the first law of thermodynamics is a restatement of the law of conservation of momentum
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... oligo-merization domain (i.e. b sheets 7 and 8, the AAAdomain helix and the C-terminal helix). However, the majority of these proteins are likely to be other meioticclade AAA ATPases and have the AAA ... domain helixand the C-terminal helix, but not the b domain. The distinguishing feature of members of the meioticclade of AAA ATPases is the SRH motif, which dif-fers from that of other AAA ATPases ... material is availableonline:Fig. S1. Sequence alignment of the C-terminal regions of Vps4, spastin, katanin and fidgetin from a range of species.This material is available as part of the online articlefrom...
- 23
- 490
- 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc
... phosphorylase, causes a large activation of glycogensynthase but a small stimulation of glycogen synthesis; (c)that the stimulation of glycogen synthesis by inactivation of phosphorylase is associated ... with both activation andtranslocation of glycogen synthase, and that the formermechanism alone cannot explain the stimulation of glyco-gen synthesis. This suggests that translocation of glycogensynthase ... of the phosphorylase inactivator, we suggest thatadditional factors may be involved in translocation of glycogen synthase and that phosphorylase a itself may be animportant determinant of the...
- 9
- 381
- 0
Shooting the Sacred Cows of Money Putting a bullet in the head of bad financial advice
... Tom is an international speaker and anadjunctprofessorin the Masters of TaxprogramatArizonaStateUniversity.Heservesas the RichDadAdvisorforTaxandWealthStrategyand is the author of anupcomingRichDadAdvisorbookonbuildingwealththroughtaxstrategies. ... industry was born called nancial planners. Today it takes 30 days to become a nancial planner. It still takes a year and a half to become a massage therapist. RobertAndy,whatdoyouthink of mutualfunds?Andy ... my house had appreciated in value. Again, that’s capital gains versus cash ow. And what peoplearendingoutnowthat the realestatemarkethascrashedand the value of homeshasbeensuckedout…nowpeopleareupsidedownontheirhome,andthey’rendingoutit’s a liabilitybecausetheystillhavetopay the bankonthat...
- 38
- 492
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACAATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTGpGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ... GCGGGATCCGTGAATAATCTGCACCCTCGAATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTTpYESTrp2 ⁄ PDIP46 ⁄ SKAR(D) GCGGGATCCCTCAGCCCATTGGAAGGCACCATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAGpYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2...
- 14
- 517
- 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... evolutionary analysis of the DNase I family. The mammalian group formed a relatively tight cluster, while the snake (E. quadrivirgata,E. climacophora and A. blomhoffii), amphibian (X. laevis,Rana catesbeiana, ... quadrivirgata,E. climacophoraand A. blomhoffiiDNases ITotal RNA was isolated from each snake pancreas by the acid guanidinium thiocyanate/phenol/chloroform method[24] and any DNA contamination was ... reagent grade and available commercially. The snakes and Japanese white rabbits were acquired, main-tained and used in accordance with the Guidelines for the Care and Use of Laboratory Animals...
- 8
- 500
- 0
Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf
... annulata, Budonosoma granulifera, Cassiopeaxamachana, Condylactys gigantea, Gorgonia ventalina,Lebrunia danae, Palythoa caribaeorum, Physalia phy-salis, Plexaura homomalla, Stichodactyla helianthus ... magnifica Phylum Annelida, Class Polychaeta, SubclassPalpata, Order Canalipalpata, Suborder Sabellida, Family Sabellidae,Genus Sabellastarte [14] The ‘tentacle crown’ and the ‘body’ parts of ... the kingdom Methazoa(Phyla: Annelida, Urochordata, Echinodermata, Cnidaria,Mollusca, Artropoda) were collected in the north coast of Havana and classified by Cuban specialists at the NationalInstitute...
- 16
- 628
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part1 pot
... of examinations:1. Financial audits attest to the fairness of the financial statements of agencies. Theyexamine the adequacy of the financial records and accounting and internal controls, andthey ... the Governorand the Legislature of the State of HawaiiConducted by The AuditorState of HawaiiandKPMG LLP THE AUDITORSTATE OF HAWAIISubmitted byThis is trial versionwww.adultpdf.comvTable of ContentsChapter ... May 2002Summary4 The Office of the Auditor and the certified public accounting firm of KPMG LLPconducted a financial audit of the Department of Public Safety, State of Hawaii for the fiscal...
