Vps4 regulates a subset of protein interactions at the multivesicular endosome Parimala R Vajjhala1, Elizabeth Catchpoole1, Chau H Nguyen1, Carol Kistler1 and Alan L Munn1,2 Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD, Australia School of Biomedical Sciences, University of Queensland, St Lucia, QLD, Australia Keywords endocytosis; lysosome; macromolecular disassembly; membrane traffic; vacuole Correspondence A L Munn, Institute for Molecular Bioscience, University of Queensland, St Lucia, Brisbane, QLD 4072, Australia Fax: +61 73346 2101 Tel: +61 73346 2017 E-mail: A.Munn@imb.uq.edu.au (Received 17 December 2006, revised February 2007, accepted February 2007) doi:10.1111/j.1742-4658.2007.05736.x During endocytic transport, specific integral membrane proteins are sorted into intraluminal vesicles that bud from the limiting membrane of the endosome This process, known as multivesicular body (MVB) sorting, is important for several important biological processes Moreover, components of the MVB sorting machinery are implicated in virus budding During MVB sorting, a cargo protein recruits components of the MVB sorting machinery from cytoplasmic pools and these sequentially assemble on the endosome Disassembly of these proteins and recycling into the cytoplasm is critical for MVB sorting Vacuolar protein sorting (Vps4) is an AAA (ATPase associated with a variety of cellular activities) ATPase which has been proposed to play a critical role in disassembly of the MVB sorting machinery However, the mechanism by which it disassembles the complex is not clear Vps4 contains an N-terminal microtubule interacting and trafficking (MIT) domain, which has previously been shown to be required for recruitment to endosomes, and a single AAA ATPase domain, the activity of which is required for Vps4 function In this study we have systematically characterized the interaction of Vps4 with other components of the MVB sorting machinery We demonstrate that Vps4 interacts directly with Vps2 and Bro1 We also show that a subset of Vps4 interactions is regulated by ATP hydrolysis, and one interaction is regulated by ATP binding Finally, we show that most proteins interact with the Vps4 MIT domain Our studies indicate that the MIT domain has a dual role in substrate binding and recruitment to endosomes and indicate that Vps4 disassembles the MVB sorting machinery by direct effects on multiple proteins During endocytic trafficking, some integral membrane proteins are sorted into internal vesicles which form by invagination of the endosome limiting membrane This process, referred to as multivesicular body (MVB) sorting, is critical for a number of important biological processes including receptor down-regulation, antigen presentation and exosome-dependent intercellular signalling (reviewed in [1–3]) Interest in the mechanism of MVB sorting has escalated since the discovery that components of the MVB sorting machinery are also utilized for virus budding, a process topologically similar to MVB sorting (reviewed in [4,5]) The process of MVB sorting was first examined in mammalian cells [6,7], but the components of the MVB sorting machinery were first characterized in Saccharomyces cerevisiae [8–10] The pathway is highly conserved from yeast to mammalian cells, although the number of components is expanded in mammalian cells because of the multiplicity of isoforms [11] Recognition of a cargo protein, usually by the presence Abbreviations GFP, green fluorescent protein; GST, glutathione S-transferase; HRP, horseradish peroxidase; MIT, microtubule interacting and trafficking; MVB, multivesicular body; PVDF, poly(vinylidene difluoride); Vps, vacuolar protein sorting 1894 FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS P R Vajjhala et al of a ubiquitin molecule, is followed by sequential recruitment of components of the MVB sorting machinery The order of recruitment of the different components to the endosome membrane is starting to emerge, and structural data have recently been obtained for several components (reviewed in [12]) A critical process during MVB sorting is the disassembly of the MVB sorting machinery, which allows recycling and new rounds of vesicle budding However, the molecular mechanisms that regulate cycling of the MVB sorting machinery on and off endosomes is not yet well understood Vps4p, also known as Csc1p, End13p, Grd13p, Vpl4p, Vpt10p, or Did6p, is the only essential component of the MVB sorting machinery with known enzymatic activity It is a member of the AAA (ATPase associated with a variety of cellular activities) family of ATPases [13,14] Mammalian cells express two isoforms of VPS4, VPS4A and VPS4B, and both proteins function in endocytic trafficking [15–17] All members of the AAA superfamily contain one or two copies of a conserved ATPase domain (AAA module) Although not known for Vps4p, other AAA ATPases assemble into oligomeric rings Distinct members of the AAA ATPase family function in diverse cellular processes, but a common theme is protein unfolding and macromolecular disassembly (reviewed in [18,19]) Loss of Vps4p function in yeast and mammalian cells disrupts MVB sorting and results in the formation of an aberrant multilamellar endosomal compartment referred to as the class E compartment [8,14] As both endocytic and biosynthetic traffic to the lysosome ⁄ vacuole proceeds via the MVB, the class E compartment accumulates endocytic and biosynthetic material as well as late Golgi proteins because of defective trafficking out of this compartment [9] In yeast, defective recycling of late Golgi proteins including the receptor that transports soluble vacuolar proteins from the Golgi to the MVB results in missorting and secretion of soluble vacuolar proteins to the extracellular medium [20,21] Loss of Vps4p function is also accompanied by the redistribution of several components of the MVB sorting machinery from the cytoplasm to endosomes [22,23] Therefore Vps4p-dependent ATPase activity has been proposed to be important for disassembly of the MVB sorting machinery and release into the cytoplasm An N-terminal microtubule interacting and trafficking (MIT) domain is required for recruitment of Vps4p to endosomes [22,24,25], but it is not clear precisely how Vps4p disassembles the MVB sorting machinery Previous work from our laboratory has shown that Vps20p, a component of the MVB sorting machinery, interacts Vps4 function at the multivesicular endosome with Vps4p and dissociates from Vps4p upon ATP hydrolysis [26] This was the first evidence that Vps4p ATPase activity can break intermolecular interactions As Vps20p is a coiled-coil protein and interacts with the N-terminal MIT domain of Vps4p, Vps4p ATPase activity may break coiled-coil interactions and thereby disassemble the MVB sorting machinery Several putative interactions have been reported between Vps4p and components of the MVB sorting machinery [27–30] However, as there is