. For each set of experiments, control precipi- tations with [ 3 H]AMP and [ 3 H]cAMP were performed in order to determine the efficiency of AMP capture in the precipitate, and the extent of cAMP trapping in the precipitate. Both values were reproducible from experiment to experiment, and over the whole concentration range used in our assays. AMP was precipitated with an efficiency in the range of 60% of the input, and cAMP contamination of the precipitate corresponded to about 0.7% in the input. The amount of AMP produced by PDE activity was calculated according to: C AMP ¼ C cAMP ða probe À q cAMP Â a cAMP Þ =ða cAMP ðq AMP À q cAMP ÞÞ where C cAMP is the cAMP substrate concentration, a cAMP is the total activity used in the enymatic reaction, a probe is the total radioactivity on the filter, and q cAMP and q AMP are the precipitation efficiencies of cAMP and AMP, respectively. In all experiments, < 20% of the substrate was hydrolysed, and all data points were taken in triplicate or quadruplicate. For inhibitor studies, the test compounds were dissolved in H 2 O or dimethylsulfoxide. The dimethylsulfoxide concen- tration in the final assay solutions never exceeded 2%, and appropriate controls were always included. Data were evaluated using the PRISM 3.0 software package from GraphPad. Results Isolation of a PDE gene from T. brucei by functional complementation in S. cerevisiae At the onset of this project, no sequences with similarities to PDEs were available in the T. brucei genome databases, and the gene was isolated by complementation screening in S. cerevisiae. Yeast strains deficient in PDE activity are heat-shock sensitive and do not survive exposure to elevated temperatures [7]. This phenotype provided a convenient screening system for the search for PDE genes. In the PP5 yeast strain used for the screening, both endogenous PDE genes (PDE1 and PDE2) have been disrupted by URA3 and HIS3 marker genes, respectively [33]. Since the trypano- somal cDNA library to be used was constructed in a vector carrying the URA3 selection marker for uracil auxotrophy, the PP5 strain, which is Ura + , first had to be selected on 5-fluoroorotic acid for spontaneous ura – mutants. Several such mutants were isolated and analysed for their genetic stability. The clone with the lowest reversion frequency, PP5-12, was used for further experiments. PP5-12 was transformed with the cDNA library, and % 24 000 transformants were recovered after Ura + selec- tion. Transformants were replica-plated onto SC–met–ura plates preheated to 55 °C and were incubated at 55 °Cfor 15 min. Plates were then cooled and incubated at 30 °Cfor 3 days. An exploratory screen had revealed a high frequency (0.5%) of spontaneous heat-shock resistant revertants. The 120 heat-shock resistant colonies were thus individually retested, and 109 of them that still proved heat-resistant were analysed further. Segregation analysis and retransfor- mation of individual plasmids into PP5-12 resulted in a single plasmid, pBa46, which confered heat-shock resistance upon back-transformation into PP5-12. pBa46 was found to contain a cDNA fragment representing most of the ORF (amino acids Met159 through the stop codon after Thr620) and 210 bp of the 3¢-untranslated region of a novel PDE gene of T. brucei, TbPDE1. Cloning and genomic organization of TbPDE1 While the complementation screen was ongoing, a DNA fragment coding for a protein kinase A-related gene (TbPKAC3) was isolated from a genomic phage library of T. brucei (N. Wild and M. Boshart, unpublished results). Upon sequencing beyond the 3¢-untranslated region of TbPKAC3, an ORF of 620 amino acids (TbPDE1)was identified that encompassed the cDNA sequence contained in pBA46. TbPDE1 is a single-copy gene, as several restriction enzymes produced single bands with different mobilities upon Southern blot analysis (Fig. 1). The gene is located on chromosome 10. The two hybridizing bands Fig. 1. Genomic organization of TbPDE1. Southern blot analysis of genomic T. brucei DNA of strain AnTat1.1 digested with BamHI (B), EcoRI (E), HindIII (H) and XhoI (X). Plasmid controls representing 0.5, 1 and 2 genome equivalents are included in the right hand part of the blot. The hybridization probe was a PCR fragment representing amino acids 177–602 of the TbPDE1 open reading frame. Molecular mass markers are given on the left. 640 S. Kunz et al. (Eur. J. Biochem. 