the kinetic energy of a system of
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
... erythrocyte energy metabolism Average ranking of saturation parameters according to their impact on the dynamic stability of the network assessed by analysis of the eigenvalues of the resampled Jacobian ... and detailed rate laws (hybrid model, values in bold) The heading designates the type of load parameter varied and the range of variation relative to the normal value of the reference state The ... ATP shown in Fig According to the exact model, the maximum of the ATP consumption rate appears at a 3.3-fold increased value of kATPase as compared to the value k0 ATPase ẳ 1:6 h At values of...
- 15
- 456
- 0
Tài liệu Báo cáo khoa học: The kinetic properties of various R258 mutants of deacetoxycephalosporin C synthase doc
... enzymes Mutants can be grouped into those that affect apparent Km values, those that affect kcat values and those that affect both Km and kcat values In the case of the R258K mutant with 2-OG, a modest ... concentration of cosubstrate was used in each experiment and so apparent kinetic parameters are reported Secondly, the concentration of the 2-oxoglutarate cosubstrate has been shown to be a critical ... all mutants were purified to at least 85% purity (as judged by SDS/PAGE and gel filtration analyses) using a combination of anion-exchange and gel filtration chromatographies The DNA sequences of...
- 7
- 412
- 0
Developing a system of exercises to improve public speaking skill in interpreting for the 4th year students of english at vinh university
... justified the use of questionnaire as the main research instrument Different phases of the data collection and analysis procedures were depicted in the third part The procedure of the data analysis was ... understand and know the way to improve their appearance when being a public speaker It will have a good effect to their speech later Through this part, we can realize that attitude and appearance are ... appearance before going to stage As an overall trend, we can see that all of students at Vinh University have a good preparation of appearance before being a public speaker As can be seen clearly...
- 71
- 689
- 1
Tài liệu Báo cáo khoa học: A knowledge-based potential function predicts the specificity and relative binding energy of RNA-binding proteins ppt
... B & Szabo A (1988) An analysis of the accuracy of Langevin and molecular dynamics algorithms Mol Physics 65, 1409–1419 Supplementary material The following supplementary material is available ... tests of docking decoy discrimination We anticipate that the performance of the potential will only increase with the size of the structural database and as terms are added to the model to account ... cut-off values for some sets of mutation data (Table 3) Some of these mutations are not near the protein–RNA interface (e.g one of the ˚ U 1A mutations, D79V, is A from the RNA molecule), and...
- 14
- 736
- 0
Tài liệu Báo cáo khoa học: A kinetic model of the branch-point between the methionine and threonine biosynthesis pathways in Arabidopsis thaliana doc
... Butikofer and Valerie Verne for the ELISA assays We thank Pr Roland Douce and Dr Michel Matringe and Mickaela Homan for critical reading of the manuscript Special ă thanks to Maighread Gallagher ... Database and can be accessed at http://jjj.biochem.sun.ac.za/ database/curien/index.html free of charge Fig Phser branch-point in the aspartate-derived amino acid biosynthetic pathway in plants ... the TS catalytic constant in the absence and presence of a saturating concentration of AdoMet, respectively K1K2 is the product of the binding constants for the association of the rst and the second...
- 13
- 906
- 0
Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx
... trouvés as “assisted readymades” because they allow an artist to remake the act of creation as one of pure insight and inspired recognition rather than one of manual craftsmanship (see Taylor, ... complement of adjectival properties used by Veale and Hao (2007), we harvest all instances of the patterns “as ADJ and * as” and “as * and ADJ as” from Google, noting the combinations that are found and ... that AdjA1 and AdjA2 are mutually reinforcing The combination is indexed on AdjA1+AdjA2 Example: “as dark and sophisticated as a chocolate martini” (3) AdjA NounS where NounS denotes a cultural...
- 6
- 442
- 0
A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf
... White, also, is a name of a thing, or rather of things Whiteness, again, is the name of a quality or attribute of those things Man is a name of many things; humanity is a name of an attribute of ... cut the matter short by saying, two ideas They would say, that the subject and predicate are both of them names of ideas; the idea of gold, for instance, and the idea of yellow; and that what takes ... The Calculation Of Chances Chapter XIX Of The Extension Of Derivative Laws To Adjacent Cases Chapter XX Of Analogy Chapter XXI Of The Evidence Of The Law Of Universal Causation Chapter...
