regulus in whom we have an example of the voluntary endurance of captivity for the sake of religion which yet did not profit him though he was a worshipper of the gods
báo cáo hóa học:" Assessing normative cut points through differential item functioning analysis: An example from the adaptation of the Middlesex Elderly Assessment of Mental State (MEAMS) for use as a cognitive screening test in Turkey" docx
... interests Authors' contributions AK, SK and AT were involved with the conception and design of the study AK and SK arranged the data collection, took part in the interpretation of the data, and the Page ... points for passing a subtest, as is the case for the MEAMS, a formal test of the validity of the cut point is the absence of DIF For example, if a cut point is set for passing a subtest and DIF ... pooled the data from the normal and patient groups where, in the latter case, the first level of education also included a number of illiterate patients The basis of the DIF approach lies in the...
- 8
- 448
- 0
Báo cáo hóa học: " REP-LECOTOX: an example of FP 6 INCO project to strengthen ecotoxicological research in WBC (Western Balkan countries)" ppt
... goals, the upgraded and strengthened LECOTOX will have an important task in the future, as well as the capability and capacity to offer its expertise and advice to policy and decision makers as well ... Each fraction contains different types of contaminants depending on their polarity, planarity and the of aromatic system, and the most active ones have been prioritised for further analysis aimed ... (presentations available at project’s homepage) To enable further exchange of experiences and information about the research potential and capacities of local (Serbian) and regional research institutions and...
- 9
- 374
- 0
Structuring an advertising business in Vietnam (an example of FPT media - the corporation for financing and promoting technology)
... Figure 2.1 Flat and tall organization As an organization grows, the increase in the size of the managerial component is less than proportional to the increase in the size of the organization 1.2.2 ... that fit a company’s need is a large challenge Each structure has advantages and disadvantages, and managers have to be ready and willing to redesign the organization in order to obtain the advantages ... reason is the ability of manager The two main factors that affect the span of control are task complexity and task interrelatedness 1.2.5 The shape of hierarchy and the way it works are also affected...
- 104
- 1,457
- 2
Tài liệu An Example of Using the Get* Methods phần 1 pdf
... method For example, the productID variable is used to store the ProductID column value, and since ProductID is of the SQL Server int type, the appropriate C# type for the productID variable is int ... type You can see this type correspondence in Table 9.3, shown earlier You can get the database type for a column using the GetDataTypeName() method of your DataReader object For example: Console.WriteLine("ProductID ... productsSqlDataReader.GetOrdinal("UnitsInStock"); int discontinuedColPos = productsSqlDataReader.GetOrdinal("Discontinued"); // use the GetFieldType() method of the DataReader object // to obtain the...
- 6
- 594
- 0
Tài liệu An Example of Using the Get* Methods phần 2 docx
... SqlBoolean Let's assume that you already have a SqlDataReader object named productsSqlDataReader and it may be used to read the columns from the Products table The following while loop uses the GetSql* ... some of the methods shown in Table 9.7 An Example of Using the GetSql* Methods Let's take a look at an example that reads the ProductID, ProductName, UnitPrice, UnitsInStock, and Discontinued ... SqlString GetSqlString() binary SqlBinary GetSqlBinary() varbinary SqlBinary GetSqlBinary() image SqlBinary GetSqlBinary() sql_varient object GetSqlValue() timestamp SqlBinary GetSqlBinary()...
- 6
- 471
- 0
Tài liệu An Example of Communal Currency pdf
... year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not exceed in any case the amount of their annual income without the ... a mutual exchange of their respective notes, each party paying interest for the balance of notes remaining against it; in this way all the notes of the States would have found themselves in the ... Members, the Committee which they have appointed specially for this purpose, when we think of the publicity, of the exact acquaintance from year to year which all the inhabitants have of the liabilities,...
- 37
- 485
- 0
Managing diffuse water pollution in South East Queensland: An analysis of the role of the Healthy Waterways Partnership docx
... Resource Management Plan, the SEQ Regional Plan, and in the Healthy Waterways Action Plan There is consistency and a top down adaptation from the standards produced by the Australian and New Zealand ... 2007) The Moreton Bay Marine Park Zoning Plan designates various areas of the bay as national park – including the Moreton Bay Marine Park, the St Helena Island National Park and the Southern ... plans that have come out of the Strategy The main Action Plans addressing the issue of non-point pollutant loading are the following: Managing diffuse water pollution in SEQ: an analysis of the...
- 58
- 789
- 0
Báo cáo khoa học: Metabolomics, modelling and machine learning in systems biology – towards an understanding of the languages of cells potx
... structure) and a high-frequency signal the other way In this manner the same components can change their concentrations such that they may be at the same instantaneous levels while nevertheless having ... is increasingly commonplace to have access to large datasets of variables (Âomics data) against which to test a mathematical model of the system that might generate such data In these cases, the ... biology) that denes the participants in the process of interest and the (qualitative) nature of the interactions between them; then we try to develop equations, preferably mechanistic rather than empirical,...
