the hypothalamic neuropeptides modulate physiological activity via g proteincoupled receptors gpcrs galaninlike peptide galp is a 60 amino acid neuropeptide that was originally isolated from porcine hypothalamus using a binding assay for galanin recep
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx
... distri-bution of the real substrates and PGA active site.In order to interpret the biphasic character of the Hammett plots available for AGA and GGT, it was suggested that the breakdown of the ... progress (general acid catalysis). The untypical Hammett dependence observed for the PGA-catalyzed hydrolysis of phenylacetyl anilidesindicates that a change in the reaction pathway or the rate-limiting ... Journal 276 (2009) 2589–2598 ª 2009 The Authors Journal compilation ª 2009 FEBSPGA are higher than those reported for glycosylaspar-aginase and GGT, indicating that the PGA-catalyzedhydrolysis...
- 10
- 425
- 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... 5¢-GAATTCGAGGCCATGAAGACCATCTTG-3¢ (sense) and 5¢-CTCGAGGGGCTCAGGTGGATTTTAGG-3¢ (antisense), corres-ponding to the nt sequences of the cDNA from positions28–48 and 867–885, respectively. The ... tight cluster, while the snake (E. quadrivirgata,E. climacophora and A. blomhoffii), amphibian (X. laevis,Rana catesbeiana, Bufo vulgaris japonicus and Cynopspyrrhogaster), avian (chicken) and ... (TAI-TEC, Saitama, Japan), and then its residual activity was measured by the SRED method (2). The temperature of thermal denaturation (T1/2) is defined as that at which the DNase I activity is halved...
- 8
- 500
- 0
Báo cáo Y học: Restoring enzyme activity in nonfunctional low erucic acid Brassica napus fatty acid elongase 1 by a single amino acid substitution pdf
... mutagenesis kit (Strat-agene). We have designed the oligonucleotide primersSDF-3 (5¢-TGTTGGTGGGGCCGCTATTTTGCTCTCCAACAAG-3¢) and SDF-4 (5¢-CTTGTTGGAGAGCAAAATAGCGGCCCCACCAACA-3¢) containing the desired ... coding regions.Cloning FAE1 coding regions and heterologousexpression in yeastBased on known FAE1 sequences from Arabidopsis andB. napus, the forward primer VBE4 (5¢-ACCATGACGTCCATTAACGTAAAGCTCC-3¢) ... (5¢-ACCATGACGTCCATTAACGTAAAGCTCC-3¢) and the reverseprimer VBE3 (5¢-GGACCGACCGTTTTGGGCACG-3¢)were designed, synthesized and used to amplify FAE1 codingregions from target species by PCR. Genomic DNA was isolated according to...
- 7
- 381
- 0
Báo cáo Y học: Domain V of m-calpain shows the potential to form an oblique-orientated a-helix, which may modulate the enzyme’s activity via interactions with anionic lipid potx
... a- helical long axis [27,28]. It was suggested by Daman et al.[26]thattheformationofsuch an a- helix may feature in the membrane interactions ofm-calpain domain V. Here, to investigate this suggestion, ... & Anatharamaiah, G. M. (1992) Role of basic amino acid residues in the amphipathic helix: the snorkelhypothesis. In Molecular Conformation and Biological Interactions(Balaram, P. & Ramaseshan, ... biological activity [46,48].It is clear from our theoretical analyses that the GTAMRILGGVI segment has the potential to form an a- helix with strong structural similarities to the oblique-orientated...
- 9
- 392
- 0
Tài liệu Đề tài " Radon inversion on Grassmannians via G˚ardingGindikin fractional integrals " pptx
... last integration the diagonal entries of the matrixt are given by the arguments of˜f, and the strictly upper triangular entries oft are variables of integration.To the cone Pkone can associate ... between the cases (a) ≤ k and (b) >kforRf, and (a) ≤ n − kand (b) >n− k for R∗ϕ.Namely, in the case (a) the Radon transforms and their duals are representedby G arding-Gindikin ... Springer-Verlag, NewYork (1963).[J] A. T. James, Normal multivariate analysis and the orthogonal group, Ann. Math.Statist. 25 (1954), 40–75.800 ERIC L. GRINBERG AND BORIS RUBINso that K and...