- 1,048
- 548
- 0
Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt
... [10], and Porphyromonas gingivalis [11], parasitic protozoa such as Trichomonas vaginalis [12] and Entamoeba histolytica [13], and the plant Arabidopsis thaliana [14] MGL has been implicated in the ... for catalysis Arg55 of EhMGL1 and Arg58 of EhMGL2 are located near the PLP of the neighboring subunit of the catalytic dimer, as revealed by X-ray crystallography (unpublished data), similar to ... development of new chemotherapeutics against amoebiasis For the further development of antiamoebic agents based on TFM, elucidation of the underlying reaction mechanisms of MGLs and the interaction of...
- 13
- 406
- 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt
... purification of MAO A The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG ... Palo Alto, CA, USA) The concentration of benzylamine was typically in the range 0.02–2 mm, and the assay was started by the addition of MAO A to a final concentration of 0.6 lm Michaelis–Menten kinetic ... in MAO A R V Dunn et al Fig S5 Substrate dependence of the reductive halfreaction of MAO A- catalysed oxidation of PEA at pH 8.5 and 20 °C This material is available as part of the online article...
- 9
- 327
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...
- 8
- 551
- 0
Báo cáo khoa học: Heterologous expression of a serine carboxypeptidase-like acyltransferase and characterization of the kinetic mechanism potx
... l-malate leading to proton abstraction by the active site seryl alkoxide acting as a base The thereby activated l-malate would then attack directly the ester carbonyl of sinapoylglucose, in accordance ... membrane, a fusion with the leader of the initiation-specific a- 1,6-mannosyltransferase (OCH1; amino acids 1–30) [23] was applied Vacuolar localization was accomplished by a partial sequence of ... reactions The kinetic characterization of AtSMT reaction revealed a random sequential bi-bi mechanism The presence of both sinapoylglucose and l-malate in the active site may favor acyl transfer...
- 13
- 310
- 0
Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx
... in each case As the autocatalytic activation of trypsinogen is quantitative, the increase in trypsin activity shows the appearance of newly processed trypsin during the reaction, and the y scale ... value of KI Note that the expressions of kcat and Km are exactly the same as the case of mixed inhibition for the classical Michealis–Menten kinetics Three different types of special cases can ... M)1Æcm)1 As there are many sets of constants that give essentially the same curve, the individual fit for each set of experimental data to Eqn (12) cannot give reliable estimates for the kinetic parameters...
- 8
- 403
- 0
Báo cáo khoa học: A kinetic model for the burst phase of processive cellulases pptx
... elucidate and rationalize such interrelationships of activity and processivity Materials and methods All mathematical analysis and numerical tting were performed using the software package Mathematica ... and off rate At a xed k2, a change in this ratio may be interpreted as a change in the afnity of the enzyme for the substrate Hence, we can assess relationships of this afnity parameter and the ... examples of how the analysis of the kinetic parameters may elucidate certain aspects of the activity of Cel 7A First, we consider changes in the ratio k1S0 k3 This reects the ratio of the on rate...
- 14
- 572
- 0
Measuring the Economic Value of a City Park System docx
... Philadelphia Philadelphia parks have support galore In fact, there are more than 100 “friends of parks” organizations Two of them, the Philadelphia Parks Alliance and Philadelphia Green, operate ... quadrangles, and corporate campuses.) Third, the amount and characteristics of rainfall are calculated from U.S weather data The model (which Philadelphia Department of Parks and Recreation combines aspects ... trees around the Tidal Basin, the stately elms gracing the Reflecting Pool, and massive oaks of Lafayette Park, there are 4,839 acres of general tree cover in the city’s 7,999 acres of parkland Their...