271) Ó FEBS 2004 observed with BamHI-digested DNA reflect a polymorphic BamHI site. This was confirmed by restriction mapping of independent genomic phage clones (data not shown) and also by independent knockout experiments of TbPDE1 [29]. The observation that TbPDE1 is a single-copy gene was further supported by quantification of the gene copy number by using internal plasmid standards equivalent to 0.5, 1 and 2 haploid genome copies of TbPDE1.Hybrid- ization of genomic blots at low stringency (T m ¼ 45 °C) as well as library screening under similar conditions failed to detect related PDE genes or other putative TbPDE1 family members. Complete sequencing of the cDNA clone pBa46 and of genomic clones revealed a small number of nucleotide sequence differences despite careful verification by resequencing. This was not unexpected as the genomic and the cDNA sequences were derived from different strains of T. brucei (see Materials and methods) and because an allelic polymorphism in the TbPDE1 locus was also detected by BamHI restriction enzyme analysis (Fig. 1). The trans-splicing site at the 5¢-end of the TbPDE1 transcript was mapped by RT-PCR using two nested gene- specific primers and a primer directed to the conserved mini- exon sequence present at the 5¢-end of all trypanosomal mRNAs. Seven out of eight such cDNA clones contained the mini-exon splice site at position )159 relative to the translational start, and one clone at position )155. Both sites were preceded by an AG dinucleotide and a long polypyrimidine stretch immediately upstream (Fig. 2A). These results demonstrated that the intergenic region between TbPKAC3 and TbPDE1 is only 117–135 bp long, as the 3¢-end of theTbPKAC3-transcript had previously been mapped by RT/PCR (T. Kloeckner, unpublished results). The oligo-A stretch at the 3¢-end of cDNA clone pBa46 most likely represents the beginning of the polyA tail of the TbPDE1 mRNA since no corresponding oligoA stretch is found in the genomic sequence, and since poly pyrimidine-rich stretches which are typically located upstream from the polyadenylation sites of other trypano- somal mRNAs [38] were found upstream of this site (Fig. 2B). TbPDE1 mRNA is expressed in the bloodstream and in the procyclic life cycles stages According to the mapped transcript ends, TbPDE1 should give rise to an mRNA of approximately 2.5 kb. This was detected in Northern blots using RNA from three different life cycle stages of T. brucei, long-slender and short-stumpy forms isolated from infected rats, and cultured procyclic forms (Fig. 2C). In good agreement with the results from Northern blotting experiments, TbPDE1 mRNA was also detected in cultured bloodstream and procyclic forms by using real-time RT/PCR (data not shown). Organization of the predicted amino acid sequence The ORF of TbPDE1 encodes a protein of 620 amino acids, with a calculated molecular mass of 70 336 (Fig. 3). Since TbPDE1 was identified by complementation of a PDE deletion strain of S. cerevisiae, its function as a PDE had already been established. Analysis of the predicted amino acid sequence fully supported this initial assumption. The amino acid sequence unambiguously identified TbPDE1 as a class I PDE [12], with amino acids His413–Phe424 representing the signature sequence for class I cyclic nucleotide PDE. This motif, Pdease_1 [39], displays the consensus sequence HisAsp(LeuIleValMetPheTyr)XHis- X(Ala,Gly)XXAsnX(LeuIleValMetPheTyr). Based on the three-dimensional structures of two isoenzymes of human PDE4 and one of human PDE5 [40–42], the active site is well conserved between these human PDEs and TbPDE1 (Fig. 4). A comparison of the core region of the catalytic domain (Phe347–Phe578) of TbPDE1 with those of other class I PDEs indicates that it is about equidistant from all other class I families, including the dunce gene of Drosophila,the Fig. 2. TbPDE1 mRNA. (A) 5¢-Upstream region of TbPDE1. Pol- ypyrimidine-tracts are indicated by black dots. The two alternative trans-splicing acceptor sites are indicated with arrows, and the AG sequences preceding them are underlined. The N-terminal part of the ORF is underlined and shown in bold type. (B) 3¢-Untranslated region of TbPDE1. The end of the ORF is underlined and shown in bold type. A polypyrimidine tract upstream of the poly(A) addition site is indi- cated by black dots. The poly(A) addition site is marked with an asterisk. The complete DNA sequence of the TbPDE1 locus was submitted to GenBank under the accession number AF253418. (C) Northern blot hybridized with a TbPDE1-specific riboprobe using 10 lg total RNA per lane. LS, Long-slender forms purified from rodent blood; SS, short-stumpy forms; PC, procyclic culture forms derived from short-stumpy forms by in vitro differentiation. RNA size markersinareindicatedontheleft(kb). Ó FEBS 2004 Class I phosphodiesterase from T. brucei (Eur. J. Biochem. 