translation differences classified as a separate component of equity in translation differences and a reconciliation of these differences at the start of the reporting period and at the balance sheet date
Shaking a box of sand II – at the jamming limit, when shape matters
... surface intermittency We have in the above focused largely on the fast dynamical behaviour of the top of a column of grains in the jamming limit, alluding to an increasingly slower dynamics as ... with the local field h n as the position of a random walker at time n For a free lattice random walk of n steps, one has h = n, as all conn figurations are equiprobable, so that the entropy reads ... Edwards’ flatness We notice that there is a reasonable congruence of all the numerical results and the (theoretically more accurate) quenched average at the asymptotic density ρ∞ Thereafter, there are...
- 11
- 392
- 0
As I Remember Recollections of American Society during the Nineteenth Century docx
... become King of Great Britain, I felt even at that late day that the act was a personal grievance Through the passage of many years a fragment of one of these Jacobite songs still rings in my ears: ... her teaching While I was still attending Madame Chegaray's school, my father, under the impression that I was not quite as proficient in mathematics and astronomy as it was his desire and ambition ... for the battle of Bennington, and who for twelve years was a member of the United States Senate and was present as President pro tempore of that body at the first inauguration of Washington Another...
- 220
- 437
- 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc
... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG ... was not clear how many of these putative Vps4p interactions with the MVB sorting machinery may be regulated by Vps4p ATPase activity That not all Vps4p interactions are regulated by ATPase activity ... membrane association and ATPase activity of Vps4p at the yeast multivesicular body Proc Natl Acad Sci USA 103, 6202–6207 Amerik AY, Nowak J, Swaminathan S & Hochstrasser M (2000) The Doa4 deubiquitinating...
- 14
- 362
- 0
Báo cáo y học: "Small variable segments constitute a major type of diversity of bacterial genomes at the species level" pptx
... running MGA and MAUVE alignments and integrating them into the MOSAIC database [55], as well as the Migale bioinformatics platform for providing computational resources and technical assistance The ... Kurokawa K, Ishii K, Yokoyama K, Han CG, Ohtsubo E, Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa ... DNA [70] Moreover, it is suspected that, in nature, bacteria alternate between a mutator and non-mutator state, via the inactivation/activation of the mutS or mutL genes, and during the mutator...
- 15
- 424
- 0
báo cáo khoa học: " Switching to smokeless tobacco as a smoking cessation method: evidence from the 2000 National Health Interview Survey" pot
... points in national adult male smoking prevalence Comparison of ST and pharmaceutical nicotine in a regulatory, legal and social context further suggests that the potential of ST as a cessation aid ... that chewing tobacco is just as likely to cause cancer as smoking cigarettes [20] These findings are in direct contrast to the general agreement among tobacco research and policy experts that ... negative A ban on broadcast advertising of ST had been established as early as 1986 [27], so the estimated $170 million spent by manufacturers in 1999 was restricted largely to print media and...
- 7
- 303
- 0
Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx
... binding assay SI participated in handling and analysing recombinant cell lines AML was involved in the study design, draft and revision of manuscript All authors have read and approved the final ... viral extracts The data obtained did not distinguish between binding to CHO and CHO-CAR using the clinical isolate of CVB5, although an indication of attachment to CHO-CAR was observed when measuring ... suitable for attachment studies and allows the use of crude virus containing extracts as well as limited amounts of cells and viruses Statistical analyses Individual data pairs were analysed by the...
- 6
- 230
- 0
Báo cáo y học: "Influence of genetic variability at the surfactant proteins A and D in community-acquired pneumonia: a prospective, observational, genetic study" pot
... 1A1 0 and 6A- 1A, and a lower frequency of the major SFTPA1aa19-T and aa219-C alleles and of haplotypes 6A3 and 6A3 - 1A1 (see Table 4) Similar results were observed when 90-day mortality was analyzed ... CAP The major alleles of SFTPA1 aa50-G, aa219-C as well as SFTPA2 aa9 -A and aa91-G or genotypes carrying these alleles were associated with protection against CAP The frequencies of the different ... patients who died at 28 or 90 days, and they also predisposed to MODS and ARDS respectively Likewise, 6A was associated with ARDS, and 1A was associated with MODS By contrast, 6A3 and 6A3 - 1A1 ...
- 12
- 278
- 0
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language
... of the research procedures including data gathering techniques, subjects and data gathering procedures were presented Finally, the method and the calculation to analyze data were included at the ... (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing needs and understanding problems Asian Journal of English Language Teaching, 17, pp.65-68 Al-Issa, A ... description of subject, data collection instrument, data gathering procedures, data analysis At the end of this chapter is a conclusion 2.1 Paticipants and Setting of the Study 2.1.1 Paticipants The...
- 50
- 454
- 2
Study of technical feasibility and the payback period of the invested capital for the installation of a grid connected photovoltaic system at the library of the technological federal university of paraná
... [17] has found a difference of 5,5% between annual average daily irradiation obtained at the weather station INMET and database SWERA To conclude, this paper considered 5,5% of the annual average ... energy, and that energy generated in case of surplus is sold to the dealership for a premium rate 2,5 to times the normal rate This variation is a function of the location of the installation and the ... tax and fiscal incentives, regarding the installed photovoltaic power, as well as because of the same unitary installation costs for this power range, the payback period of the invested capital...
- 12
- 431
- 0
AN INVESTIGATION INTO THE EFFECTIVENESS OF COLLABORATIVE BRAINSTORMING AT THE PRE WRITING STAGE IN INTERMEDIATE ENGLISH CLASSES AT a UNIVERSITY IN HANOI
... produce more ideas than those in the collaborative-to-individual sequence The results indicate that training can increase quantity of ideas generated in groups and that group brainstorming session ... of the class The research began with an investigation of students’ idea generation for writing in my class, and then collaborative brainstorming was developed and applied aiming at improving ... Step 2: Reading through all the data I read all the data carefully and sometimes took notes on the margin of the paper Step 3: Coding the data The information was coded, organized and sorted...