a complex network of interactions between the components of the MVB sorting machinery, it was not clear which interactions with Vps4p are direct and which are indirect In addition, it was not clear how many of these putative Vps4p interactions with the MVB sorting machinery may be regulated by Vps4p ATPase activity That not all Vps4p interactions are regulated by ATPase activity is supported by our previous studies showing that the Vps4p interaction with Vta1p is not affected by ATP hydrolysis [26] Here, we demonstrate new direct interactions between Vps4p and the MVB sorting machinery in yeast We present evidence that a subset of Vps4p interactions is regulated by ATP hydrolysis, and that one interaction is regulated by ATP binding to Vps4p Finally, we also show that most Vps4p interactors interact with the MIT domain of Vps4p Results Vps4p binds directly to multiple components of the MVB sorting machinery Vps4p has been shown to bind directly to a few MVB sorting machinery components including Vps20p, Vta1p and Did2p ⁄ Chm1p [26,31] However, it is not known whether the function of Vps4p in disassembly of the MVB sorting machinery is mediated solely via interactions with these proteins or whether Vps4p binds directly to and acts via other components of the MVB sorting machinery We therefore tested candidate Vps4p interactions with components of the MVB sorting machinery When binding of purified Vps4p to MVB components was examined in vitro, Vps4p was found to bind directly to multiple MVB sorting machinery components, including Vps2p and Bro1p, in addition to Vps20p, Vta1p and Did2p, but not to Snf7p (Fig 1) Our data also show that, when molar equivalent amounts of Vps4p interactors are compared, the amount of Vps4p that binds to Did2p is greater than that bound by any of the other interactors These data are consistent with Vps4p having a relatively high affinity for Did2p FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS 1895 Vps4 function at the multivesicular endosome P R Vajjhala et al Fig All of the GST-tagged Vps4p-interacting proteins that function during MVB sorting except Snf7p can bind directly to Vps4p An equal amount of 6His-tagged Vps4p was incubated with glutathione–agarose bearing GST–Snf7p, GST–Vps20p, GST–Bro1p, GST–Did2p, GST–Vps2p, GST–Vta1p or GST alone Unbound protein was recovered in the supernatants Bound protein was released with Laemmli sample buffer The bound and unbound fractions were subjected to SDS ⁄ PAGE and immunoblotting with a polyclonal antibody to Vps4p The shift in the position of Vps4p6His bound to GST–Vps20p is due to the presence of the GST– Vps20p, which migrates very close to Vps4p-6His The data shown are representative of at least two independent experiments ATP binding and ATP hydrolysis by Vps4p regulates protein interactions at the MVB Vps4p has been proposed to function as a protein complex disaggregation machine on endosomes [22] Consistent with this, the binding of Vps20p to Vps4p is regulated by ATP hydrolysis [26] It was likely that other components of the MVB sorting machinery are also substrates for disassembly by Vps4p To test this, we performed the in vitro binding assay in the presence and absence of ATP In the presence of ATP, purified wild-type Vps4 is catalytically active and will hydrolyse added ATP Thus interactions that are regulated by Vps4p ATPase activity are predicted to decrease under these conditions In contrast, interactions that are not regulated by Vps4p ATPase activity are predicted to be unaffected The data obtained show that binding of both Vps2p and Bro1p to Vps4p was decreased in the presence of ATP compared with binding in the absence of ATP However, the binding of Did2p to Vps4p was not affected by the presence of ATP (Fig 2) To determine whether the decreased binding in the presence of ATP is due to ATP hydrolysis or ATP binding, the effect of ATP on binding to a Vps4p mutant (Vps4p–E233Q) that is defective in ATP hydrolysis was also studied Binding of Vps2p and Vps20p to Vps4p–E233Q was increased in the presence of ATP, but binding of Bro1p to Vps4p–E233Q was decreased in the presence of ATP (Fig 2) We surmise that the decreased binding of Vps2p to Vps4p in the presence of ATP is due to Vps4p-dependent ATP hydrolysis In contrast, the decreased binding of Bro1p to wild-type Vps4p and to Vps4p–E233Q in the presence of ATP may be due to competitive binding or an allosteric effect Several components of the MVB sorting machinery interact with Vps4p via the N-terminal MIT domain To determine whether there is any correlation between the binding sites on Vps4p and the response of the interacting proteins to ATP binding and hydrolysis, we determined the region of Vps4p that mediates interaction with Vps2p, Snf7p and Bro1p using the yeast two-hybrid technique (Fig 3) Both Vps2p and Snf7p interact with Vps4p mainly via the Vps4p N-terminal coiled-coil domain (Fig 3C) We did not detect an interaction between Bro1p and full-length Vps4p or any of the Vps4p domains using the yeast two-hybrid technique (not shown) consistent with a previous report [27] To more precisely map the interaction sites of Vps2p, Snf7p, Vps20p, and Did2p within the Vps4p N-terminal domain, we generated two Vps4p N-terminal mutants (Fig 4A,B) and tested the effect of Fig ATP binding and ATP hydrolysis by Vps4p regulates interaction with Bro1p, Vps2p and Did2p The 6His-tagged wild-type Vps4p or Vps4p–E233Q was incubated with glutathione–agarose bearing GST–Vps2p, GST–Bro1p, GST–Did2p or GST–Vps20p in the presence or absence of ATP The bound protein was released with Laemmli sample buffer and subjected to Western blotting using a polyclonal antibody to Vps4p The data shown are representative of at least two independent experiments performed in duplicate 1896 FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS P R Vajjhala et al A B C Fig Vps2p and Snf7p interact with the N-terminal domain of Vps4p (A) Schematic representation of Vps4p with the domain organization inferred from structural data from mammalian VPS4A and VPS4B (B) Constructs used for mapping the region of Vps4p that mediates interaction (C) Yeast two-hybrid interaction analysis of Vps2p and Snf7p with full-length wild-type Vps4p (Vps4p-full), the N-terminal region of Vps4p (Vps4p-N), the previously predicted AAA domain (Vps4p-AAA), and the C-terminal region (Vps4p-C) EGY48 carrying pLexA-based bait plasmids and pB42AD-based prey plasmids as well as the p8OpLacZ reporter plasmid were spotted on to medium containing X-gal Plates were photographed after overnight incubation, and two-hybrid interaction was assessed by blue coloration Three independent transformants are shown these mutations on the different Vps4p interactions In the Vps4p–YEE mutant, residues 26–29 in the second helix of the MIT domain were deleted These residues are completely conserved between the yeast and human VPS4 isoforms In the Vps4p–IRA mutant, residues 