271) 641 regA gene of Dictyostelium or the trypanosomal TbPDE2 family (Fig. 5). The lowest degree of sequence identity was found with the mammalian PDEs 2 and 6 (< 30% identity), while the highest degree of sequence identity was found with the PDEs 1, 3 and 4 (> 40% identity). Using the standard sequence homology criteria to define PDE families [12], TbPDE1 clearly represents a new family of the class I of PDEs. The status of a new family is also supported by the observation that no sequence similarity with other PDEs is detected outside the catalytic domain, either with mamma- lian PDEs or with the trypanosomal TbPDE2 family. Outside of the catalytic domain, sequence similarity decrea- ses, within 10–40 amino acids at the N-terminal side of the domain, and within 15 amino acids at its C-terminal side. Expression of TbPDE1 in S. cerevisiae The successful complementation screening in yeast indicated that recombinant TbPDE1 is enzymatically active. In addition to the cDNA plasmid pBa46 (encoding amino acids Met159–Thr620), the full-length TbPDE1 construct (pLTHisPDE1) and an N-terminally truncated TbPDE1 construct (pLTBoris, amino acids Arg189–Thr620) also restored the wild-type phenotype of the yeast mutant (Fig. 6A). In contrast, a construct expressing only the core of the catalytic domain (pHisPDEcat1; amino acids Phe347–Phe578) did not (Fig. 6A). Very similar results were also obtained in a genetically different PDE-deletion strain of S. cerevisiae, YMS5 ([43]; data not shown). In addition to conferring a heat-shock resistance pheno- type to the two yeast PDE deletion strains, the introduction of functional TbPDE1 also significantly changed the phenotype during growth as suspension cultures. The Fig. 3. Amino acid sequence of TbPDE1. Arrows indicate the starting point of various recombinant TbPDE1 polypeptides referred to in the text: 1, pBa46 (original cDNA clone recovered by complementation screening); 2, pET-PDE-(R189–T620) and pLTBoris; 3, pET-PDE- (K321–T620). Underlined, (Phe347–Phe578) core of the catalytic regionthatwasusedtocalculateaminoacididentitiesbetween different PDEs [12]. The Gene Bank accession number of the TbPDE1 polypeptide is AAL580095. Fig. 4. Alignment of the catalytic regions of human PDE4B2B, human PDE5A4 and TbPDE1. A, TbPDE1; B, human PDE4B2B; C, human PDE4D2; D, human PDE5A4. Open bars show the approximate location of alpha-helices. Helices predicted from the TbPDE1 sequence correspond reasonably well with those (a4 through a18) found in the three-dimensional structures of the human PDEs 4B2B, 4D2 and 5A4. Black bars and shaded regions show the signature motifs for class I PDEs. Black dots indicate conserved residues. 642 S. Kunz et al. (Eur. J. Biochem. 271) Ó FEBS 2004 PDE deletion strain PP5, and its Ura – derivative PP5-12, exhibit extensive clumping when grown in SC medium (Fig. 6B). When complemented by a heterologous PDE (TbPDE1 or human PDE4A), clumping was significantly reduced (Fig. 6B). The overall experience with expressing different fragments of several different PDEs (TbPDE1, the TbPDE2 family [26], and human PDE4A) suggested that the extent of clumping of the S. cerevisiae PP5 strain correlates inversely with the extent of recombinant PDE activity (unpublished results). Despite the functional complementation observed in intact yeast cells, no significant PDE catalytic activity could be detected in yeast cell extracts. In contrast, control lysates from yeast cells that expressed either human PDE4A or trypanosomal TbPDE2A [26] from the same yeast vector plasmid pLT1 showed high levels of PDE catalytic activity. To determine if the very low level of TbPDE1 activity might be due to instability of the recombinant protein, a full-size TbPDE1 construct was expressed which contained a haemagglutinin-tag at its N terminus. This tagged protein fully rescued the heat-shock phenotype, was detectable by immunoblotting and was stable throughout cell breakage and PDE assay. Nevertheless, no enzyme activity could be detected. These