- 108
- 314
- 0
Designing an esp syllabus for the second-year students of library study at the national teachers training college
... on the top line Figure : Organization of information Sample paragraph: A card catalog entries are printed on card that libraries arrange alphabetically in drawers A card catalog usually contains ... necessary for completion of the task A major concern is that students understand the task and what they are doing, and not act in a mechanical way Task-based syllabuses are of clear significance ... details Minor details a A card catalog entries are printed on card that libraries arrange alphabetically in drawers A card catalog usually contains of three types of cards for each item in the...
- 76
- 737
- 4
An english-vietnamese cross-cultural study of keeping face at the first encounter
... working easily with small talk questions and this kind of conversation above is called small talk A small talk is defined as an everyday conversation about everyday matters, usually at social ... (NPSs) and Mixed Politeness Strategies (MPSs) are used as analytical framework In each category, the strategies are exploited by the participants, and then calculated as percentages The frequency of ... expectations among participants about its appropriateness and a common willingness and cultural understanding to take part in I.2 Politeness I.2.1 What Face? The nature of politeness has been debating...
- 51
- 1,306
- 12
Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot
... GCCAACACGATTTTCCTCCCAGTTGGAACGGCC GCCAACACGATTTTCAGCCCAGTTGGAACGGCC GCCAACACGATTTTCCGCCCAGTTGGAACGGCCv CCCTTCGCGCCCAACGCACTTACCCAAGGACCG CCCTTCGCGCCCAACGCAAGTACCCAAGGACCG CCCTTCGCGCCCAACGCACGCACCCAAGGACCG ... GGTCGGTCAATTGCGGCTCCTCGCGGCCGTATG GGTCTAGCTCTGTTCACGCCATGGTCATGATGCG GGTCTAGCTCTGTTCACTTCATGGTCATGATGCG CCGACCATTTGGCCCTTCCTGCTGCC CGCCAACACGATTGCCCACCCAGTTGGAACGG GCCAACACGATTTTACGACCAGTTGGAACGGC ... eryngii is a monomeric glycoprotein of 70 kDa with dissociable flavin-adenine dinucleotide (FAD) as cofactor that catalyzes the oxidation of a variety of aromatic and aliphatic polyunsaturated alcohols...
- 11
- 471
- 0
Methods of Policy Accommodation at the Interest-Rate Lower Bound ppt
... demand for real balances); or an increase in the price level (so that the real monetary base does not increase by as large a proportion as the nominal increase) These familiar mechanisms may have ... Eurodollar rate at the date of expiration, and so the price at which such a contract currently trades can be viewed as providing a measure of market expectations of the average level of the funds rate ... extending more than a year into the future The release of the statement had an almost instantaneous effect on market expectations about the future path of the policy rate, as indicated by trading in...
- 97
- 494
- 0
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf
... candidate for the catalytic glutamate of propionate CoAtransferase based on these data was glutamate 324 (Fig 3) Detection of glutamate 324 as the catalytic carboxylate of propionate CoA-transferase ... propionate CoA-transferase was compared to other proteins in the database using the BLAST algorithm [24,25] The protein was most similar to a putative acetoacetate:acetyl-CoA CoA-transferase from ... kJámol)1 acetate The enzymes involved are pyruvate:glutamate transaminase (1), glutamate dehydrogenase (2) (R)-lactate dehydrogenase (3), propionate CoA-transferase (4) (R)lactoyl-CoA dehydratase...
- 9
- 498
- 0
The Turning World Globalisation and Governance at the Start of the 21st Century docx
... That much of the debate in late 2001 was about the positive or negative impacts of what is felt as a new and more powerful form of "globalisation" - and in a context of passionate debate in the ... administration: social, strategic and subsidiarity These are precisely the three rationales that we find at work in the concept and the scenario of the State based on solidarity - a State that, at the ... State intervention in many aspects of social life that in turn led to the creation of popular national States rather than true benefactor States In these popular national States, participation...
- 126
- 462
- 0
Báo cáo khoa học: Hepatocyte-specific interplay of transcription factors at the far-upstream enhancer of the carbamoylphosphate synthetase gene upon glucocorticoid induction doc
... TTCTTAAAACTTGACCAAA Primer GGGTACGATGACTAAATGATCGGA Primer TCATCAGCAGCCCTTCTTTGCACAAC (Figs and 5A, B) Primer GACTAAATGATCGGATACGTGCCCATTCT (Figs and 5C) Lower strand Primer CTCAACGTCATTCTAAAGT Primer ... proteins [3] To compare and validate the in vivo footprinting, we also analyzed in vitro DNaseI-treated DNA by LM-PCR Linearized plasmid containing the CPS enhancer was incubated with either BSA ... Primer ACAACATACTTCGAAACTGTGACC Primer TGTCCTGGCACATGACCCGGATCA h before the start of the experiment DNaseI treatment was performed exactly as previously described [27] Dimethylsulfate treatment...
- 9
- 429
- 0
Taxation of European Companies at the Time of Establishment and Restructuring docx
... upon a reorganization This is the case if capital gains tax is low and the depreciable capacity is increased as part of the realization inasmuch as the benefit from the increased depreciation in ... elaborated (economic principles, legal principles as well as administrative aspects) Based on these findings, the currently applicable rules in the EU member states regarding the treatment of the ... and capital is ensured (Art 14 ECT) Thus, the internal market is rather a national market than an international one, since the system of the market is uniform or supranational and no longer international...
- 282
- 569
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25