- 36
- 367
- 0
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
... plant cysteine pro-teases. The primers used were 5¢-TTGCCTGAGCA TGTTGATTGGAGAGCGA AAG-3 ¢ (forward) and 5¢-GGGATAATAAGGTAATCTAGTGATTCCAC-3¢ (reverse). PCR-amplified products were purified from ... substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronariaRaka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta ... Sundd M, Jagan-nadham MV & Dattagupta JK (1999) Crystallizationand preliminary X-ray analysis of ervatamin B and C,two thiol proteases from Ervatamia coronaria. ActaCrystallogr D 55, 1074–1075.55...
- 14
- 634
- 0
The Health Benefits of Physical Activity for Girls and Women ppt
... physical activity. Participation in physical activity Although levels of inactivity in Canada are decreasing [15], current participation research has found that the majority of Canadians can be classified ... experiencing increasing rates of various diseases such as fibromyalgia,coronary heart disease and cancers, and both girls and women experience body image dissatisfaction,low self-esteem and eating disorders ... unifying and in -the- moment experience. Traditionalaerobic exercise classes that motivate using negative feedback may be experienced as damaging ratherthan encouraging, in spite of the feelings...
- 214
- 560
- 1
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... meioticclade AAA ATPases and have the AAA domain helixand the C-terminal helix, but not the b domain. The distinguishing feature of members of the meioticclade of AAA ATPases is the SRH motif, ... adding Vps4p–E233Q and gluta-thione S-transferase (GST)–Vta1p, 6His-tagged Vps4p–E233Q was purified as above and GST–Vta1p was purifiedon glutathione agarose and eluted in assay buffer containing5mm ... material is availableonline:Fig. S1. Sequence alignment of the C-terminal regionsof Vps4, spastin, katanin and fidgetin from a range ofspecies.This material is available as part of the online articlefrom...
- 23
- 490
- 0
Báo cáo khoa học: Analysis of the NADH-dependent retinaldehyde reductase activity of amphioxus retinol dehydrogenase enzymes enhances our understanding of the evolution of the retinol dehydrogenase family pot
... Cephalochordates areuseful organisms for comparative analyses, as their lowgene complexity and archetypical body plan organiza-tion suggest that they retain many ancient characteris-tics. Amphioxus ... enzymatic activity of this fraction was assayed against retinoids. Given that most vertebrateRDHs can catalyze cis-retinol and ⁄ or trans-retinol oxi-dation, these were the substrates initially ... NAD+and NADP+, and10–100 lg of microsomes obtained from independentassays. Negligible activity was also observed when9-cis-retinol was assayed (data not shown). Next, weanalyzed whether...
- 14
- 477
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... was amplified from the plasmid pUG27 [13] using the primersdisSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGATATGAAGGCATAGGCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TATTAATATTCCTATATTTTACATAGGAGGAAATTACATGCATGAAACCTACAGCTGAAGCTTCGTACGC-3¢, ... amplified from plasmid pUG27 asdescribed above using the primers disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. ... http://mips.gsf.de/proj/yeast/info/tools/hegemann/gfp.html) using the primersSUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢,...
- 8
- 485
- 0
the impact and importance of activity based costing on financial performance of manufacturing firm
... financial performance at DLV. Thus by applying ABC, managers of manufacturing firms would be given more accurate information and able to take the right actions that would improve the profitability ... summarize and analyze; the comparison between groups, location can be measure for difference; and researching a small group can give a reliable indication of the views of a larger population. ... strategy for its survival, such as restructuring or changing technical methods for its business activity. ABC is a good method for managerial accounting, it focuses accurately on each cost for...