56–71 in the third helix of the MIT domain were deleted These residues are also highly conserved The YEE and IRA mutants are named after the first three amino acids that were deleted in each motif We also tested the effect of a previously described Vps4pcoiled-coil (CC) mutation [22] in which residues 50–87, which comprises most of the second and third helices of the MIT domain, were deleted Yeast two-hybrid analysis (Fig 4C) revealed that each mutation diminished but did not abolish Did2p interaction, whereas Vps2p interaction was abolished by the Vps4p–IRA and Vps4p-CC mutations All the Vps4 function at the multivesicular endosome N-terminal mutations tested abolished Vps20p and Snf7p interactions As expected, the interaction of Vta1p with the Vps4p C-terminal domain was not diminished by any of the N-terminal mutants we tested To confirm the yeast two-hybrid interactions described above and to identify the domain of Vps4p to which Bro1p binds, we performed in vitro proteinbinding assays (Fig 4D) The data obtained indicate that the Vps4p–YEE and Vps4p–IRA mutations diminish direct binding of Vps2p, Vps20p and Did2p The Vps4p-CC mutation appeared to increase binding to all interactors However, the Vps4p-CC mutant protein also displayed an interaction with glutathione S-transferase (GST) alone (Fig 4D) and displayed an increased interaction with the Vps4p antibody (not shown) Thus, we cannot interpret the data obtained for this Vps4p-CC mutant protein Mutation of the b domain abolished interaction with Vta1p as previously reported [32,33] and in addition increased binding to the N-terminal interactors, including Vps2p, Vps20p and Did2p None of the N-terminal MIT domain mutations or the C-terminal b domain mutations diminished binding of Vps4p to Bro1p In summary, our data indicate that most Vps4pinteracting proteins (Vps2p, Vps20p, Did2p and Snf7p) interact with the N-terminal MIT domain of Vps4p In addition, these data show that the Bro1p interaction with Vps4p is unique as it is undiminished by mutations in the N-terminal MIT domain or b domain Vps4p interactions with Did2p, Vps2p and Vps20p are important for recruitment to endosomes and for MVB sorting To determine whether the Vps4p YEE and IRA motifs play a role in Vps4p recruitment to endosomes, wildtype and mutant Vps4p tagged with green fluorescent protein (GFP) were expressed in cells in which the chromosomal VPS4 gene has been deleted (vps4D) Wild-type GFP-tagged Vps4p could be detected on punctate structures (Fig 5A) consistent with localization to endosomes, as previously reported [22] However, the GFP-tagged Vps4p–YEE and Vps4p–IRA mutant proteins, like the GFP-tagged Vps4p-CC mutant protein, exhibited severely reduced punctate localization We conclude that the Vps4p YEE and IRA motifs are important for Vps4p recruitment to endosomes To test whether the YEE and IRA motifs and the region deleted in the Vps4p-CC mutant protein are important for Vps4p function in vivo, we tested the ability of the N-terminal mutant proteins to restore FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS 1897 Vps4 function at the multivesicular endosome P R Vajjhala et al A B D C Fig Interaction with Vps2p, Snf7p, Vps20p and Did2p, but not with Bro1p, is diminished by mutation of conserved residues in the Vps4p MIT domain (A) Alignment of human VPS4A, VPS4B and S cerevisiae (Sc) Vps4p sequences using CLUSTAL W [50] The conserved YEE and IRA motifs that were deleted are shown in bold, and the previously described coiled-coil (CC) mutation is shown underlined (B) Location in the VPS4A MIT domain of the conserved YEE and IRA motifs and the region deleted in the previously described Vps4p-CC mutant (C) Yeast two-hybrid interaction analysis of wild-type (WT) Vps4p and Vps4p N-terminal mutants with Vps2p, Snf7p, Vps20p, Did2p, and Vta1p Interaction analysis was performed as described in the legend to Fig Three independent transformants are shown (D) In vitro binding of 6Histagged wild-type Vps4p and Vps4p N-terminal mutants to GST-tagged Vps2p, Vps20p, Did2p, Bro1p, and Vta1p, or to GST alone Equal amounts of full-length 6His-tagged proteins were incubated with glutathione–agarose beads bearing the different GST fusion proteins or GST alone Bound protein was released with Laemmli sample buffer and subjected to Western blotting using a polyclonal antibody to Vps4p The data shown are representative of two independent experiments A Western blot of the different 6His-tagged proteins used for the in vitro binding assay (5% input) is also shown MVB sorting and delivery of a soluble vacuolar protein to the vacuole (vacuolar protein sorting) in vps4D yeast As a marker for MVB sorting, we used a GFPand ubiquitin-tagged form of the iron transporter homologue, Fth1p (GFP-Fth1p-Ub), which is known to undergo MVB sorting into the vacuole lumen [34] In vps4D yeast expressing wild-type Vps4p, the GFPFth1p-Ub undergoes MVB sorting and is transported to the vacuole lumen (Fig 5B) However, in vps4D yeast expressing the Vps4p–YEE, Vps4p–IRA or 1898 Vps4p-CC mutant proteins, MVB sorting of GFPFth1p-Ub was not significantly improved compared with vps4D cells carrying empty vector To assess the ability of the Vps4p mutant proteins to restore transport of a soluble vacuolar protein to the vacuole in vps4D yeast, we tested their ability to correct the missorting and secretion of a soluble vacuolar protein, carboxypeptidase Y Expression of wild-type Vps4p, but not Vps4p–YEE, Vps4p–IRA or Vps4p-CC mutant proteins restored vacuolar transport of carboxy- FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS P R Vajjhala et al Vps4 function at the multivesicular endosome A Fig An intact MIT domain is required for Vps4p localization to endosomes and for Vps4p in vivo function (A) AMY245 vps4D yeast cells expressing GFP-tagged wild-type (WT) Vps4p, Vps4p-CC, Vps4p–YEE, and Vps4p–IRA or carrying empty vector (YCplac111) were grown in SD medium and the GFP-tagged proteins visualized by fluorescence microscopy The same fields of cells are shown visualized by fluorescence (right) and Nomarski (left) optics Scale bar, lm (B) Ubiquitin-dependent MVB sorting of Fth1p-GFP-Ub in AMY245 (vps4D) yeast cells carrying plasmids expressing wild-type Vps4p or Vps4p mutant proteins or carrying empty vector (YCplac111) Cells were incubated in SD medium containing 100 lM bathophenanthrolinedisulfonic acid for h to chelate iron and induce Fth1p-GFP-Ub expression Cells were then washed with buffer containing 1% sodium azide, 1% sodium fluoride, and 100 mM phosphate, pH 8.0, to stop further transport The same fields of cells are shown visualized by fluorescence (right) and Nomarski (left) optics Scale bar, lm (C) Vacuolar protein sorting in AMY245 (vps4D) yeast cells carrying plasmids expressing wild-type Vps4p or Vps4p mutant proteins or carrying empty vector (YCplac111) or no vector Cells were grown on YPUAD solid medium for days at 24 °C in