0

poland russia a transboundary management problem and an example of modeling for decision making

NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

Điện - Điện tử

... the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those threats that have transboundary effects ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges ... coast of Peninsular Malaysia such as Sg Muda, Sg Pinang, Sg Perak, and Sg Klang are short and steep Open water bodies, natural wetlands, and manmade lakes such as dams, and ex-mining pools are...
  • 88
  • 581
  • 0
BÀI THẢO LUẬN TIẾNG ANH in managing people, the occurrence of conflict is inevitable. In opinion, What is conflict at work? How do managers deal with conflict and why do they need to resolve these problem ? Give an example of an event where conflict were

BÀI THẢO LUẬN TIẾNG ANH in managing people, the occurrence of conflict is inevitable. In opinion, What is conflict at work? How do managers deal with conflict and why do they need to resolve these problem ? Give an example of an event where conflict were

Tài liệu khác

... Bui Tuan Anh II.4 : Nguyen Ngoc Anh II.5 and III : Pham Van Anh II.6 and Secretary : Nguyen Ngoc Anh Head of team No Secretary Name Nguyen Thi Kim Anh Bui Tuan Anh Nguyen Ngoc Anh Pham Van Anh ... interest of the organization is an important skill for all managers as well as for individuals in general A survey of US researchers found that an average manager spent 21% of the week in dealing ... project at hand and more on gossiping about conflict or venting about frustrations As a result, organizations can lose money, donors and access to essential resources • Members Leave Organization...
  • 11
  • 1,452
  • 1
báo cáo khoa học:

báo cáo khoa học: " The economics of health and climate change: key evidence for decision making" pdf

Báo cáo khoa học

... cost estimates of health sector adaptation plans in the National Adaptation Programme of Action [20] One study from Bangladesh estimates an average annual adaptation cost in the health sector, ... health damage and adaptation costs, which are an important proportion of overall damage costs for climate change If this is true, it follows that health should be an important component of adaptation ... Disaster Management Programme, Ministry of Food and Disaster Management Dhaka, Bangladesh 30 UNFCCC: National Economic, Environment and Development Study for Climate Change Project Initial Summary...
  • 7
  • 473
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: " Effects of intensive versus no management strategies during an outbreak of the bark beetle Ips typographus (L.) (Col.: Curculionidae, Scolytinae) in the Tatra Mts. in Poland and Slovakia" ppsx

Báo cáo khoa học

... Łysa Polana and Morskie Oko in TPN (Poland) and Javorina in TANAP (Slovakia) The total study area covered 5258 including 3441 in Slovakia and 1817 in Poland The region was mostly covered by autochthonous ... Poland) .The Figure Distribution of the stands (%) in the mountain slopes in the study area in TANAP (Slovakia) and TPN (Poland) stands in the study area were characterised by high altitudinal variability: ... main cause of this collapse was probably the effect of cold and rainy weather on trees and bark beetles, as well as the increase Variable management and bark beetle outbreak in the activity of...
  • 7
  • 368
  • 0
Tài liệu A structured approach to Enterprise Risk Management (ERM) and the requirements of ISO 31000 ppt

Tài liệu A structured approach to Enterprise Risk Management (ERM) and the requirements of ISO 31000 ppt

Cao đẳng - Đại học

... culture of the organisation and this will include mandate, leadership and commitment from the Board It must translate risk strategy into tactical and operational objectives, and assign risk management ... by way of two mechanisms These are monitoring and review of performance and communication and consultation Monitoring and review ensures that the organisation monitors risk performance and learns ... analysis Analysis of processes and operations within the organisation to identify critical components that are key to success G HAZOP and FMEA approaches Hazard and Operability studies and Failure...
  • 20
  • 818
  • 1
The Classification of Pulmonary Tuberculosis and An Outline of Standardised Principles of Management pot

The Classification of Pulmonary Tuberculosis and An Outline of Standardised Principles of Management pot

Sức khỏe giới tính

... that a correct classification is the key to correct and standardised principles of management; and that only with standardised principles of management can results in various series and in various ... 815 and 1130 ” (1955) Tuberculosis William Heinemann Classification, Pathogenesis and Management ” (1956) A New Classification of Pulmonary Tuberculosis Standerds William Heinemann Management and ... distinguished, and this can only be accomplished when the cases concerned are classified to primary and secondary types and the four main forms of the disease In the management and rehabilitation of a case,...
  • 14
  • 497
  • 0
The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt

The Report of the Task Force on Financial Mechanisms for ICT for Development - A review of trends and an analysis of gaps and promising practices ppt

Tài chính doanh nghiệp

... Regional organizations and institutions can help facilitate cooperation and coordination and international financial institutions and donors can then play a vital role in seeding and facilitating ... MTN has engaged in a strategy that places the company as major player in the regional mobile market place With recent expansion into Nigeria, Rwanda, Swaziland, Cameroon and Uganda, the MTN brand ... finance institutions (FMO of the Netherlands, Development Bank of Southern Africa and DEG of Germany) and US$120-million of senior debt from commercial banks (Barclays Bank plc and the Standard...
  • 125
  • 1,274
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
  • 11
  • 679
  • 0
báo cáo hóa học:

báo cáo hóa học: "Usability of a virtual reality environment simulating an automated teller machine for assessing and training persons with acquired brain injury" pdf

Điện - Điện tử

... collected and analyzed data for Part II KNKF, CKKY and WAKY drafted the manuscript All authors read and approved the final manuscript Acknowledgements Presented in part at the Hospital Authority ... the VR-ATM CKKY formulated concepts and ideas in Part I of the study WAKY and YEWH collected and analyzed data for Part I KNKF formulated concepts in Part II of the study CBCH, LKCK, LJCK, and LTHY ... same tasks - cash withdrawals and money transfers - with the VR-ATM or the real ATM in a rehabilitation hospital For the real ATM practice, the therapist issued the participant an ATM card, a...
  • 9
  • 454
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Strong convergence theorem for a generalized equilibrium problem and system of variational inequalities problem and infinite family of strict pseudo-contractions" potx

Hóa học - Dầu khí

... closed and convex and T is a nonexpansive mapping of C into itself, then F(T) is nonempty; for instance, see [5] Recently, Tada and Takahashi [6] and Takahashi and Takahashi [7] considered iterative ... α1 , α2 , α3 ∈ (κ, 1 )and α1 , α2 , α3 ∈ (κ, 1 )for all j = 1, For every n Î N, let Sn and S be S-mappings generated by Tn, , T1 and an, an- 1, , a1 and Tn, Tn-1, , and an, an 1, , respectively ... monotone mappings J Nonlinear Convex Anal 7, 105–113 (2006) Takahashi, W: Nonlinear Functional Analysis Yokohama Publishers, Yoko-hama (2000) Tada, A, Takahashi, W: Strong convergence theorem for an...
  • 16
  • 367
  • 0
Báo cáo y học:

Báo cáo y học: " The ANU WellBeing study: a protocol for a quasi-factorial randomised controlled trial of the effectiveness of an Internet support group and an automated Internet intervention for depressio" doc

Báo cáo khoa học

... to measure participant randomisation preference at baseline Page 11 of 13 Planned data analysis and sample size The WellBeing trial aimed to recruit and randomise 500 participants to four conditions ... A detailed list of the WellBeing board rules appeared when the participant first registered on the board and was available at all times on the Board home page and in the participant's manual Discussion ... between August 2008 and May 2009 A subsample of 7000 surveys (randomly selected from the two metropolitan divisions of Canberra and Maribyrnong and the two rural divisions of Murray and Indi) were...
  • 13
  • 429
  • 0
báo cáo khoa học:

báo cáo khoa học: " Toward a treaty on safety and cost-effectiveness of pharmaceuticals and medical devices: enhancing an endangered global public good" pot

Báo cáo khoa học

... individuals and the com- http://www.globalizationandhealth.com/content/2/1/5 munity can afford; medicines meeting appropriate standards of quality, safety and efficacy; quality use of medicines; and ... published trial data and prefer to rely on surrogate outcomes, such as readily measured changes in biochemical markers of disease Another disadvantage is that CEAP and CEAMD analysis is often (unless ... countries and impact on pharmaceutical research and development[76] Toward a multilateral treaty It seems remarkable, in an age of corporate globalisation, that medicines and medical devices national...
  • 9
  • 448
  • 0
Báo cáo y học:

Báo cáo y học: "Cost-effectiveness of a hypertension management programme in an elderly population: a Markov model" ppt