- 73
- 702
- 1
the implementation and adopting of activity based costing in manufacturing vietnamese companies a case study of samsung vina corporation
... if a train leaves the station with half empty seats, although that cost per passenger is calculated base on actual capacity or assumption of full capacity, this cost is relevant for managers ... information of costs for finding strategies and making decisions. ABC is a subset of activity- based management, which is used to identifying and evaluating activities of the firm‟s performance. ... Organizational structure was classified into organic and mechanistic by Stalker and Burns [25], organic organizations have lower level of formalization and centralization than that of mechanistic...
- 64
- 1,355
- 3
Does the Built Environment Influence Physical Activity? EXAMINING THE EVIDENCE pot
... physical activity. Activities that raise the rateof energy expenditure are frequently expressed as the ratio of working toresting metabolic rate.Metropolitan statistical area (MSA). A statistical ... 3,historical data that may help explain the apparent long-term declinein total physical activity levels are examined in the areas of techno-logical innovations in the workplace, at home, and in travel; ... through many mediating factors, suchas sociodemographic characteristics, personal and cultural variables,safety and security, and time allocation. Whether an individual is physically active is...
- 269
- 375
- 0
Making the Poor Pay for Public Goods via Microfinance Economic and Political Pitfalls in the Case of Water and Sanitation docx
... on the outskirts of Hyderabad, the state capital, which was recently amalgamated into the Greater Hyderabad Municipal Corporation. Groundwater in An-dra Pradesh is rapidly depleting; Hyderabad, ... solutions for provision of water and sanitation (as well as for education, healthcare, etc., as discussed above) is that small loans from private MFIs can and will, given appropriate programme design, ... define what is actually commonly managed (and how it is to be managed) against what is managed as a private good. The subordination of goods to societal institutions applies particu-larly to...
- 43
- 464
- 0
Báo cáo Y học: Amino acids 3–13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor pdf
... 5¢-CTGGGGCCCGGGTTCTGGATCACTTCGCGGACGCTCTGGCGCAGATTCTGGCGAGCTCCT-3¢pr30/33RR 5¢-CTGGGGCCCGGGTTCTGGATCCGTTCGCGGCGGCTCTGGAACAGATTCTGGAA-3¢pr24/25AA 5¢-CTGGGGCCCGGGTTCTGGATCACTTCGCGGACGCTCTGGAACAGAGCCGCGAAAGCTCC-3¢pr26/27AA ... 5¢-GATCTCCAAGACCTACCGAGGAGCTTTCCAGAATCTGTTCCAGAGCGTGCGCGAAGTGATCCAGAACG-3¢pr16–36antisense 5¢-AATTCGTTCTGGATCACTTCGCGCACGCTCTGGAACAGATTCTGGAAAGCTCCTCGGTAGGTCTTGGA-3¢pr17–32sense 5¢-GATCAAGACCTACCGAGGAGCTTTCCAGAATCTGTTCCAGAGCGTGCGCG-3¢pr17–32antisense ... 5¢-CTGGGGCCCGGGTTCTGGATCACTTCGCGGACGCTCTGGAACAGAGCCGCGAAAGCTCC-3¢pr26/27AA 5¢-CTGGGGCCCGGGTTCTGGATCACTTCGCGGACGCTCTGGGCCGCATTCTGGAAAGCTCC-3¢pr2–36sense 5¢-AATTGGGGATCCGAGAAGTGCAGTTAGGGCTGGGAAGG-3¢pr2–36antisense 5¢-GATCGAATTCGTTCTGGATCACTTCGCGCACGCTC-3¢pr1–14sense...
- 12
- 597
- 0
- the development of oracy is a significant
- the cws is a highly engineered
- the first law of thermodynamics is a restatement of the
- the fountain of youth is a legendary spring
- the balance of payments is a periodic statement of the
- the balance of payments account is a record of
- the capital account balance is a nations
- what is a toucans habitat in the rainforest
- what is a gorillas habitat in the rainforest
Tìm thêm: khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25