observations indicate that TbPDE1 is expressed in S. cerevisiae at levels that are sufficient to produce a clear phenotype (heat-shock resistance, growth as a smooth suspension), but that are too low to be detectable in PDE assays of cell lysates. Expression of TbPDE1 in E. coli Recombinant full-length TbPDE1 was expressed from plasmid pET-PDE1 and purified from the cytosolic fraction of E. coli cell lysates with high yields after 4 h of expression at 25 °C. However, the purified protein exhibited only low levels of catalytic activity. Consequently, N-terminally truncated variants were designed on the basis of sequence alignments (see above). The C-terminal 250 residues were predicted to comprise the catalytic domain of TbPDE1. The N-terminally truncated construct pET-PDE1-(Arg189– Thr620) was expressed in E. coli as an active enzyme which could be purified from the soluble fraction. In contrast, the more extensively truncated construct pET-PDE1-(Lys312– Fig. 5. Amino acid sequence identities between the catalytic cores of class I PDEs. The following PDE sequences were used for comparison (GCG Pileup, using default parameters): 1, human PDE1C (access number AAC50437); 2, human PDE2A (O00408); 3, human PDE3A (AAA35912); 4, human PDE4A (AAC35012); 5, human PDE5A (NM_001074); 6, human PDE6B (NP_000274); 7, human PDE7A (Q13946); 8, human PDE8A (O60658); 9, human PDE9A (AAO34689); 10, human PDE10A (AAD32595); 11, human PDE11A (CAB82573); a, T. brucei TbPDE2C (AAK33016); b, D. melanogaster dunce (NP_726859); c, S. cerevisiae PDE2 (AAA34846); d, D. dis- coideum regA (AAB03508). Fig. 6. Functional complementation of PDE-deficient S. cerevisiae by TbPDE1. (A) Restoration of heat-shock resistance. Duplicate patches of recombinant yeast strains were exposed to a 55 °C heat shock for 15 min and were then grown at 30 °C for 2 days. pLTHisPDE1, Full length TbPDE1 containing an N-terminal His 6 tag; pLTBoris, amino acids Arg189–Thr620 of TbPDE1, containing an N-terminal His 6 tag; pHisPDEcat1, catalytic core (Phe347–Phe578) containing an N-terminal His 6 tag; pLT1, empty expression vector pLT1; pLC-h6.1, full length human PDE4. (B) Clumping of the PDE-deletion strain PP5-12 and suppression of clumping by the expression of a PDE. Yeast cultures were grown for 24 h at 30 °C on a rotary wheel and were photographed immediately after removal from the wheel. 1, His 6 taggedfull-lengthTbPDE1;2,pLTBoris;3,pBa46;4,pHisPDEcat1; 5, empty expression vector pLT1; 6, pLC-h6.1 (full-length human PDE4A4B). All cultures grew to approximately the same cell density. (C) Map of TbPDE1 regions expressed by the various constructs. Numbers indicate first and last amino acid expressed by each con- struct. Grey box: catalytic core region of TbPDE1. Ó FEBS 2004 Class I phosphodiesterase from T. brucei (Eur. J. Biochem. 271) 643 Thr620) produced an inactive protein which was found in inclusion bodies exclusively. This was not unexpected since this construct most likely lacks a considerable part of the catalytic domain and thus may be unable to fold correctly. In the initial experiments, the specific activity of recom- binant TbPDE1 (Arg189–Thr620) was consistently very low, and the enzyme was highly unstable. While the net yield of soluble enzyme could be considerably improved by growing the cells in TB medium instead of Luria–Bertani medium (see Materials and methods), low activity and high instability remained unsatisfactory. Inclusion of 5 m M Mg 2+ during cell breakage and in all subsequent purifica- tion steps greatly stabilized the enzyme and increased its activity. Incubation of the enzyme with the cation-chelator EDTA led to rapid inactivation (Fig. 7). Once the enzyme was inactivated, removal of the EDTA and the addition of Mg 2+ did not restore its activity. Gel filtration analysis of recombinant TbPDE1 demonstrated a marked difference in migration of the enzyme in the presence or absence of Mg 2+ , suggesting that conformational changes were induced by the cations (data not shown). In addition to the continuous presence of Mg 2+ , inclusion of low concen- trations of detergent [0.1% (v/v) Tween-20] further activa- ted the enzyme about fourfold and improved the preservation of activity upon freezing. Kinetic analysis Enzyme activity was stimulated by either Mg 2+ or Mn 2+ ions, but enzyme preparations inactivated by the prior removal of Mg 2+ could not be reactivated by either cation (see above). Although