... be statistically significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA score and circulating Ang-2 (Table ... optimal cut-off values Data are displayed as median and range (minimum to maximum) unless otherwise stated All statistical analyses were performed with the SPSS Page of (page number not for citation ... Critical Care Vol 12 No Kümpers et al package (SPSS Inc., Chicago, IL, USA) and the GraphPad Prism software (GraphPad Prism Software Inc San Diego, California, USA) Figure Results Decreased Ang-1 and...
... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation ofa behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476 ... the diagnosisof sepsis on admission to the ICU Eosinopenia may become a helpful clinical tool in ICU practices interpretation of data, and gave the final approval of the manuscript All authors ... presented as the mean ± standard deviation for variables witha normal distribution, and as the median and interquartile range for variables with skewed distributions Parametric or nonparametric...
... reelected with as wide ofa margin as any candidate in the state’s history (A) she was reelected with as wide ofa margin as any candidate in the state’s history (B) she had been reelected with as wide ... wide ofa margin as any candidate in the state’s history (C) having been reelected with as wide a margin as any candidate in the state’s history (D) she was reelected with as wide a margin as any ... Graduate Management Admission Test, which isa standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international...
... within a scene have the same color temperature A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation Most cameras can adjust automatically ... or black level, of zero IRE, rather than the 7.5 IRE broadcast standard Some cameras that automatically boost the signal in low light situations can also be run in manual mode where you can control ... practice, actual contrast ranges are rarely measured using a meter A subjective analysis based on camera output is generally sufficient Color Temperature The third consideration is color temperature...
... English is difficult and it’s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can be a piece of ... ˈeɪʃ ən doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ə ˈfreɪd ʌv ˈmeɪk ɪŋ mɪ ˈsteɪk dʒʌst traɪ tuː spiːk Speak English as much as possible spiːk ˈɪŋ ... In fact, she isa sales person! “Improve” = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ...
... AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement This project was supported by grants from the Austrian Science ... gene as an internal standard PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 ... were cleared in ethanol and visualized witha stereomicroscope (Leica MZ16FA) RNA isolation and real-time quantitative RT-PCR analysis RNA was isolated from seedlings according to manufacturer’s...
... structure of Met8P has shown that this protein has an aspartate residue (Asp141), which is important for both chelatase and dehydrogenase function [17]; interestingly, this aspartate, Asp129, is also ... biosynthetic pathway, for example, oxidation of C17 propionate to give an acrylate side chain This type of step would normally require FAD-based chemistry Another potential dehydrogenation is NAD ⁄ NADP-dependent ... lacking iron and ⁄ or with the side chain saturated, but accessing these putative substrates is not trivial An alternative approach would be to seek accumulation of the substrate of NirF in a...
... program An alternative to either of these is the International Baccalaureate (IB) and a small number of schools, mainly private, offer the IB diploma Table reports some standard VCE statistics across ... (bas) It isa group of schools in Ballarat, that provides the basis for interschool sporting competition Ballarat and Clarendon College; Ballarat and Queens Anglican Grammar School; Ballarat ... English Attendance ICSEA Number of Teachers Number of Support Staff Read7 Write7 Spell7 Grammar7 Math7 School Associations: ASPV AGSV GV ACC ACOED BAS CAS Sandhurst EID GIS SIS Region: Cental East...
... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... When removing NaCl by prolonged dialysis, this protease is activated and cleaves PsbQ at low salt concentrations We circumvented the drawbacks of the 1-M NaCl wash by taking advantage of the Cu2+ ... structural analysis, obtained by the VERIFY3D program [61], gave an average value of 0.21, which is greater than zero, the quality value indicated by the program In addition, the distribution of distances...
... where sy isa string in a, or f = v and e E a The functional uncertainty approach may be characterized as a localization of the long distance dependencies; a localization at the level of fstructures ... This is the same analysis as given by LFG In a TAG, the dependent items are part of the same elementary tree Features of these nodes can be related locally within this elementary tree (as in a ... defined a restricted version of FTAG, called RFTAG, that can generate only TALs (the languages generated by TAGs) In RFTAG, we insist that the feature structures that are associated with nodes are...
... Nucleic Acids Res 32, 1325– 1334 Nakahata S, Kotani T, Mita K, Kawasaki T, Katsu Y, Nagahama Y & Yamashita M (2003) Involvement of Xenopus Pumilio in the translational regulation that is specific ... protein alone (Fig 3A) This activation was comparable with that obtained with MS2-PABP This activation was cis-dependent, as MS2-XRbm9 and MS2-PABP fusion proteins did not affect the expression of ... compilation ª 2008 FEBS C Papin et al Zealand), followed by affinity purification The antibody against Xenopus CPEB is an affinity-purified rabbit polyclonal antiserum [20] The RPA and AuroraA antibodies...
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the SRH motif, ... CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains used in this study Strain Genotype Source EGY48 AMY245 MATa his3 trp1 ura3 LexAop(·6)-LEU2 MATa vps4-D::KanMx leu2 ura3 his4 lys2 bar1 MATa...
... have been reported to act as phytotoxins [e.g cerato-platanin of Ceratocystis fimbriata f sp platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and ... and pathogenesis-related proteins (As-CG of Coccidioides immitis, Aca1 of Antrodia camphorata and Aspf13 of Aspergillus fumigatus) It should be noted that a low similarity of H atroviridis Epl1, ... culture filtrates of Ceratocystis fimbriata f sp platani, in the cell walls of ascospores, hyphae and conidia of this fungus The authors suggested that cerato-platanin may have a similar role to...
... CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351-SUT2 was constructed to contain SUT2 as the only open reading frame ... CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively YEp351-SUT2 was linearized with SphI and co-transformed with ... The cassette was amplified from the plasmid pUG27 [13] using the primers disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA...
... and a sense cDNA probe (complementary to the antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT ... (2000) Ultrastructural colocalization of nidogen-1 and nidogen-2 with laminin-1 in murine kidney basement membranes Histochem Cell Biol 113, 115–124 Nagahama H, Hatakeyama S, Nakayama K, Nagata M, ... Natl Acad Sci USA 95, 14220–14225 Ohto H, Kamada S, Tago K, Tominaga S, Ozaki H, Sato S & Kawakami K (1999) Cooperation of Six and Eya in activation of their target genes through nuclear translocation...