Báo cáo khoa học

... GW and CA participated in the collection and assembly of data; GP, ER, GW, CA, CG, CP and ES contributed to analysis and interpretation of data; all authors participated in drafting of the article ... discount rate according to suggestions from the World Bank for Latin America and Argentina [35] Sources of events and outcomes data Annual rates of cardiovascular events for intermediate and high ... hand, according to their basal cardiovascular risk They could have an acute cardiovascular event or not or die from causes other than cardiovascular ones Survival probabilities for an acute cardiovascular...
  • 11
  • 285
  • 0
REGULATIONS AGAINST ABUSIVE PRICING  a COMPARISON OF EU, US AND  VIETNAMESE LAW AND AN APPLICATION OF ITS  RESULTS TO VIETNAM

REGULATIONS AGAINST ABUSIVE PRICING a COMPARISON OF EU, US AND VIETNAMESE LAW AND AN APPLICATION OF ITS RESULTS TO VIETNAM

Khoa học xã hội

... Treaty Articles 85 and 86 became Articles 81 and 82 of the EC Treaty and used to be called as Article 81EC, Article 82EC The Treaty was further amended by the Treaty of Amsterdam and the Treaty ... issues such as the basic rules of laws, concepts and forms of abusive pricing For every issue, I correlate and analyse information regarding the relevant EU and US laws Part II, located in Chapter ... identification of dominance While US and EU law pay attention to two elements: “significant market power” and the “durable” feature of the power for an appearance of dominance, the VLC looks only at...
  • 31
  • 401
  • 0
regulations against abusive pricing - a comparison of eu, us and vietnamese law and an application of its results to vietnam

regulations against abusive pricing - a comparison of eu, us and vietnamese law and an application of its results to vietnam

Tiến sĩ

... Tran, Hoang Nga List of Abbreviations ASEAN Associations of South East Asian Nations AAC Average avoidable cost ATC Average total cost AVC Average variable cost CCHC Competition Case Handling ... many countries in Africa and Asia Countries may adopt anti-unfair competition law and monopoly control 32 law in separate acts, for example Germany31, China , or adopt one act covering all areas ... violates the antitrust laws and permits States to sue companies for antitrust violations parens patriae 15 In those Acts, Section of the Sherman Act14, Sections and of the Clayton Act15 and...
  • 242
  • 315
  • 0
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

Sư phạm

... 4, Al-Issa, A (2006b) Language problems facing Omani learners of English ORTESOL, 24, pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing ... scientifically and objectively than other forms of research Questionnaire is easy to analyze Data entry and tabulation for nearly all surveys can be easily done with many computer software packages Questionnaire ... probably unaware of their hands when they talk to their classmates, their arms and hands may seem larger than life when they are standing in front of a roomful of people Some of them put their hands...
  • 50
  • 454
  • 2
Guidelines on estabilishing a risk management framework and policy

Guidelines on estabilishing a risk management framework and policy

Quản trị kinh doanh

... of an organization, at the BOD A clear path for managing risk starts at the BOD and senior management The BOD and senior management s roles should include: • Being a major advocate of risk management ... risk management policies or develop a formal risk management framework and policy Energy firms should have a formal commitment to and cultural understanding of risk management across the organization ... to ensure accurate and consistent measuring and monitoring of value and risk • Creating a living document that is revised as methods and approaches in risk management improve and/ or management...
  • 40
  • 302
  • 0
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh

Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh

Môi trường

... at the stage of planning and implementation of water and sanitation options Educational intervention on water and sanitation: 1995-1997 The educational intervention on water and sanitation was ... Environment and Research Population Center (EPRC) We thank people living in Bauniabad, staffs of Dhaka Water and Sewerage Authority, staffs of EPRC and all the stakeholders for their kind cooperation and ... status of the respondent, sources and practices about drinking water, types of latrines, cost and financial aspects, local community participation, hygiene practices, and other water and sanitation...
  • 9
  • 971
  • 0
A study on syntactic and pragmatic features of insertion sequence in english and vietnamese

A study on syntactic and pragmatic features of insertion sequence in english and vietnamese

Khoa học xã hội

... percentage of insertion sequences as well as comparing their frequency in English and Vietnamese Thanks to both qualitative and quantiative approaches, the researcher can describe and analyze, ... English and 130 in Vietnamese selected for the analysis are in the form of written texts in the sources provided They are analysed in terms of syntax and pragmatics and then compared and contrasted ... of College of Foreign Languages, University of Danang - Information Resource Center, University of Danang CHAPTER 1: INTRODUCTION 1.1 Statement of the Problem Language is a vital tool in human...
  • 26
  • 1,297
  • 4

Xem thêm