- 22
- 706
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... might also be important for binding to the toxin The change of Val to Phe may result in a better interaction in terms of an increased contact area Changes at CDRs and in clone 61 0A had a synergistic ... is the first report of the generation of a human recombinant antibody fragment capable of neutralizing the toxic effects of the whole venom from a deadly animal L Riano-Umbarila et al ˜ formed in ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC...
- 11
- 679
- 0
Báo cáo khoa học: Inhibitory activity of double-sequence analogues of trypsin inhibitor SFTI-1 from sunflower seeds: an example of peptide splicing docx
... enzyme each and then their inhibitory activities were checked against another enzyme, they displayed inhibitory activity that was at least one order of magnitude higher On the basis of these results, ... proteinases and remained intact in the presence of the other enzyme Consequently, the hypothesis that the inhibitory activity of the permutants in the presence of both enzymes could have been caused ... inhibitor was designed by combining two binding loops of BBI As postulated by Jaulent and Leatherbarrow [11], the size of the inhibitor was incompatible with the simultaneous binding of trypsin and...
- 9
- 307
- 0
Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt
... to the North Atlantic, forcing the ocean into a state with weak Atlantic overturning and NADW south of Iceland, similar to a stadial period The assumption under which the ocean needs to shift into ... (implying an oceanic subsurface warming) after one thousand years at 17 ka BP The star and circle indicate the location of the Hudson Strait ice stream mouth and source, respectively the annual mean ... from the ocean to the ice due to subsurface warming induces an increase of the basal melt below the Labrador ice shelf (Fig 1) The reduced shelf thickness increases the calving rate substantially...
- 10
- 566
- 0
báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx
... the EFA The Brazilian dataset showed coefficients of 863 for the Subscale I (and 845 for the International dataset), 804 for the Subscale II (.822 for the International sample) and 671 for the ... Brazilian scale fit and performance These potential alterations should not promote crucial modifications in the scale format, since they can be made during the statistical analysis phase and not ... Items in bold were retained in the international final version the International dataset too Out of these, only item 18 remained in the final international AAQ version The Multi-trait Analysis...
- 10
- 871
- 0
Báo cáo hóa học: " Leg joint power output during progressive resistance FES-LCE cycling in SCI subjects: developing an index of fatigue" doc
... the ergometer testing, collected force and kinematic data, performed the statistical analysis and drafted the manuscript PDF participated in the design and coordination of the study, data analysis, ... tip of the malleolus, and on the lateral side of the ergometer boot at the approximate location of the fifth metatarsal Additional markers were placed at the center of the pedal spindle, on the ... and cycling motion coincide The range between the two tails indicates the standard error of the mean Standard error was set at 95% Page of 12 (page number not for citation purposes) Journal of...
- 12
- 373
- 0
báo cáo hóa học:" Cross-diagnostic validity in a generic instrument: an example from the Functional Independence Measure in Scandinavia" docx
... 4:55 An analysis of the clinical meaning of the DIF problem was then conducted by testing whether the meaning of the summed score reflected the same amount of independence between the SCI, TBI and ... to the Norwegian centres and Denmark The centres did however not have to state which version of the manual was used, however the manuals are quite similar Rasch analysis The Rasch model [12] was ... multidimensionality in the data, and thus the formal test of local independence assumption (for a unidimensional scale) was not performed Summed score comparison For the analysis of the clinical meaning of...
- 8
- 301
- 1
báo cáo hóa học:" Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" docx
... the EFA The Brazilian dataset showed coefficients of 863 for the Subscale I (and 845 for the International dataset), 804 for the Subscale II (.822 for the International sample) and 671 for the ... Brazilian scale fit and performance These potential alterations should not promote crucial modifications in the scale format, since they can be made during the statistical analysis phase and not ... Items in bold were retained in the international final version the International dataset too Out of these, only item 18 remained in the final international AAQ version The Multi-trait Analysis...
- 10
- 737
- 0
báo cáo hóa học:" Reliability of 95% confidence interval revealed by expected quality-of-life scores: an example of nasopharyngeal carcinoma patients after radiotherapy using EORTC QLQ-C 30" pdf
... using a Rasch analysis rather than sample and item dependent classical test models For the reason of space limitation for this manuscript, we have not explored the dimensionality and invariance ... 1Department of Pharmacy, Chi-Mei Medical Center, Tainan, Taiwan, 2Department of Hospital and Health Care Administration, Chia-Nan University of Pharmacy and Science, Tainan, Taiwan, 3School of ... items, s x is the variance of the observed total test scores for the sample of examinees and s Yi is the variance of item i for the sample of examinees Formula shows the equation for skewness:...
- 8
- 318
- 0
Project Gutenberg''''s An Example of Communal Currency, by J. Theodore Harris doc
... Enquiries were then made from inhabitants of the island itself The information gathered was vague and not much to the point With a few notable exceptions, the average Guernseyman seems to know or care ... Brock, can tell how, at the opening of the Market he "sprinkled the packages (of redeemed notes) with perfume, and while the band was playing a dirge he laid them on the fire, where they were quickly ... than £10,000, which the adjoining parishes subject to this charge were not in a condition to raise The state of the finance was not more consolatory with a debt of £19,137, and an annual charge...
- 213
- 522
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008