the first law of thermodynamics is a restatement of which of these laws
Tài liệu Chapter XV The First Law of Thermodynamics pdf
... constantPV)(11)()(2211221121VPVPVPVPRCTTnCWVV120lnVVnRTWQ4/29/2008 2Chapter XV The First Law of Thermodynamics §1. Heat, work and paths of a thermodynamic process§2. The first law of thermodynamics §3. Kinds of thermodynamic processes§4. Thermodynamic processes ... processes for an ideal gas4/29/2008 26Summary The first law of thermodynamics: ΔU = Q - W The change of internal energy The quantity of heat addedto the system The work doneby the system The work ... Calculation of work done during volume changes: A typical example of a thermodynamic system is an amount of gas enclosed in a cylinderwith a movable piston. (Such a system is the central part...
- 27
- 597
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... oligo-merization domain (i.e. b sheets 7 and 8, the AAAdomain helix and the C-terminal helix). However, the majority of these proteins are likely to be other meioticclade AAA ATPases and have the AAA ... domain helixand the C-terminal helix, but not the b domain. The distinguishing feature of members of the meioticclade of AAA ATPases is the SRH motif, which dif-fers from that of other AAA ATPases ... (SRH). The SRHdistinguishes AAA family ATPases from otherWalker-type ATPases [21]. A pair of conserved Argresidues within this motif activate ATPase activity inan adjacent ATPase domain [22,23]...
- 23
- 490
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 wasconstructed to contain SUT2 as ... 5¢-TGACGCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGATATGAAGGCATAGGCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TATTAATATTCCTATATTTTACATAGGAGGAAATTACATGCATGAAACCTACAGCTGAAGCTTCGTACGC-3¢, respectively. The plasmid pFL38-RAS2 was con-structed by ligating the ... (S1278b) the kanMX cassette from plasmidpUG6 [12] was amplified by polymerase chain reaction(PCR) using the primers disRAS2fwd 5¢-TAACCGTTTTCGAATTGAAAGGAGATATACAGAAAAAAAACAGCTGAAGCTTCGTACGC-3¢ and...
- 8
- 485
- 0
Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt
... for the generous gift of the microarray data analysis that was originally per-formed at the Penn Microarray Facility (University of Pennsylvania, Philadelphia, PA, USA). We also thankDrs Angus ... Chip1up primer (5¢-aagctccagagggtctgcac-3¢) andChip1dw primer (5¢-gaaaggcatcccgaacgcat-3¢); Chip2upprimer (5¢-aaatgtcttgaccagccgtc-3¢) and Chip2dw primer(5¢-gaaacaaaggcctctcccag-3¢); Chip3up ... [3,4,8]. Therefore, it is clear that the identification of the molecular regulatorsresponsible for intestinal epithelial establishment,determination and maturation is crucial to the provision of a...
- 13
- 359
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACAATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTGpGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGAATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACCATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAGpYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2...
- 14
- 517
- 0
The Euro Imbalances and Financial Deregulation: A Post-Keynesian Interpretation of the European Debt Crisis pot
... external crisis. From our post-Keynesian point of view, the evidence against a fiscal crisis is so clear-cut that it is somewhat perplexing that the academic and political debate is fundamentally ... a share of assets of all commercial banks. “Z-Score” is estimated as ROA+equity/assets/sd(ROA); the standard deviation of ROA, sd(ROA), is estimated as a 5-year moving average. Source: Based ... Cesaratto and Stirati (2011) suggest that German mercantilism—that is, the stagnant wages and export-led strategy of growth in Germany is at the center of the crisis. Our analysis suggests that export-led...
- 37
- 442
- 0
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx
... equivalent to 20–25% of the total surface.Voltage electrodes had resistances of 0.2–0.5 MW.Custom-made software and hardware were used for acquisition andanalysis of data. Leakage and linear capacity ... shown are the mean (j) and standard deviation (bars) for each cRNA a: b ratio, and the sample size percRNA combination is shown in parenthesis. Data are from five different batches of oocytes, each ... TX,USA), in the presence of antisense primer SB1-20 (5¢-TCAAACCACACCCCGAGAAA-3¢)and[32P]dATP[aP](3000 CiÆmmol)1; Amersham Pharmacia Biotech.), follow-ing the manufacturer’s instructions. The...
- 9
- 415
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... Nakamura, and K. Sugama for their technical as-sistance. This work was supported financially by a grant from the Ministry of Education, Science and Culture of Japan (High-Tech Research Center, ... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig. 1A) . The PCR ... BNP, which was originally isolated from the por-cine brain [6], shows an amino acid sequence homol-ogy to ANP. BNP has central and peripheral actions that are similar to those of ANP. The heart...
- 7
- 612
- 1
How group work is used in speaking lesson of the first year major students of english at viet nam university of commerce
... study was analysed both quantitatively and qualitatively. As for quantitative analysis, we used descriptive statistics to quantify the data in form of charts and figures. The qualitative data were ... language theory, CLT has a rich theoretical base and some of the characteristics of the communicative view of language are:- Language is a system for the expression of meaning- The primarily ... in the study. Research materials are addressed in the forth part. The data collection procedure is followed and the data analysis is in the last part. The details are going to be presented as...
- 42
- 1,861
- 4
A study on teaching oral skills to the first year students at Hanoi University of Industry in the Communicative Approach
... CLT as in the situations in Korean, Indonesian and Japanese context. HaUI teachers' opinions about the traditional grammar based exams as a difficulty and their priority of training in assessing ... this chapter is devoted to the reexamination of the concepts most relevant to the thesis’s topic. Firstly, an account of the CLT theory is made. Secondly, characteristics of communication is ... that a majority do not recognize the notion of the teacher as a “facilitator” and the student as “generator of knowledge”, nor do they accept an emphasis on a student-based 34are in the first...
- 44
- 1,605
- 9
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... application, and dietary or vitamin supplements, which are the goods listed in the registration cited as a bar to the registration of the mark applicant seeks to register. Nine such third-party registrations ... an automated search of publications. She argued that this evidence establishes that the goods are related. The first article indicates that skin toner, cologne and skin cream contain vitamins. ... connotation. The commercial impressions these two marks create are very similar. Contrary to the arguments presented by applicant, we find that the record in this appeal clearly establishes that...
- 8
- 416
- 0
- the first law of thermodynamics states that energy in a system is
- the first law of thermodynamics is generally referred to as
- the first law of thermodynamics is related to the conservation of which quantity
- the first law of thermodynamics states that energy is constant
- the first law of thermodynamics states that the energy of the universe is
- the first law of thermodynamics states that energy is constant it can
- the first law of thermodynamics is a restatement of which of these laws
- the first law of thermodynamics is a restatement of the quizlet
- the first law of thermodynamics is a restatement of the law of conservation of momentum
- the first law of thermodynamics states that energy is constant it can but not
- the first law of thermodynamics is a restatement of the law of conservation of
- the first law of thermodynamics states that the total energy of the universe is
- the first law of thermodynamics states that energy is constant it can but not quizlet
- the first law of thermodynamics states that the of the universe is constant
- the first law of thermodynamics states that the total energy in a closed system is
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25