Mn 2+ stimulated the activity more strongly, 10 m M Mg 2+ wasusedasthecationin all subsequent experiments. The recombinant enzyme (Arg189–Thr620) displayed standard Michaelis–Menten kinetics, as observed for other PDEs (Fig. 8A). An unex- pected finding was the high K m of TbPDE1 for its substrate cAMP (Fig. 8A). An exact K m value was difficult to determine as the assay procedure became unreliable at substrate concentrations beyond 1 m M , and thus did not allow measurement at substrate concentrations far beyond K m . Nevertheless, the combined results of many independ- ent determinations place the K m for cAMP at > 600 l M . This high K m for cAMP is most probably not due to the extraction and purification conditions of the enzyme, as similar values were obtained with enzyme batches prepared in the presence or absence of Mg 2+ and detergent. Also, the high K m is unlikely to be an artefact of expression in E. coli because the catalytic domains of several human class 1 PDEs have been successfully expressed in the same E. coli strain and have exhibited the expected low K m values for their respective substrates [44,45]. When reactions were performed in the presence of a 100-fold excess of cGMP, cAMP hydrolysis was not affected (data not shown), indicating that TbPDE1 is cAMP specific, and that its activity is not influenced by allosteric binding of cGMP. Inhibitor screening The potency of a series of known PDE inhibitors against the recombinant enzyme was determined. In of all these assays, cAMP concentration was kept at 1 l M , i.e., far below K m , so that the 50% inhibitory concentrations (IC 50 ) approxi- mate K i . Most of the inhibitors tested showed essentially no effect on the activity of TbPDE1 (Table 1 and Fig. 9). The few that exhibited significant potency were sildenafil, a highly specific inhibitor of human PDE5, trequinsin, an inhibitor of human PDE3, ethaverine and dipyridamole. However, their IC 50 values were rather high (1 and 2.5 l M for sildenafil and trequinsin, respectively) when compared with the IC 50 values against their specific targets (human PDE5 for sildenafil, 0.0039 l M ; human PDE3 for trequin- Fig. 7. Mg 2+ dependence of TbPDE1 stability. Aliquots of purified TbPDE1 were incubated for 60 min at 30 °C. At different times during this preincubation, EDTA was added to 10 m M final concentration. After the 60 min preincubation, the enzyme solutions were diluted 1250· into standard reaction buffer (25 m M Tris/HCl pH 7.4, 0.5 m M EDTA, 0.5 m M EGTA, 10 m M MgCl 2 ,1l M cAMP), and PDE activity was determined. (A) Preincubation on ice (60 min), no EDTA. (B) Preincubation at 30 °C (60 min), no EDTA (defined as 100% activity). (C) EDTA added after 60 min preincubation at 30 °C, sample then immediately diluted and assayed. (D) EDTA for 20 min. (E) EDTA for 40 min. (F) EDTA for 60 min. Fig. 8. Analysis of TbPDE1 activity. Michaelis–Menten kinetics of TbPDE1 indicates a K m of > 600 l M for cAMP. Insert: Hanes plot. 644 S. Kunz et al. (Eur. J. Biochem. 271) Ó FEBS 2004 sin, 0.0003 l M ). The inhibitor profile of TbPDE1, including the four most potent inhibitors, sildenafil, trequinsin, ethaverine and dipyridamole, is very similar to that determined for TbPDE2A [26], and it is entirely different from that of mammalian PDEs. No correlation was observed between the selectivity and potency of inhibitors for their respective human target PDE family, and their potency against TbPDE1. Interestingly, the broad-spectrum PDE inhibitor IBMX, which is widely used in cell biological experimentation, is essentially inactive on TbPDE1, with an IC 50 value of > 1 m M . Discussion This study reports the identification and characterization of a novel cyclic-nucleotide-specific PDE, TbPDE1, from T. brucei. TbPDE1 is a member of the class I PDEs and represents a new family within this class. The amino acid sequence of its catalytic domain is approximately equidis- tant from those of all mammalian class I PDEs, the class I PDEs dunce of D. melanogaster,regAofD. discoideum and PDE2 of S. cerevisiae,aswellasfromanotherclassIPDE of T. brucei, TbPDE2A. TbPDE1 is camp specific, its activity is not modulated by cGMP, and it exhibits an unusually high K m for its substrate cAMP (> 600 l M ). It can functionally complement PDE-deficient yeast strains and is not inhibited by the broad-spectrum PDE-inhibitor IBMX, even at high concentrations. The latter observation is reminiscent