- 28
- 386
- 0
báo cáo sinh học:" Forecasting the need for medical specialists in Spain: application of a system dynamics model" potx
... are those used by the US Department of Health and Human Services [51] These rates and appropriate standards can be set as parameters, as the model is an instrument that allows Page of the Health ... describe the states of the system, such as the number of medical specialists, while flow variables depict the rates of change of levels, such as the number of training positions that are available ... liberal immigration policies, it had the highest population growth rate of the European Union, with an average annual increase of 1.6% and a Page of total increase of 15%, leading to a great increase...
- 9
- 543
- 1
Báo cáo hóa học: " Quantification of the effects of an alpha-2 adrenergic agonist on reflex properties in spinal cord injury using a system identification technique" pptx
... seated and secured in an adjustable chair with the ankle strapped to the footrest and the thigh and trunk strapped to the chair The seat and footrest were adjusted to align the ankle axis of rotation ... and writing the manuscript DC referred the patients and participated in interpreting data, and WZR participated in interpreting data and writing the manuscript All authors read and approved the ... repeated Following comple- Page of tion of each trial, the torque and EMG signals were examined for non-stationarities or co-activation of other muscles If there was evidence of either, the data...
- 7
- 465
- 0
báo cáo hóa học: " On the solvability conditions of the first boundary value problem for a system of elliptic equations that strongly degenerate at a point" pdf
... equations, diagonal systems and variational integrals Manuscripta Math 55, 467–486 (1986) doi:10.1007/BF01186659 Rutkauskas, S: On the first boundary value problem for the class of elliptic systems ... systems degenerating at an inner point Math Model Anal 6(1), 147–155 (2001) Rutkauskas, S: On the Dirichlet problem for a system of degenerate at a point elliptic equations in the class of bounded ... |m|≤n of the particular solutions obtained above Note, if αk0 = for some k0, ≤ k0 ≤ s -1, then ak = for all natural k ≤ k0 - (Such a situation can come to exist, if a < 2.) Therefore, all the sums...
- 11
- 399
- 0
báo cáo hóa học: " Exponential energy decay and blow-up of solutions for a system of nonlinear viscoelastic wave equations with strong damping" ppt
... decay of solutions for a quaslinear system of viscoelastic equations Nonlinear Anal 71, 2257–2267 (2009) doi:10.1016/j.na.2009.01.060 22 Agre, K, Rammaha, MA: Systems of nonlinear wave equations ... = and b = and for a wider class of relaxation functions He established a more general decay result, for which the usual exponential and polynomial decay results are just special cases For the ... Mathematical Sciences, Nanjing Normal University, Nanjing 210046, PR China 2Department of Mathematics, Anhui Science and Technology University, Feng Yang 233100, Anhui, PR China Liang and Gao...
- 19
- 369
- 0
Báo cáo hóa học: " Atomic force microscopy investigation of the kinetic growth mechanisms of sputtered nanostructured Au film on mica: towards a nanoscale morphology control" pot
... Dipartimento di Fisica e Astronomia, Università di Catania via S Sofia 64, 95123 Catania, Italy 2CNR-IMM MATIS, via S Sofia 64, I-95123 Catania, Italy Laboratory for Molecular Surface and Nanotechnology ... the SPMLabAnalyses V7.00 software that define each grain area by the surface image sectioning of a plane that was positioned at half grain height In this way we can obtain the distributions of ... suitable support for crystalline Au deposition because the small mismatch of the crystal lattice allows the Au to grow in large atomically flat areas The understanding of the kinetic growth mechanisms...
- 13
- 581
- 0
báo cáo hóa học:" Research Article Note on the Persistent Property of a Discrete Lotka-Volterra Competitive System with Delays and Feedback Controls" pptx
... Gopalsamy, Stability and Oscillations in Delay Differential Equations of Population Dynamics, vol 74 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, ... LotkaVolterra competitive system with delays and feedback controls,” Journal of Computational and Applied Mathematics, vol 211, no 1, pp 1–10, 2008 S Ahmad, “On the nonautonomous Volterra-Lotka ... competition equations,” Proceedings of the American Mathematical Society, vol 117, no 1, pp 199–204, 1993 S Ahmad and A C Lazer, “On the nonautonomous N-competing species problems,” Applicable Analysis,...
- 9
- 351
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25