contact with a nitrocellulose filter RH1800 (wild-type) yeast cells without any vector (boxed in both panels) was included as a control Cells were eluted from the filter, and carboxypeptidase Y on the filter was detected by immunoblotting with anticarboxypeptidase Y serum To test for cell lysis, the blot was stripped and re-probed with an antibody to a cytoplasmic protein (calmodulin) (D) Total cell lysates from AMY245 vps4D yeast cells expressing wild-type Vps4p, Vps4p-CC, Vps4p–YEE, and Vps4p–IRA or carrying empty vector (YCplac111) were subjected to Western blotting using a polyclonal antibody to Vps4p as well as an antibody to actin B C D peptidase Y compared with vps4D cells transformed with empty vector alone (Fig 5C) We conclude that the YEE and IRA motifs as well as the region deleted in the Vps4p-CC mutant are important for Vps4p function in MVB sorting and vacuolar protein sorting To test whether the phenotypes of vps4D cells expressing the Vps4p N-terminal mutants were due to lowered expression or degradation of the mutant proteins, we tested the steady-state expression of the mutant Vps4p proteins (Fig 5D) Although both the Vps4p–IRA and Vps4p–YEE mutants are expressed, their steady-state connections are somewhat reduced compared with that of wild-type Vps4p However, such a modest reduction in expression level is unlikely to account for the inability of these mutant proteins to restore MVB sorting and vacuolar protein sorting in vps4D yeast Surprisingly, the expression of the Vps4p-CC mutant was significantly greater than that FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS 1899 Vps4 function at the multivesicular endosome P R Vajjhala et al of wild-type Vps4p We conclude that the phenotypes observed in vps4D cells expressing the Vps4p N-terminal mutants are due to loss of function of these mutant proteins We surmise that the interactions of the Vps4p MIT domain with Did2p, Vps2p, Vps20p and Snf7p are critical for Vps4p recruitment to endosomes and Vps4p function in MVB sorting Discussion Here, we show that Vps4p has the ability to interact directly with multiple components of the MVB sorting machinery A number of these interactions are mediated by the MIT domain of Vps4p, and a subset are regulated by Vps4p-dependent ATP hydrolysis Interestingly, however, two interactions had unique features The interaction of Bro1 with Vps4p is regulated by ATP binding rather than hydrolysis, and interaction of Did2p with Vps4p is regulated by neither ATP binding nor ATP hydrolysis Our data highlight the fact that the role of Vps4p in MVB sorting is more complex than previously assumed As there exists mammalian orthologues of these MVB sorting proteins, our findings are likely to have relevance to VPS4 function in mammalian cells An indication that Vps4p may interact with Vps2p and Bro1p came from previous studies [28,35] However, a network of interactions connects components of the MVB sorting machinery, therefore it was not clear whether these putative Vps4p interactions were direct or indirect Ours is the first study to show that the interactions with Vps2p and Bro1p are direct Several lines of evidence suggest that the interactions we have characterized are physiologically important Firstly, the Vps4p interactions studied here are all with proteins known to function in MVB sorting Secondly, a subset of the interactions are regulated by ATP binding or ATP hydrolysis by Vps4p Finally, direct in vivo evidence that these interactions are important comes from our phenotypic analysis of vps4 mutants in which some of these interactions are abrogated We did not detect a direct interaction between Vps4p and Snf7p, consistent with a previous study [36] However, while this paper was in preparation, a report [37] was published demonstrating a direct interaction using differently tagged constructs Our findings in this study allow us to classify Vps4p interactions into three types; those regulated by ATP binding, those that are regulated by ATP hydrolysis, and those that are not regulated by either These different types of interaction may contribute to Vps4p function in different ways The interactors may be 1900 important for recruitment of Vps4p to endosomes, they may be substrates acted upon by Vps4p during disassembly of the MVB sorting machinery, or their function at the MVB may be regulated by Vps4p For example, the high affinity of Did2p for Vps4p coupled with the fact that this interaction is not regulated by ATP binding or hydrolysis supports a role for Did2p in recruitment of Vps4p to endosome membranes This is consistent with previous studies showing that Vps4p is efficiently recruited to endosomes in both its nucleotide-bound [22] and nucleotide-free [38] states In contrast, Vps2p and Vps20p are likely to be substrates of Vps4p during disassembly of the MVB sorting machinery This process is known to require cycling of Vps4p between an ATP-bound and nucleotide-free state Finally, although Bro1p does not appear to be a substrate, it might be regulated by Vps4p, as it is displaced by ATP binding to Vps4p The MIT domain of Vps4p appears to play a dual role in endosome localization and substrate binding Here, we have shown that motifs in the MIT domain that are highly conserved between yeast Vps4p and mammalian VPS4 isoforms are required for endosome localization These data are consistent with a previous study showing that deletion of a larger region, which includes most of the second and third helices of the MIT domain, prevents Vps4p recruitment to endosomes Moreover, our interaction studies have shown that these conserved motifs are also important for interaction with Vps2p, Vps20p, Did2p and Snf7, indicating that some or all of these interactions may be required for efficient targeting of Vps4p to the endosome Each of these proteins has been proposed in various studies to be important for Vps4p targeting to endosomes [23,26,39,40] Although the Vps4p N-terminal mutant proteins all retain interaction with Bro1p and Vta1p, these are clearly not sufficient for Vps4p recruitment to endosomes As the binding of Vps2p and Vps20p, which both bind to the MIT domain, is regulated by ATP hydrolysis, our data suggest that the MIT domain may also function as a substrate-binding site Thus our in vivo studies with the Vps4p mutant proteins suggest that loss of Vps4p function in MVB sorting and vacuolar protein sorting may be due to both inefficient recruitment to endosomes and interaction with substrates Our studies together with data from a previous study [25] indicate that four MVB sorting proteins, Vps2p, Vps20p, Snf7p and Did2p, all interact with the MIT domain of Vps4p, suggesting that these proteins may have a common motif or common fold Intriguingly, when we searched for a common motif in these Vps4p-interacting proteins, we identified a motif, FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS P R Vajjhala et al VDELMD, in Vps20p