- 10
- 374
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part2 docx
... departmental annualreport. The Internal Affairs Office conducts criminal, administrative, and civilinvestigations of the employees of the department and the lawful use anddisposition of departmental ... System of the State of Hawaii; (2) the national average1 of nine days for all protective services,which includes police officers and prison and security guards; and (3) the national average1 of ... the number of opportunities for overtime the ACO has had to date.At the smaller facilities, the watch commander selects the ACO from a call back list. The call back list is similar to the volunteer...
- 10
- 363
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part3 pot
... versionwww.adultpdf.com23Chapter 3: Financial Audit The AuditorState of Hawaii:We have audited the combined financial statements of the Department of Public Safety, State of Hawaii (department), as of and for the fiscal ... 2001.Except as discussed in the preceding paragraph, we conducted our auditin accordance with auditing standards generally accepted in the UnitedStates of America and the standards applicable to financial ... to above present fairly, in all materialrespects, the financial position of the Department of Public Safety, State of Hawaii, as of June 30, 2001, and the results of its operations and the cash...
- 10
- 372
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part4 pptx
... is established if information indicates that it is probable that a liability has been incurred at the date of the combined financialstatements and the amount of the loss is reasonably estimable.Total ... described above is a materialweakness.This report is intended solely for the information and use of the Auditor,State of Hawaii, and the management of the department and is notintended to be and ... encumbered, general fund appropriationsgenerally lapse at the end of the fiscal year for which the appropriationswere made. The State Legislature specifies the lapse date and any otherparticular conditions...
- 10
- 397
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part5 pptx
... options at an actuarially determined rate.Measurement of assets and actuarial valuations are made for the entireERS and are not separately computed for individual participatingemployers such as the ... optionsprovide a monthly retirement allowance based on the employee’s age,years of credited service, and average final compensation (AFC). The AFC is the average salary earned during the five highest paid ... the combined financial statements and the amount of the loss is reasonablyestimable.Note 13 – RiskManagementThis is trial versionwww.adultpdf.com40Chapter 3: Financial AuditExhibit A ProprietaryFiduciaryFund...
- 10
- 504
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part6 pot
... leave should beinvestigated in a timely manner. The department has stated that it is unfair to compare ACOs’ levels of sick leave usage with that of other state agencies and national averages.We ... DirectorCorrectionsSmNEY A. HAYAKAWADeputy Director Law EnforcementSTATE OF HAWAIIDEPARTMENT OF PUBLIC SAFETY919Ala Moana Boulevard, 4th FloorHonolulu, Hawaii 96814RECE~IEDHAriL 52 PH 'OlO f'.' ... transmitted a draft of this report to the Department of Public Safety(department) on April 25, 2002. A copy of the transmittal letter to the department is included as Attachment 1. The response of the...
- 10
- 365
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part7 ppt
... atOCCC, Halawa, and Maui Community Correctional Center (MCCC). In addition,Kulani and Kauai Community Correctional Center have historically had lowerrates of overtime. The Wardens at these facilities ... unfortunately the reality. We are fully aware of the problemand of what it will take to arrive at a solution, and we are making every effort toaddress it.Nevertheless, we are pleased to report that ... amount of overtime that the ACO has already worked. The Department worked with the UPWon the procedures for assigning overtime work on a fair and equitable basisfor the larger facilities, Oahu...
- 5
- 352
- 0
Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature of the State of Hawaii Report No. 02-10 May 2002_part1 ppt
... Financial Audit of the Department of Public SafetyReport No. 02-10May 2002 A Report to the Governorand the Legislature of the State of HawaiiConducted by The AuditorState of HawaiiandKPMG ... State Auditor to conductpostaudits of the transactions, accounts, programs, and performance of all departments, offices, and agencies of the State of Hawaii (State) andits political subdivisions. The ... InternalAffairsOfficeInspectionsandInvestigationsOfficeCivilRightsComplianceOfficeOffice of the DeputyDirectorforAdministrationOffice of the DeputyDirectorforCorrectionsOffice of the DeputyDirectorfor Law EnforcementFiscalOfficeAdministrativeServicesOfficeTrainingandStaffDevelopmentOfficePersonnelManagementOfficeClassificationOfficeProgramCoordinationOfficeIntakeServiceCentersDivisionCommunityCorrectionalCentersDivisionCorrectionalFacilitiesDivisionHealthCareDivisionCorrectionsProgramServicesDivisionCorrectionalIndustriesDivisionProtectiveServicesDivisionExecutiveProtectionSectionNarcoticsEnforcementDivisionSheriffDivision*Administrativelyattachedto the department.This is trial versionwww.adultpdf.com The Auditor State of HawaiiOVERVIEWFinancial Audit of the...
- 10
- 259
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25