Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

16 401 0
  • Loading ...
    Loading ...
    Loading ...

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 07/03/2014, 03:20

Cardiac ankyrin repeat protein is a marker of skeletalmuscle pathological remodellingLydie Laure1, Laurence Suel1, Carinne Roudaut1, Nathalie Bourg1, Ahmed Ouali2, Marc Bartoli1,Isabelle Richard1and Nathalie Danie`le11Ge´ne´thon-CNRS FRE3087, Evry, France2 INRA de Theix, Saint Gene`s Champanelle, FranceMuscle atrophy can result from disuse of the organ orbe associated with ageing or severe systemic conditionssuch as diabetes, AIDS and cancer. It is also a featurecommon to many hereditary muscle diseases, includingmuscular dystrophies (MDs). Duchenne MD (DMD),caused by mutation in the dystrophin gene, is the mostcommon form of the disease and is particularly severe:skeletal and cardiac muscles are affected, and the life-span of the patients is seriously impaired [1]. Limbgirdle MDs (LGMDs) represent another importantsubgroup of MD, grouped together on the basis ofcommon clinical features: they all primarily andKeywordsCARP; FoxO1; muscle; p21WAF1/CIP1;remodellingCorrespondenceI. Richard, Ge´ne´thon, CNRS FRE3087, 1 bisrue de l’Internationale, 91000 Evry, FranceFax: +33 0 1 60 77 86 98Tel: +33 0 1 69 47 29 38E-mail: richard@genethon.fr(Received 31 July 2008, revised 20 October2008, accepted 24 November 2008)doi:10.1111/j.1742-4658.2008.06814.xIn an attempt to identify potential therapeutic targets for the correction ofmuscle wasting, the gene expression of several pivotal proteins involved inprotein metabolism was investigated in experimental atrophy induced bytransient or definitive denervation, as well as in four animal models ofmuscular dystrophies (deficient for calpain 3, dysferlin, a-sarcoglycan anddystrophin, respectively). The results showed that: (a) the components ofthe ubiquitin–proteasome pathway are upregulated during the very earlyphases of atrophy but do not greatly increase in the muscular dystrophymodels; (b) forkhead box protein O1 mRNA expression is augmented inthe muscles of a limb girdle muscular dystrophy 2A murine model; and (c)the expression of cardiac ankyrin repeat protein (CARP), a regulator oftranscription factors, appears to be persistently upregulated in every condi-tion, suggesting that CARP could be a hub protein participating in com-mon pathological molecular pathway(s). Interestingly, the mRNA level ofa cell cycle inhibitor known to be upregulated by CARP in other tissues,p21WAF1/CIP1, is consistently increased whenever CARP is upregulated.CARP overexpression in muscle fibres fails to affect their calibre, indicatingthat CARP per se cannot initiate atrophy. However, a switch towards fast-twitch fibres is observed, suggesting that CARP plays a role in skeletalmuscle plasticity. The observation that p21WAF1/CIP1is upregulated, put inperspective with the effects of CARP on the fibre type, fits well with theidea that the mechanisms at stake might be required to oppose muscleremodelling in skeletal muscle.AbbreviationsAAV2/1, adeno-associated virus 2/1; Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DAPI,4¢,6-diamidino-2-phenylindole; DMD, Duchenne muscular dystrophy; EDL, extensorum digitorum longus; FoxO, forkhead box protein O;FP, fluorescent protein; LGMD, limb girdle muscular dystrophy; MAFbx, muscle atrophy F-box protein; MD, muscular dystrophy; MLC-2v,myosin light chain 2v; MLC-f, myosin light chain, fast; MuRF1, muscle RING finger protein 1; NF, neurofilament protein; NF-jB, nuclearfactor-jB; qRT-PCR, quantitative RT-PCR; TA, tibialis anterior; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labelling; Ub,ubiquitin; UPS, ubiquitin–proteasome system; YFP, yellow fluorescent protein.FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 669predominantly affect proximal muscles around thescapular and the pelvic girdles [2]. About 20 differentforms of LGMD are currently recognized; among themost frequent are LGMD2A, LGMD2B and thesarcoglycanopathies (LGMD2C–F), caused by muta-tion in the calpain 3, dysferlin and sarcoglycan genes,respectively [2].Disuse-induced atrophy and MDs might share somemolecular mechanisms that are possibly involved inskeletal muscle wasting. Muscle atrophy results fromthe negative balance in the ratio between protein syn-thesis and protein degradation, hence leading towardsprotein wasting. One of the key players in the degrada-tion of myofibrillar proteins is the ubiquitin–protea-some system (UPS) [3]. The elimination process isinitiated by labelling of the targeted proteins with mul-tiple ubiquitin molecules, and requires the coordinatedaction of three classes of enzymes known as E1 (ubiqu-itin-activating