that is highly conserved in Did2p (VDELMS) and Snf7p (VDETMD) and might be present in a degenerate form in Vps2p (ADEIVN) Although the precise binding sites are not known, these motifs fall within the identified regions of Did2p and Vps20p that bind to Vps4p In contrast to these interactors, Bro1p does not contain this motif and does not appear to bind to the Vps4p MIT domain or b domain, as mutations in these domains did not diminish interaction with Bro1p Although this is intriguing, the motif may be shared by these proteins because it has some other function important for MVB sorting The N-terminal and C-terminal Vps4p domains have been thought to function independently in Vps4p endosome recruitment and assembly This is because the N-terminal Vps4p-CC mutant, which is not recruited to endosomes, assembles into an oligomer with ATPase activity [22] Also, mutation of the b domain of Vps4p abrogates Vps4p oligomer assembly, but does not affect Vps4p recruitment to endosomes [33] However, our data indicate that mutations in the Vps4p MIT domain strengthen Vps4p interactions mediated by the b domain In addition, mutation of the b domain strengthens interactions with the MIT domain Thus our data offer the first evidence that there may be functional interactions between the N-terminal and C-terminal Vps4p domains Our finding that the interaction of Bro1p with Vps4p is regulated by ATP binding alone is intriguing Ubiquitinated cargo proteins are sorted and then deubiquinated before their incorporation into an intraluminal vesicle This prevents degradation of ubiquitin along with the cargo protein [41] Bro1p recruits the de-ubiquitinating enzyme Doa4p to the MVB [42] Displacement of Bro1p by ATP binding to Vps4p may allow removal of the de-ubiquitinating machinery immediately before closure of the intraluminal vesicle and disassembly of the MVB sorting machinery This will be an interesting topic for a future investigation An unexpected observation made during the course of our study indicated that Vps4p may be subjected to ubiquitin-mediated degradation Deletion of most of helices and of the MIT domain led to a considerable increase in expression of the mutant protein compared with deletion of smaller regions within or adjacent to this large deletion A comparison of the sequences deleted in the various mutants suggests that this increased expression may be correlated with loss of the sequence SYEENAAKKS This sequence bears some resemblance to a sequence, SINNDAKSS, which is present in the cytoplasmic tail of the yeast mating factor receptor, Ste2p [43] In the SINNDAKSS Vps4 function at the multivesicular endosome sequence, the serine residues are phosphorylated by casein kinase I homologues, and this in turn is required for ubiquitination of the lysine residue by the Nedd4-like ubiquitin ligase, Rsp5p [44,45] Mono-ubiquitination of the SINNDAKSS sequence serves as a signal for endocytosis and subsequent MVB sorting and degradation in the vacuole [43] The similarity of this sequence and that present in the MIT domain of Vps4p suggests that Vps4p may be subject to ubiquitin-dependent degradation This will be interesting to investigate in the future Our findings support a model for MVB sorting in which nucleotide-free Vps4p is recruited to endosomes via interactions that may involve Vps2p, Vps20p, Snf7p and particularly Did2p, which binds Vps4p to a greater extent than all other interactors (Fig 6A) Upon recruitment of Vps4p to endosomes, it can interact with Bro1p initially in the absence of bound ATP Upon ATP binding to Vps4p (Fig 6B), Bro1p is displaced ATP binding is predicted to contribute to Vps4p assembly into an oligomeric ring [22], which is aided by Vta1p [46] ATPase activity of Vps4p is stimulated by Vta1p [33,46] and even more by Vps20p [33] Our data are in agreement with the proposed role of Vps4p in disassembly of the MVB sorting machinery, and support a role for disassembly via effects on Vps2p and Vps20p (Fig 6C), as interactions with both of these proteins are sensitive to ATP hydrolysis (this study [26]) Current data suggest that Vps20p in particular has numerous interactions with components of the MVB sorting machinery [27,30] and appears to play a key role in holding together the complex Thus unfolding of Vps20p is predicted to destabilize the assembled MVB sorting machinery In summary, we have performed the first systematic study of interactions between Vps4p and the MVB sorting machinery Several of these interactions have distinct properties Only a subset of these interactions is regulated by Vps4p ATPase activity, and one interaction is regulated by Vps4p ATP binding Studying the role of Vps4p in the regulation of protein–protein interactions at the MVB will lead to a better understanding of the mechanism of MVB sorting and virus budding Experimental procedures Media, reagents, strains and plasmids YPUAD and SD minimal media were as described previously [26] Lucifer Yellow (LY) carbohydrazide dilithium salt was from Fluka AG (Buchs, Switzerland) Horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG, and bathophenanthrolinedisulfonic acid were from Sigma FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS 1901 Vps4 function at the multivesicular endosome P R Vajjhala et al Fig A model for Vps4p-mediated disassembly of the MVB sorting complex (A) Vps4p is recruited to the endosome membrane through interactions that may involve Did2p, Vps2p, Vps20p and Snf7p Did2p is predicted to play an important role because of its high-affinity interaction that is insensitive to ATP binding or ATP hydrolysis The Vps4p dimers shown at the endosome membrane may form in the cytoplasm and then be recruited to endosomes, or monomeric Vps4p may be recruited to the endosome membrane and then oligomerize on the membrane Bro1p can initially interact with Vps4p and recruits Doa4p, which de-ubiquitinates the cargo protein (B) ATP binding to Vps4p at the endosome membrane mediates its assembly into an oligomeric ring, which is promoted by Vta1p Bro1p is displaced by ATP binding to Vps4p (C) Upon ATP hydrolysis by Vps4p, effects on Vps2p and Vps20p are predicted to break interactions with these proteins and thus disassemble the MVB sorting complex In addition, the Vps4p high-molecular-mass oligomer disassembles (D) The soluble components of the MVB sorting machinery are ready for another round of MVB sorting The Vps4 interactors that we have studied are shown in pink, and other components are shown in grey Components of the ESCRT complexes (0–III) are circled in box A (St Louis, MO, USA) HRP-conjugated anti-mouse IgG was from Bio-Rad Laboratories (Hercules, CA, USA), and HRP-conjugated anti-goat IgG was from Zymed (San Francisco, CA, USA) Ni ⁄ nitrilotriacetate–agarose and monoclonal antibody to pentaHis were from Qiagen (Hilden, Germany) Immobilized glutathione on agarose was from Scientifix (Melbourne, Australia) Pre-stained protein molecular