... application, and dietary or vitamin supplements, which are the goods listed in the registration cited as a bar to the registration of the mark applicant seeks to register. Nine such third-party registrations ... an automated search of publications. She argued that this evidence establishes that the goods are related. The first article indicates that skin toner, cologne and skin cream contain vitamins. ... with the Examining Attorney and applicant that the critical question in the case before us centers on the relationship between the goods. The marks are very similar in sound, appearance and...
... 5-ACATTGTGCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAGAATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATCAGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAGAGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATGAGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3.AcknowledgementThis ... [c-32P]-ATP. MBP was used as an artifi-cial substrate to assess the kinase activity and GST alone wasused as a negative control. The top panel shows the kinase assayvisualized by autoradiography and ... mutants simulatingdisease resistance response. Cell 77, 565–577.26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K,Miyao A, Kawasaki T, Shimamoto K & Hirochika H(2007) Rice Pti 1a negatively...
... to the learner is the same as the number of credits allocated to the component. The full number of credits is always awarded if the student achieves a passing grade; it is never adjusted according ... information), but they should ascertain that it contains all the elements and that, as far as pos-sible, the sequence is respected.More information on the European Union is available on the ... workload information• about these assessment methods that is available well in advance award of the number of ECTS credits• allocated to each educational component after the required assessment...
... phosphatasessigma and delta. J Neurosci 26, 5872–5880.35 Stoker AW, Gehrig B, Newton MR & Bay BH (1995)Comparative localisation of CRYP alpha, a CAM-liketyrosine phosphatase, and NgCAM in the ... black dots, protease cleavage sites. (B) SDS ⁄ PAGEseparation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose. (C) SDS ⁄ PAGE and silverstain ... inevitable partial degradation ofnucleolin, mean that calculations of binding affinityare unrealistic at this stage.Nucleolin localization in muscle is analogous toPTPr ligand localizationTo determine...
... TAT ATG T Weak 3 aa2 ⁄ 4 55067 TCA ATG C Weak 58 aa3 33 39% 609296093360939GTA ATG CTGC ATG TTCC ATG GGAdequateWeakAdequate13 aa33 aa31 aa3¢ 76 49% –4¢ 56 61% 61041 GGA ATG T Adequate ... obviousretrieval signal is missing. The human phospholipases D1 and D2 are mainlyassociated with the plasma membrane or with the membranes of intracellular organelles although theylack a transmembrane ... [13].PositionKozak consensus A GCC ATG GGContextATG1330 AAG ATG A AdequateATG2345 CTG ATG T WeakATG3396 CCC ATG A WeakATG4489 CTG ATG A WeakHu-K4 A. Munck et al.1722 FEBS Journal 272 (2005)...
... r a Þwhere rnand ruare the experimentally determinednumerical values of the ratio a/ b, and r a is the theoreticalnumerical value of ratio a/ b for a mixture of aromaticamino acids (Tyr and ... programs did not mark any as pooror inappropriate. Another structural analysis, obtained by the VERIFY3Dprogram [61], gave an average value of 0.21,which is greater than zero, the quality value ... Z-scores and therefore a positive value indicates betterthan average and their maximum values are around 4. The values for all these parameters obtained for the PsbQ modelwere quite good and the...
... system of the modern mathematician:. . . all the different fields of mathematics are as inseparable as the different parts of a living organism; as a living organism mathe-matics has to be permanently ... es-tablishing mathematical facts.What is interesting is that a mathematical statement of fact isa free-standing entity with intrinsic merit and value. But a proof isa device ofcommunication. ... mathematics. The purpose of this book is to explore all the ideas and developmentsoutlined above. Along the way, we are able to acquaint the reader with the culture of mathematics: who mathematicians are,...
... homologs are poly (A) polymerases. Proc Natl Acad Sci USA 101, 4407–4412.18 Nakanishi T, Kubota H, Ishibashi N, Kumagai S,Watanabe H, Yamashita M, Kashiwabara S, Miyado K& Baba T (2006) ... repression is anRNA-mediated oligomer. Nucleic Acids Res 32, 1325–1334.5 Nakahata S, Kotani T, Mita K, Kawasaki T, Katsu Y,Nagahama Y & Yamashita M (2003) Involvement ofXenopus Pumilio in the ... XRbm9 is able to target XGld2 tospecific mRNA. The molecular mechanism underlyingXRbm9-dependent translational activation is unclearand awaits further investigations. The subcellular localization...
... are likely to be other meioticclade AAA ATPases and have the AAA domain helixand the C-terminal helix, but not the b domain. The distinguishing feature of members of the meioticclade of AAA ... these AAA ATPases. Thusmany AAA ATPases function as protein disassemblymachines [25]. ATPase activity of Vps4 is critical fordisassembling the MVB sorting machinery, including the endosomal sorting ... sequences as well as the Arg residues in the SRH (red) andWalker A and B motifs (black) are shown. The colour code for the remainder of the protein is: large AAA subdomain, pink; small AAAsubdomain,...
... to achieve catalysis, a common feature in hydro-lytic metalloenzymes [12]. One residue that appears totake part in catalysis in HsSTP is His62, which mayact as a general acid and protonate the ... kinase and adenylosuccinate syn-thase, but not in S. agalactiae CovR ⁄ CsrR. The motif is located at the surface of the SaPPase (Rantanen,unpublished), and superposition of the prolines allowssuperposition ... kinase is translocatedTable 3. Structure refinement statistics for SaSTP against the nativeP21212 and SAD data. SAD data collected at 0.97935 A ˚wavelength.Native SelenomethionineSpace...
... joining, a distance algorithmic method. Stability ofclades was evaluated by 1000 bootstrap rearrangements.Bootstrap values lower than 20% are not displayed in the cladogram.RNA isolation and hybridizationFungal ... immitis, which is produced by the saprophyticand the parasitic phases of Coccidioides immitis, the causative agent of the human respiratory disease SanJoaquin Valley fever, was proposed as a Coccidioides-specific ... of the EST database, and especially PatriziaAmbrosino and Luis Sanz for providing purified cellwalls of plant pathogenic fungi. The authors also wishto thank Christian Gamauf for his help in...
... disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 wasconstructed to contain SUT2 as ... 5¢-TGACGCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGATATGAAGGCATAGGCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TATTAATATTCCTATATTTTACATAGGAGGAAATTACATGCATGAAACCTACAGCTGAAGCTTCGTACGC-3¢, respectively. The plasmid pFL38-RAS2 was con-structed by ligating the ... (S1278b) the kanMX cassette from plasmidpUG6 [12] was amplified by polymerase chain reaction(PCR) using the primers disRAS2fwd 5¢-TAACCGTTTTCGAATTGAAAGGAGATATACAGAAAAAAAACAGCTGAAGCTTCGTACGC-3¢ and...
... solution. The latter has the additional attributes of being available anywhere, at anytime and on any device.If it was only a simple as a mouse-trap. The complication is that for most customers they ... this ebook, I discuss one functional transformation that has taken placed as a result of cloud services, namely; the impact on the assessment of value. This isa timely discourse as the vast ... the traditional performance measure are absurd. It is pure guesswork to forecast IT demand over a multi-year period and translate that back to IT costs. How many and what types of servers are...