enzymes), E2 (ubiquitin-conjugatingenzymes) and E3 (ubiquitin ligases) [4]. The ubiquitin–proteasome cascade is stimulated at many levels inseveral conditions leading to muscle wasting: theexpression of proteasome subunits, the hydrolyticactivity, and the general substrates ubiquitination [5].In particular, the 14 kDa ubiquitin carrier protein E2(E2-14 kDa) and two recently identified E3s, muscleatrophy F-box protein (MAFbx; also commonly calledatrogin-1) and muscle RING finger protein 1 (MuRF1;also named TRIM63), are upregulated in many skele-tal muscle-wasting conditions [5]. During atrophy,expression of MAFbx and MurF1 is stimulated by theforkhead box protein O (FoxO) family of transcriptionfactors, through inhibition of the Akt pathway [6,7].In addition, it was also shown that transcriptionalstimulation of MuRF1 is under the control of thenuclear factor-jB (NF-jB) pathway [8].Even though the literature largely explores the con-vergent role of the UPS components in atrophy, mus-cle wasting is a complex mechanism in which specific,although poorly understood, pathways could play arole. In particular, cardiac ankyrin repeat protein(CARP) was suggested to be involved in these pro-cesses. CARP, together with ankyrin repeat domain-containing protein 2 (Ankrd2) and diabetes-relatedankyrin repeat protein, forms a family of transcriptionregulators known as muscle ankyrin repeat proteins.These three isoforms share in their C-terminal region aminimal structure composed of several ankryrin-likedomains possibly involved in protein–protein inter-action, PEST motifs characteristics of rapidly degradedprotein, and a putative nuclear localization signal.CARP is expressed in both cardiac and skeletal mus-cles, and was reported to be either upregulated [9] ordownregulated [10,11], depending on the atrophic situ-ation considered, and upregulated in hypertrophic con-ditions in heart [12–17] and in skeletal muscle [18–21].From the functional point of view, in heart cells,CARP overexpression suppresses troponin C and atrialnatriuretic factor expression [22], and its interactionwith the transcription factor YB1 inhibits the synthesisof the ventricular-specific myosin light chain 2v (MLC-2v) [23]. In vascular smooth muscle cells, increasedCARP expression has been demonstrated to be associ-ated with upregulation of the protein p21WAF1/CIP1,aninhibitor of the cell cycle [24]. Taken as a whole, thesefindings suggest that CARP coordinates the expressionof genes involved in cell structure and proliferation,and could play a role during muscle mass variation.In an attempt to identify hub proteins that may bepotential diagnostic markers or even therapeutic tar-gets for the correction of muscle wasting, the expres-sion of pivotal proteins involved in all the mechanismsdiscussed previously was investigated in denervation-induced atrophy, as well as in three animal models ofLGMD and in the mdx mouse, a DMD model. Ourstudy demonstrates that: (a) the UPS is transientlyupregulated after denervation, consistent with itsknown role in atrophy, but it does not seem to begreatly activated in MD; (b) FoxO1 is a biologicalmarker specific for the LGMD2A murine model;and (c) among all the genes considered, the expressionof CARP, together with its downstream target,p21WAF1/CIP1, appears to be the only one that system-atically increases. CARP overexpression in musclefibres fails to induce an atrophic phenotype, indicatingthat CARP per se cannot initiate the phenomenon.Nonetheless, the switch towards fast-twitch fibresobserved in this situation, together with the observa-tion that the p21WAF1/CIP1expression pattern seems toreflect CARP level, suggests that CARP might play arole in muscle plasticity.ResultsThe proteasome pathway components areonly transiently upregulated, whereas increasedCARP expression is maintained throughoutdenervation-induced-atrophyThe expression of several factors possibly involved inatrophy was investigated by the evaluation of theirmRNA level by quantitative RT-PCR (qRT-PCR) inconditions leading to transitory or definitive atrophy.The genes studied were those encoding: (a) two tran-scription factors involved in the control of musclemass: NF-jB-p65 and FoxO1; (b) several componentsCardiac ankyrin repeat protein in muscle plasticity L. Laure et al.670 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBSof the UPS – ubiquitin (Ub), E2-14 kDa, two E3ubiquitin ligases, MuRF1 and MAFbx, and the C2,C8 and C9 subunits of the proteasome; and (c) CARP,a transcriptional regulator associated with perturbationof muscle mass. Transient or chronic denervation ofthe posterior limb was induced and the mRNA levelswere measured in tibialis anterior (TA) muscles at fourdifferent