mass marker was from Fermentas (Hanover, MD, USA) poly(vinylidene difluoride) (PVDF) membrane was from Millipore (Bedford, MA, USA) Polyclonal anti(carboxypeptidase Y) and anti-calmodulin sera were gifts from H Riezman (University of Geneva, Geneva, Switzerland), polyclonal antibody to Vps4p was from Santa Cruz Biotechnology (Santa Cruz, CA, USA), and monoclonal antibody to actin was from Chemicon (Temecula, CA, USA) 1902 S cerevisiae strains used in this study are listed in Table Transformation of yeast with plasmid DNA was performed using a modified lithium acetate protocol [47] PCR primers used for plasmid constructions were from GeneWorks (Thebarton, Australia) and are listed in Table Plasmids used in this study are listed in Table Table Yeast strains used in this study Strain Genotype Source EGY48 AMY245 MATa his3 trp1 ura3 LexAop(· 6)-LEU2 MATa vps4-D::KanMx leu2 ura3 his4 lys2 bar1 MATa his4 leu2 ura3 bar1 Clontech [33] RH1800 Riezman lab strain FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS P R Vajjhala et al Vps4 function at the multivesicular endosome Table Primers used for mutagenesis Primer Sequence (5¢- to 3¢) Vps4 Upstr F Vps4 SalI R Vps4 SalI F Vps4 Dstr R YEE F YEE R IRA F IRA R CGCTGCAGTAAGAGCAGTAAACCCG GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGG Table Plasmids used in this study Plasmid Description Source YCplac111 pGEX5X-1 pGEX-4T pET11d p8op-lacZ pLexA pB42AD pPL 1640 pAM 349 pAM 377 pAM 378 pAM 398 pAM 451 pAM 452 pAM 453 pAM 454 pAM 482 pAM 496 pAM 813 pAM 862 pAM 863 pAM 870 pAM 922 pAM 922 pAM 932 pAM 934 pAM 969 pAM 977 pAM 979 pAM 980 pAM 981 pAM 982 pAM 985 pAM 986 pAM 987 pAM 988 pAM 989 pAM 990 pAM 991 pAM 992 pAM 996 pAM 997 CEN4 ARS1 LEU2 E coli ⁄ yeast shuttle vector GST fusion expression vector GST fusion expression vector T7 RNA polymerase-based gene expression vector Two-hybrid reporter plasmid Two-hybrid bait vector Two-hybrid prey vector URA3 CEN plasmid expressing Fth1p-GFP-Ub Original library clone of VPS20 in pB42AD (encoding Vps20p 3–221 ⁄ end) pGEX5X-1 expressing Vps20p with an N-terminal GST tag pGEX5X-1 expressing Vta1p with an N-terminal GST tag Original library clone of VTA1 in pB42AD (encoding Vta1p 108–330 ⁄ end) pLexA expressing LexA fused to Vps4p pLexA expressing LexA fused to N-terminal domain of Vps4p (residues 1–128) pLexA expressing LexA fused to AAA domain of Vps4p (residues 129–350) pLexA expressing LexA fused to C-terminal domain of Vps4p (351–437 ⁄ end) pET11a E coli expression vector expressing Vps4p with a C-terminal 6His tag Original library clone of DID2 ⁄ CHM1 in pB42AD (encoding Did2p ⁄ chmlp 41–204 ⁄ end) YCplac111 expressing Vps4p pET11d E coli expression vector expressing Vps4p-GAI with a C-terminal 6His tag YCplac111 expressing Vps4p with a C-terminal yEGFP tag pB42AD expressing the activation domain fused to Vps4p YCplac111 expressing Vps4p–E233Q YCplac111 expressing Vps4p-CC YCplac111 expressing Vps4p D31-87 (Vps4p-CC) with a C-terminal yEGFP tag pB42AD expressing the activation domain fused to Snf7p pB42AD expressing the activation domain fused to Vps2p pGEX-4T expressing Snf7p with an N-terminal GST tag pLexA expressing LexA fused to Vps4p-CC pLexA expressing LexA fused to Vps4p D26–29 (Vps4p–YEE) pLexA expressing LexA fused to Vps4p D56–71 (Vps4p–IRA) pB42AD expressing the activation domain fused to Bro1p YCplac111 expressing Vps4p (Vps4p–YEE) with a C-terminal yEGFP tag YCplac111 expressing Vps4p (Vps4p–IRA) with a C-terminal yEGFP tag pGEX-4T expressing Vps2p with an N-terminal GST tag pGEX-4T expressing Did2p with an N-terminal GST tag pGEX-4T expressing Bro1p with an N-terminal GST tag pET11a E coli expression vector expressing Vps4p-CC with a C-terminal 6His tag pET11a E coli expression vector expressing Vps4p–YEE with a C-terminal 6His tag pET11a E coli expression vector expressing Vps4p–IRA with a C-terminal 6His tag YCplac111 expressing Vps4p–YEE YCplac111 expressing Vps4p–IRA [51] GE Healthcare GE Healthcare Novagen Clontech Clontech Clontech [34] [26] [26] [26] [26] [26] [26] [26] [26] [26] [33] [33] [33] [33] [33] [33] This study [33] This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS 1903 Vps4 function at the multivesicular endosome P R Vajjhala et al The sequence of all constructs was confirmed by automated DNA sequencing (Australian Genome Research Facility, Brisbane, Australia) (SG) complete medium lacking Ura, Trp, and His and containing X-gal The strength of protein interactions was assessed by blue coloration on this medium Plasmid construction In vitro binding assays Genomic DNA was prepared as described previously [48] from S cerevisiae RH449, and an S cerevisiae cDNA library was a gift from Michael White (University of Texas South-western Medical School, Dallas, TX, USA) PCR was carried out using the proofreading DNA polymerases Pfu (Fermentas) or Phusion (Finnzymes, Espoo, Finland) N-Terminal YEE and IRA mutations were generated by site-directed mutagenesis using the oligonucleotides listed in Table In each case two separate PCRs were set up with either the Vps4 Upstr F primer and a mutagenic reverse primer or a mutagenic forward primer and a SalI R primer The two PCR products were combined for a third PCR using the Vps4 Upstr F and SalI R primers The resulting PCR product encoding the N-terminal region of Vps4p, with a mutation, was ligated with pAM813 that had been digested with PstI and SalI to release the wild-type sequence To generate pLexA constructs with N-terminal CC, YEE or IRA mutations, mutant VPS4 was amplified without any upstream sequence and with suitable restriction sites for cloning To express Vps4p–YEE and IRA N-terminal mutants with a C-terminal GFP tag, both constructs were amplified without a stop codon and cloned in-frame into a YCplac111-based plasmid encoding yEGFP, which was cloned from pYM12 [49] To express N-terminal mutants with a C-terminal 6His tag in Escherichia coli, DNA encoding the N-terminal mutants were amplified with a primer-encoded C-terminal 6His tag and ligated downstream of the T7 promoter of pET11d (Novagen, Madison, WI, USA) The wild-type VPS2, SNF7 and BRO1 genes were amplified by PCR from genomic DNA and subcloned into pB42AD in-frame with the activation domain The SNF7 and BRO1 genes were subcloned from the pB42AD expression plasmids into pGEX-4T1 in-frame with GST The DID2 gene was amplified from genomic DNA and cloned into pGEX-4T in-frame with GST The VPS2 cDNA was amplified from a cDNA library and ligated into pGEX-4T in-frame with GST In vitro binding assays were performed as previously described [26] The 6His-tagged wild-type Vps4p, Vps4p–E233Q, Vps4p-CC, Vps4p–YEE, and Vps4p–IRA as well as GST-tagged Vps2p, Snf7p, Vps20p, Bro1p, Did2p and Vta1p, and GST alone were expressed in BL21CodonPlusTM(DE3)–RIL E coli and affinity-purified on Ni ⁄ nitrilotriacetate–agarose or glutathione–agarose, respectively The 6His-tagged proteins were eluted from the resin using 