of the human PDE9, that is similarly resistent to IBMX. Initial functional studies in T. brucei have demonstrated that TbPDE1 is not an essential enzyme, either for proliferation in culture or for tsetse fly infection by TbPDE1 knockout trypanosomes [29]. This is radically different from the situation of the TbPDE2 family. The members of the TbPDE2 family are essential. Heterozygous TbPDE2 knockout strains exhibit haploid insufficiency, and homozygous knockouts are nonviable. Downregulation of TbPDE2 activities either by inhibitors or via RNA inter- ference leads to a disruption of nuclear division and to rapid cell death ([27] and T. Seebeck and M. Linder, unpublished results). Expression of recombinant TbPDE1 proved to depend crucially on the selection of the correct gene fragment. A fragment containing the entire catalytic domain (Met159– Thr620) exhibited only minimal activity, which was sufficient for the phenotypic conversion of yeast PDE- deletion mutants in vivo, but was not detectable by in vitro assays in either S. cerevisiae or E. coli cell lysates. A shorter fragment comprising Arg189–Thr620 was also able to convert the phenotype of PDE-deficient yeast, and it could be expressed as a soluble and catalytically active protein in E. coli. A still shorter fragment lacking the N-terminal Table 1. Potency of selected PDE inhibitors. IC 50 values were deter- mined using 1 l M cAMP as a substrate. n.d., Not determined. Inhibitor Specificity for human PDE family IC 50 (l M ) for human PDE family IC 50 (l M ) for TbPDE1 Sildenafil 5 0.0039 1 Trequinsin 3 0.0003 2.5 Ethaverine n.d. n.d. 8 Dipyridamole 5, 6 0.38 13 Etazolate 4 2 25 Papaverine Nonselective 5–25 30 Rolipram 4 2 280 IBMX Nonselective > 1000 8-Methoxymethyl-IBMX 1 4 > 100 Vinpocetine 1 20 > 100 EHNA 2 1 > 100 Milrinone 3 0.3 > 100 Cilostamide 3 0.005 > 100 Zardaverine 3, 4 0.5 > 100 Zaprinast 5, 6 0.5 > 100 Theophylline Nonselective 50–300 > 100 Fig. 9. Potency of selected PDE inhibitors against TbPDE1. Ó FEBS 2004 Class I phosphodiesterase from T. brucei (Eur. J. Biochem. 271) 645 moiety of the catalytic domain, but still containing its core part (Lys321–Thr620) was inactive in yeast, and was expressed in E. coli as an inactive polypeptide in the form of inclusion bodies which could not be refolded into an active form. Stability and activity of the recombinant enzyme Arg189–Thr620 proved to be extremely sensitive to the presence of Mg 2+ . When extracted in the absence of Mg 2+ , the resulting protein was poorly active, and activity could not be restored by the addition of Mg 2+ to the reaction buffer. Extraction in the presence of Mg 2+ ions produced a very active and stable enzyme preparation, suggesting that Mg 2+ is needed not only as a catalyst during the enzymatic reaction, but also for stabilizing the enzyme structure. This is in agreement with structural work on human PDE4B2B [41,42] that had demonstrated the presence of two divalent cations in the active centre. In addition to the continuous presence of Mg 2+ , inclusion of low concentrations of detergent, 0.1% (v/v) of Tween-20, further activated the enzyme about fourfold and improved the preservation of activity upon freezing. Current data do not allow us to determine if the N-terminal moiety of TbPDE1 is involved in maintaining the stability of the enzyme, or if it modulates the activity of the catalytic domain. Similar experiments with another trypanosomal PDE, TbPDE2A, have demonstrated that the N-terminal domain exerts no direct effect on either stability or activity of the catalytic domain [26]. The recombinant TbPDE1 Arg189–Thr620 represents a cAMP-specific PDE. cGMP neither competes as a substrate nor does it modulate enzyme activity. This specificity is in good agreement with the conservation of Asp378 and Gln575 that are predicted to confer cAMP-specificity to human PDE4 [41,42]. In contrast to all other members of the class I PDEs, the K m of TbPDE1 Arg189–Thr620 for cAMP is very high (> 600 l M ). Available data cannot formally exclude that this high K m might reflect an artefact of expression in E. coli. However, this seems unlikely as very similar fragments of mammalian class I PDEs have been expressed in the same strain of E. coli and were shown to exhibit the characteristic specificities and low K m values for their respective substrates [42–44]. If indeed genuine, the high K m ofTbPDE1forcAMPisparticularlyremarkableas the intracellular