250 mm imidazole and buffer exchanged into binding buffer (20 mm Hepes, 200 mm sorbitol, 100 mm potassium acetate, mm EDTA, mm dithiothreitol, 20 mm MgCl2, 0.1% Triton X-100) The Vps4p YEE and IRA mutant proteins were poorly expressed in E coli compared with wild-type Vps4p To test for direct in vitro binding, glutathione–agarose bearing 25 lg GST–Vps2p, GST–Snf7p, GST–Vps20p, GST–Did2p, or 50 lg GST-Bro1p or 500 lg GST were incubated with 10 lg wild-type 6His-Vps4p in mL binding buffer To test for ATPase-sensitive or ATPsensitive binding, the amount of GST fusion proteins used in the in vitro binding assay was decreased to allow detection of any difference in Vps4p binding in the presence of ATP Thus 45 lg GST–Bro1p, 28 lg GST–Vps20p, 13 lg GST–Vps2p, or lg GST–Did2p were incubated with 10 lg wild-type 6His-Vps4p or 6His-Vps4p–E233Q in mL binding buffer in the presence or absence of mm ATP To compare the binding of wild-type and Vps4p N-terminal mutant proteins, 2.5 lg full-length 6His-tagged wild-type Vps4p or Vps4p mutant protein was incubated with glutathione–agarose, bearing GST alone (500 lg), lg GST–Bro1p, lg GST–Vps20p, lg GST–Vta1p, lg GST–Did2p, or lg GST–Vps2p in mL binding buffer In all in vitro binding assays, samples were incubated overnight at °C The resin was washed four times with binding buffer, and the protein bound to the resin was eluted by heating with Laemmli sample buffer An aliquot of the supernatant containing unbound protein was diluted : in Laemmli sample buffer Bound and unbound proteins were resolved by SDS ⁄ PAGE and transferred to a PVDF filter Wild-type Vps4p and Vps4p mutant proteins were detected with an antibody to Vps4p and enhanced chemiluminescence Yeast two-hybrid protein interaction analysis Protein interactions were assayed using the Matchmaker LexA yeast two-hybrid system from Clontech (Palo Alto, CA, USA) as described previously [26] Briefly, bait plasmids containing LexA fusion proteins were cotransformed into the yeast strain EGY48 along with prey plasmids encoding proteins fused to an activation domain and the reporter plasmid p8op-LacZ To test for interaction, transformants were spotted on to synthetic galactose ⁄ raffinose 1904 Western blot analysis of total yeast cell lysates For western blot analysis of total cell lysates, AMY245 (vps4D) yeast cells carrying expression plasmids were grown at 24 °C for 24 h Cells from mL culture were pelleted and resuspended in 240 lL lysis solution (1.85 m NaOH, 1.06 m 2-mercaptoethanol) followed by incubation for FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS P R Vajjhala et al 10 on ice Proteins were precipitated by the addition of an equal volume of trichloroacetic acid, and the pellet was washed with ice-cold acetone The pellet was resuspended in 50 lL resuspension solution (5% SDS, 0.5 m Tris) and mixed with an equal volume of 75% glycerol ⁄ 0.12 m dithiothreitol ⁄ 0.05% bromophenol blue and boiled for Samples were subjected to SDS ⁄ PAGE, and proteins were transferred to a PVDF filter, which was then probed with a goat polyclonal antibody to Vps4p To assess sample loading, the same samples were electrophoresed on a second gel, transferred to PVDF, and probed with a monoclonal antibody to actin Phenotypic assays Assays for MVB sorting and carboxypeptidase Y secretion were performed as described previously [33] Microscopy Microscopy was performed using an Olympus BX51 (Olympus Australia Pty, Ltd, Mount Waverly, Australia) with a Nomarski filter for visualizing vacuoles and the appropriate filter for viewing GFP fluorescence Bioinformatics Alignment of yeast Vps4p and mammalian VPS4 sequences to identify highly conserved sequence was carried out using clustal w [50] Identification of common motifs between the Vps4p-interacting proteins was determined using the glam (Gapped Local Alignment of Motifs) program (M C Frith and T L Bailey, personal communication) Acknowledgements This work was made possible by funding from the National Health and Medical Research Council of Australia Project Grant 298921 and from core support from the Queensland State Government, all to A.L.M We thank M C Frith and T L Bailey for the use of the glam2 program References Katzmann DJ, Odorizzi G & Emr SD (2002) Receptor downregulation and multivesicular-body sorting Nat Rev Mol Cell Biol 3, 893–905 Trombetta ES & Mellman I (2005) Cell biology of antigen processing in vitro and in vivo Annu Rev Immunol 23, 975–1028 Fevrier B & Raposo G (2004) Exosomes: endosomalderived vesicles shipping extracellular messages Curr Opin Cell Biol 16, 415–421 Vps4 function at the multivesicular endosome Bieniasz PD (2006) Late budding domains and host proteins in enveloped virus release Virology 344, 55–63 Morita E & Sundquist WI (2004) Retrovirus budding Annu Rev Cell Dev Biol 20, 395–425 Palade GE (1955) A small particulate component of the cytoplasm J Biophys Biochem Cytol 1, 59–68 Sotelo JR & Porter KR (1959) An electron microscope study of the rat ovum J Biophys Biochem Cytol 5, 327– 342 Raymond CK, Howald-Stevenson I, Vater CA & Stevens TH (1992) Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants Mol Biol Cell 3, 1389–1402 Rieder SE, Banta LM, Kohrer K, McCaffery JM & Emr SD (1996) Multilamellar endosome-like compartment accumulates in the yeast vps28 vacuolar protein sorting mutant Mol Biol Cell 7, 985–999 10 Odorizzi G, Babst M & Emr SD (1998) Fab1p PtdIns (3) P 5-kinase function essential for protein sorting in the multivesicular body Cell 95, 847–858 11 von Schwedler UK, Stuchell M, Muller B, Ward DM, Chung HY, Morita E, Wang HE, Davis T, He GP, Cimbora DM, Scott A, et al (2003) The protein network of HIV budding Cell 114, 701–713 12 Hurley JH & Emr SD (2006) The ESCRT complexes: structure and mechanism of a membrane-trafficking network Annu Rev Biophys Biomol Struct 35, 277–298 13 Riezman H, Munn A, Geli MI & Hicke L (1996) Actin-, myosin- and ubiquitin-dependent endocytosis Experientia 52, 1033–1041 14 Babst M, Sato TK, Banta LM & Emr SD (1997) Endosomal transport function in yeast requires a novel AAA-type ATPase, Vps4p EMBO J 16, 1820–1831 15 Yoshimori T, Yamagata F, Yamamoto A, Mizushima N, Kabeya Y, Nara A, Miwako I, Ohashi M, Ohsumi M & Ohsumi Y (2000) The mouse SKD1, a homologue of yeast Vps4p, is required for normal endosomal trafficking and morphology in mammalian cells Mol Biol Cell 11, 747–763 16 Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara A, Yoshimori T, Yokota S & Himeno M (2003) A dominant negative form of the AAA ATPase SKD1 ⁄ VPS4 impairs membrane trafficking out of endosomal ⁄ lysosomal compartments: class E vps phenotype in mammalian cells J Cell Sci 116, 401–414 17 Sachse M, Strous GJ & Klumperman J (2004) ATPasedeficient hVPS4 impairs formation of internal endosomal vesicles and stabilizes bilayered clathrin coats on endosomal vacuoles J Cell Sci 117, 1699–1708 18 Hanson PI & Whiteheart SW (2005) AAA+ proteins: have engine, will work Nat Rev Mol Cell Biol 6, 519–529 19 Sauer RT, Bolon DN, Burton BM, Burton RE, Flynn JM, Grant RA, Hersch GL, Joshi SA, Kenniston JA, Levchenko I et al (2004) Sculpting the proteome with FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS 1905 Vps4 function at the multivesicular endosome 20 21 22 23 24 25 26 27 28 29 30 31 P R Vajjhala et al AAA (+) proteases and disassembly machines Cell 119, 9–18 Cereghino JL, Marcusson EG & Emr SD (1995) The cytoplasmic tail domain of the vacuolar protein sorting receptor Vps10p and a subset of VPS gene products regulate receptor stability, function, and localization Mol Biol Cell 6, 1089–1102 Piper RC, Cooper AA, Yang H & Stevens TH (1995) VPS27 controls vacuolar and endocytic traffic through a prevacuolar compartment in Saccharomyces cerevisiae J Cell Biol 131, 603–617 Babst M, Wendland B, Estepa EJ & Emr SD (1998) The Vps4p AAA ATPase regulates membrane association of a Vps protein complex required for normal endosome function EMBO J 17, 2982–2993 Lin Y, Kimpler LA, Naismith TV, Lauer JM & Hanson PI (2005) Interaction of the mammalian endosomal sorting complex required for transport (ESCRT) III protein hSnf7–1 with itself, membranes, and the AAA+ ATPase SKD1 J Biol Chem 280, 12799–12809 Takasu H, Jee JG, Ohno A, Goda N, Fujiwara K, Tochio H, Shirakawa M & Hiroaki H (2005) Structural characterization of the MIT domain from human Vps4b Biochem Biophys Res Commun 334, 460–465 Scott A, Gaspar J, Stuchell-Brereton MD, Alam SL, Skalicky JJ & Sundquist WI (2005) Structure and ESCRT-III protein interactions of the MIT domain of human VPS4A Proc Natl Acad Sci USA 102, 13813– 13818 Yeo SC, Xu L, Ren J, Boulton VJ, Wagle MD, Liu C, Ren G, Wong P, Zahn R, Sasajala P, Yang H, Piper RC & Munn AL (2003) Vps20p and Vta1p interact with Vps4p and function in multivesicular body sorting and endosomal transport in Saccharomyces cerevisiae J Cell Sci 116, 3957–3970 Bowers K, Lottridge J, Helliwell SB, Goldthwaite LM, Luzio JP & Stevens TH (2004) Protein–protein interactions of ESCRT complexes in the yeast Saccharomyces cerevisiae Traffic 5, 194–210 Gavin AC, Bosche M, Krause R, Grandi P, Marzioch M, Bauer A, Schultz J, Rick JM, Michon AM, Cruciat CM et al (2002) Functional organization of the yeast proteome by systematic analysis of protein complexes Nature 415, 141–147 Ho Y, Gruhler A, Heilbut A, Bader GD, Moore L, Adams SL, Millar A, Taylor P, Bennett K, Boutilier K et al (2002) Systematic identification of protein complexes in Saccharomyces cerevisiae by mass spectrometry Nature 415, 180–183 Ito T, Chiba T, Ozawa R, Yoshida M, Hattori M & Sakaki Y (2001) A comprehensive two-hybrid analysis to explore the yeast protein interactome Proc Natl Acad Sci USA 98, 4569–4574 Howard TL, Stauffer DR, Degnin CR & Hollenberg SM (2001) CHMP1 functions as a member of a newly 1906 32 33 34 35 36 37 38 39 40 41 42 43 44 45 defined family of vesicle trafficking proteins J Cell Sci 114, 2395–2404 Scott A, Chung HY, Gonciarz-Swiatek M, Hill GC, Whitby FG, Gaspar J, Holton JM, Viswanathan R, Ghaffarian S, Hill CP, et al (2005) Structural and mechanistic studies of VPS4 proteins EMBO J 24, 3658–3669 Vajjhala PR, Wong JS, To HY & Munn AL (2006) The beta domain is required for Vps4p oligomerization into a functionally active ATPase FEBS J 273, 2357–2373 Urbanowski JL & Piper RC (2001) Ubiquitin sorts proteins into the intralumenal degradative compartment of the late-endosome ⁄ vacuole Traffic 2, 622–630 Fujita H, Umezuki Y, Imamura K, Ishikawa D, Uchimura S, Nara A, Yoshimori T, Hayashizaki Y, Kawai J, Ishidoh K, et al (2004) Mammalian class E Vps proteins, SBP1 and mVps2 ⁄ CHMP2A, interact with and regulate the function of an AAA-ATPase SKD1 ⁄ Vps4B J Cell Sci 117, 2997–3009 Peck JW, Bowden ET & Burbelo PD (2004) Structure and function of human Vps20 and Snf7 proteins Biochem J 377, 693–700 Nickerson DP, West M & Odorizzi G (2006) Did2 coordinates Vps4-mediated dissociation of ESCRT-III from endosomes J Cell Biol 175, 715–720 Bishop N & Woodman P (2000) ATPase-defective mammalian VPS4 localizes to aberrant endosomes and impairs cholesterol trafficking Mol Biol Cell 11, 227–239 Babst M, Katzmann DJ, Estepa-Sabal EJ, Meerloo T & Emr SD (2002) Escrt-III: an endosome-associated heterooligomeric protein complex required for mvb sorting Dev Cell 3, 271–282 Lottridge JM, Flannery AR, Vincelli JL & Stevens TH (2006) Vta1p and Vps46p regulate the membrane association and ATPase activity of Vps4p at the yeast multivesicular body Proc Natl Acad Sci USA 103, 6202–6207 Amerik AY, Nowak J, Swaminathan S & Hochstrasser M (2000) The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways Mol Biol Cell 11, 3365–3380 Luhtala N & Odorizzi G (2004) Bro1 coordinates deubiquitination in the multivesicular body pathway by recruiting Doa4 to endosomes J Cell Biol 166, 717–729 Hicke L & Riezman H (1996) Ubiquitination of a yeast plasma membrane receptor signals its ligand-stimulated endocytosis Cell 84, 277–287 Hicke L, Zanolari B & Riezman H (1998) Cytoplasmic tail phosphorylation of the alpha-factor receptor is required for its ubiquitination and internalization J Cell Biol 141, 349–358 Dunn R & Hicke L (2001) Multiple roles for Rsp5p-dependent ubiquitination at the internalization step of endocytosis J Biol Chem 276, 25974–25981 FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS P R Vajjhala et al 46 Azmi I, Davies B, Dimaano C, Payne J, Eckert D, Babst M & Katzmann DJ (2006) Recycling of ESCRTs by the AAA-ATPase Vps4 is regulated by a conserved VSL region in Vta1 J Cell Biol 172, 705–717 47 Munn AL, Stevenson BJ, Geli MI & Riezman H (1995) end5, end6, and end7: mutations that cause actin delocalization and block the internalization step of endocytosis in Saccharomyces cerevisiae Mol Biol Cell 6, 1721–1742 48 Adams A, Gottschling DE, Kaiser KA & Stearns T (1997) Methods in Yeast Genetics A Cold Spring Harbor Laboratory Course Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Vps4 function at the multivesicular endosome 49 Knop M, Siegers K, Pereira G, Zachariae W, Winsor B, Nasmyth K & Schiebel E (1999) Epitope tagging of yeast genes using a PCR-based strategy: more tags and improved practical routines Yeast 15, 963–972 50 Thompson JD, Higgins DG & Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice Nucleic Acids Res 22, 4673–4680 51 Gietz RD & Sugino A (1988) New yeast–Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites Gene 74, 527–534 FEBS Journal 274 (2007) 1894–1907 ª 2007 The Authors Journal compilation ª 2007 FEBS 1907 ... GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGG... Vps4 Upstr F Vps4 SalI R Vps4 SalI F Vps4 Dstr R YEE F YEE R IRA F IRA R CGCTGCAGTAAGAGCAGTAAACCCG GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG... was not clear how many of these putative Vps4p interactions with the MVB sorting machinery may be regulated by Vps4p ATPase activity That not all Vps4p interactions are regulated by ATPase activity