steady-state cAMP concentration in T. bru- cei is in the range of 1–10 l M [24,27]. This situation is reminiscent of PDE1 from S. cerevisiae,ahigh-K m class II PDE. In this organism PDE1 appears to play a major role in the quenching of short-term cAMP peaks upon metabolic stimulation. Deletion of PDE1 in S. cerevisiae does not confer a significant phenotype, but the addition of glucose to cells grown in glucose-free medium induces cAMP peaks of much longer duration than seen in wild-type cells [45]. Similarly, TbPDE1, a nonessential enzyme in T. brucei [29], may represent a modulatory element of the cAMP signalling pathways of T. brucei, and its physiological roles remain to be explored. Acknowledgements We thank Ralph Schwarz, University of Marburg for his cDNA library, John Colicelli and Peter Engel for their PP5 and YMS5 strains, respectively, Miles Houslay for providing a human PDE4 clone, Sara Melville for a gift 927 genomic DNA, and Boris Bieger for providing some of the constructs. We are indebted to Miriam van der Bogaard and Markus Linder for expert technical assistance, and to Min Ku for converting our text into palatable English. We gratefully acknowledge the generosity of Glaxo-Wellcome, Smith Kline Beecham and Pfizer for providing samples of PDE inhibitors. This work was supported by grants 31-058927.99 and 3100-067225/1 of the Swiss National Science Foundation, grant C98.0060 of COST program B9 of the European Union, and by the UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (to T.S.), the Max-Planck Gesellschaft, grant BEO21/0316211A from the German Federal Ministry for Science and Technology (BMFT), and by grant Bo1100 of the Deutsche Forschungsgemeinschaft (to M.B.). References 1. Botsford, J.L. & Harman, J.G. (1992) Cyclic AMP in prokaryotes. Microbiol. Rev. 56, 100–122. 2. D’Souza, C.A. & Heitman, J. (2001) Conserved cAMP signaling cascades regulate fungal development and virulence. FEMS Microbiol. Rev. 25, 349–364. 3. Meili, R. & Firtel, R.A. (2003) Follow the leader. Dev. Cell 4, 291–293. 4. Zufall, F. & Munger, S.D. (2001) From odor and pheromone transduction to the organization of the sense of smell. Trends Neurosci. 24, 191–193. 5. Wainger, B.J., DeGennaro, M., Santoro, B., Siegelbaum, S.A. & Tibbs, G.R. (2001) Molecular mechanism of cAMP modulation of HCN pacemaker channels. Nature 411, 805–810. 6.Yu,T.P.,McKinney,S.,Lester,H.A.&Davidson,N.(2001) Gamma-aminobutyric acid type A receptors modulate cAMP- mediated long-term potentiation and long-term depression at monosynaptic CA3-CA1 synapses. Proc. Natl Acad. Sci. USA 98, 5264–5269. 7. Nikawa, J., Sass, P. & Wigler, M. (1987) Cloning and character- ization of the low-affinity cyclic AMP phosphodiesterase gene of Saccharomyces cerevisiae. Mol. Cell. Biol. 7, 3629–3636. 8. Sass, P., Field, J., Nikawa, J., Toda, T. & Wigler, M. (1986) Cloning and characterization of the high-affinity cAMP phos- phodiesterase of Saccharomyces cerevisiae. Proc. Natl Acad. Sci. USA 83, 9303–9307. 9. Thomason, P.A., Taynor, D., Stock, J.B. & Kay, R.R. (1999) The RdeA-RegA system, a eukaryotic phospho-relay controllinh cAMP breakdown. J. Biol. Chem. 274, 27379–27384. 10. Francis, S.H., Turko, I.V. & Corbin, J.D. (2001) Cyclic nucleotide phosphodiesterases: relating structure and function. Prog. Nucleic Acid Res. Mol. Biol. 65, 1–52. 11. Soderling, S.H. & Beavo, J.A. (2000) Regulation of cAMP and cGMP signaling. new phosphodiesterases and new functions. Curr. Opin. Cell Biol. 12, 174–179. 12. Beavo, J.A. (1995) Cyclic nucleotide phosphodiesterases: func- tional implications of multiple isoforms. Physiol. Rev. 75, 725– 748. 13. Muradov, K.G., Granovsky, A.E. & Artemyev, N.O. (2003) Mutation in rod PDE6 linked to congenital stationary night blindness impairs the enzyme inhibition by its gamma-subunit. Biochemistry 42, 3305–3310. 14. Strettoi, E. & Pignatelli, V. (2000) Modifications of retinal neurons in a mouse model of retinitis pigmnentosa. Proc. Natl Acad. Sci. USA 97, 11020–11025. 15. Secchiero, P., Zella, D., Curreli, S., Mirandola, P., Capitani, S., Gallo, R.C. & Zauli, G. (2000) Pivotal role of cyclic nucleotide phosphodiesterase 4 in Tat-mediated CD4 + T cell hyperactivation and HIV type I replication. Proc. Natl Acad. Sci. USA 97, 14620– 14625. 16. Dean, S.M. (2002) Pharmacologic treatment for intermittent claudication. Vasc. Med. 7, 301–309. 646 S. Kunz et al. (Eur. J. Biochem. 271) Ó FEBS 2004 [...]... signaling in trypanosomatids Parasitol Today 16, 35–38 20 Pays, E., Rolin, S & Magez, S (1997) Cell signalling in trypanosomatids In Trypanosomiasis and Leishmaniasis (Hide, G., Mottram, J.C., Coombs, G.H & Holmes, P.H., eds), pp 199–225 CAB International, Cambridge University Press, UK 21 Seebeck, T., Gong, K.W., Kunz, A. , Schaub, R., Shalaby, T & Zoraghi R (2001) cAMP signalling in Trypanosoma brucei. .. maintenance of bloodstream form trypanosomes in vitro Mol Biochem Parasitol 70, 157–166 33 Pillai, R., Kytle, K., Reyes, A & Colicelli, J (1993) Use of a yeast expression system for the isolation and analysis of drug-resistant mutants of a mammalian phosphodiesterase Proc Natl Acad Sci USA 90, 11970–11974 34 Boeke, J.D., Trueheart, J., Natsoulis, G & Fink, G.R (1987) 5-Fluoroorotic acid as a selective... (2001) Characterization of TbPDE 2A, a novel cyclic nucleotide-specific phosphodiesterase from the protozoan parasite Trypanosoma brucei J Biol Chem 276, 11559–11566 27 Zoraghi, R & Seebeck, T (2002) The cAMP-specific phosphodiesterase TbPDE2C is an essential enzyme in bloodstream form Trypanosoma brucei Proc Natl Acad Sci USA 99, 4343– 4348 28 Rascon, A. , Soderling, S.H., Schaefer, J.B & Beavo, J .A (2002)... Differentiation of African trypanosomes is controlled by a density sensing mechanism which signals cell cycle arrest via the cAMP pathway J.Cell Sci 110, 2661–2671 25 Walter, R.D & Opperdoes, F.R (1982) Subcellular distribution of adenylate cyclase, cyclic-AMP phosphodiesterase, protein kinases and phosphoprotein phosphatase in Trypanosoma brucei Mol Biochem Parasitol 6, 287–295 26 Zoraghi, R., Kunz, S.,... Beavo, J .A (2002) Cloning and characterization of a cAMP-specific phosphodiesterase (TbPDE2B) from Trypanosoma brucei Proc Natl Acad Sci USA 99, 4714–4719 29 Gong, K.W., Kunz, S., Zoraghi, E., Kunz, S., Renggli, C., Brun, E & Seebeck, T (2001) cAMP specific phosphodiesterase TbPDE1 is not essential in Trypanosoma brucei in culture or during midgut infection of tsetse flies Mol Biochem Parasitol 166, 229–232... 2004 Class I phosphodiesterase from T brucei (Eur J Biochem 271) 647 17 Spina, D (2003) Theophylline and PDE4 inhibitors in asthma Curr Op Pulm Med 9, 57–64 18 Gresser, U & Gleiter, C.H (2002) Erectile dysfunction comparison of efficacy and side effects of the PDE5 inhibitors sildenafil, vardenafil and taladafil – a review of the literature Eur J Med Res 7, 435–446 19 Naula, C & Seebeck, T (2000) Cyclic AMP... (1979) Cultivation and in vitro ¨ cloning of procyclic culture forms of Trypanosoma brucei in a semi-defined medium Acta Tropica 36, 289–292 31 LeRay, D., Barry, J.D., Easton, C & Vickerman, K (1977) First tsetse fly transmission of the ÔAnTatÕ serodeme of Trypanosoma brucei Ann Soc Belge Me´d Trop 57, 369–381 32 Hesse, F., Selzer, P.M., Muhlstadt, K & Duszenko, M (1995) A ¨ novel cultivation technique for... brucei Int J Parasitol 31, 491–498 22 Seebeck, T., Schaub, R & Johner, A (2004) cAMP signalling in the kinetoplastid protozoa Curr Mol Med in press 23 Mancini, P.E & Patton, C.L (1981) Cyclic-3¢,5¢-adenosine monophosphate levels during the developmental cycle of Trypanosoma brucei brucei in the rat Mol Biochem Parasitol 3, 19–31 24 Vassella, E., Reuner, B., Yutzy, B & Boshart, M (1997) Differentiation of. .. components of the paraflagellar rod of Trypanosoma brucei are two similar but distinct proteins which are encoded by two different gene loci J Biol Chem 269, 28745–28751 40 Bentley, J.K., Kadlecek, A. , Sherbert, C.H., Seger, D., Sonnenburg, W.K., Charbonneau, H., Novack, J.P & Beavo, J .A (1992) Molecular cloning of cDNA encoding a Ô63Õ-kDa calmodulin-stimulated phosphodiesterase from bovine brain J Biol Chem... Structure of the catalytic domain of human phosphodiesterase 5 with bound drug molecules Nature 425, 98–102 43 Huai, Q., Wang, H., Sun, Y., Kim, H.Y., Liu, Y & Ke, H (2003) Three-dimensional structures of PDE4D in complex with rolipram and implication on inhibitor selectivity Structure (Camb) 11, 865–873 44 Sullivan, M., Egerton, M., Shakur, Y., Marquardsen, A & Houslay, M.D (1994) Molecular cloning and . and represents a new family within this class. The amino acid sequence of its catalytic domain is approximately equidis- tant from those of all mammalian class I PDEs,. fatal human sleeping sickness, as well as Nagana, a devastating disease of domestic animals in large parts of sub-Saharan Africa. While many aspects of trypanosome