times following the initiation of the treat-ments (days 3, 9, 14 and 21). Atrophy was efficientlytriggered by the treatment, as 40% of the TA weightwas lost after 21 days of chronic denervation(Fig. 1A). When denervation was only transient, theTA weight also initially decreased, but slowly increasedagain from day 14 while innervation occurred [25] (sta-tistically higher than chronic denervation from day 14to day 21, P < 0.05).050100150200T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of controlC9050100150200050100150200T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of control*050100150200250300T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of controlFoxO105010015020025030005010015020025030050100150200250300T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of control****0100200300400T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of controlNF-kB01002003004000100200300400T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of control**050100150T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of controlE2050100150050100150T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of control**1101001000T0 T3 T9 T14T21 D0 D3 D9 D14D21% of controlMuRF111010010001101001000T0 T3 T9 T14T21 D0 D3 D9 D14D21T0 T3 T9 T14T21 D0 D3 D9 D14D21% of control*******T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of controlMAFbx110100100010 000T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of control*******1520253035404550Day 3 Day 9 Day 14 Day 21TA weight (mg)1520253035404550Day 3 Day 9 Day 14 Day 2115202530354045501520253035404550Day 3 Day 9 Day 14 Day 21Day 3 Day 9 Day 14 Day 21ControlTransientDefinitiveTA weight (mg)*****050100150T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of controlUbiquitin050100150050100150T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of control**********T0 T3 T9 T14T21 D0 D3 D9 D14D21% of controlCARP110100100010 000100 000T0 T3 T9 T14T21 D0 D3 D9 D14D21T0 T3 T9 T14T21 D0 D3 D9 D14D21% of control*************050100150200T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of controlC2050100150200050100150200T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of control**050100150200T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of controlC8050100150200050100150200T0 T3 T9 T14 T21 D0 D3 D9 D14D21T0 T3 T9 T14 T21 D0 D3 D9 D14D21% of control***ABFig. 1. Effect of transient or definitivedenervation on muscle weight and geneexpression profiles. Male mice of the129SvPasIco strain were treated transiently(T) by crushing or definitively (D) by sectionof the sciatic nerve. Samples were takenfrom six animals on each date (control, 3, 7,9, 14 and 21 days after nerve injury). (A)Weight of TA muscles from control, crushedand sectioned limbs (n = 6 per time point).Other muscles of the lower limb, such asEDL and soleus muscles, present similarproportional loss of weight. P-values areshown as *P < 0.05 for significancebetween control and each time point, andashP < 0.05 for significance between tran-sient and definitive denervation. (B) Eachgraph demonstrates the expression level fora gene of interest (FoxO1, NF-jB-p65, Ub,E2-14 kDa, C2, C8, C9, MuRF1, MAFbx andCARP ) as assessed by qRT-PCR in TAmuscles of treated animals (n = 2–6 foreach time point). Results are expressed aspercentage of expression level measured inthe respective sham-operated muscles.*P < 0.05 and **P < 0.01 for significancebetween control and each time point;hP < 0.05 for significance betweentransient and definitive denervation.L. Laure et al. Cardiac ankyrin repeat protein in muscle plasticityFEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 671The results showed that, with both transient anddefinitive denervation, FoxO1, NF-jB-p65 and severalcomponents of the UPS (subunits C2, C8 and C9, andthe two E3s MuRF1 and MAFbx) were immediatelyand transiently upregulated, with higher variations inthe case of the two E3s (note the logarithmic scale)Fig. 1B). After this initial increase, their expressionreturned rapidly to normal levels, even displaying aslight reduction for every proteasome subunit consid-ered (C2, C8 and C9). Ubiquitin mRNA levelsdecreased very early during the time course of atrophy,remaining very low when denervation was definitive,but progressively increasing again from the start ofreinnervation when the sciatic nerve was only crushed(Fig. 1B). E2-14 kDa expression, which remained sta-ble when atrophy was only transient, was reduced atlate stages (from day 14) of definitive denervation-induced atrophy (Fig. 1B). CARP expression increasedwith atrophy (Fig. 1B). Whereas CARP expressionslowly decreased back to control level with the reduc-tion of atrophy in transient denervation, it stayed highwhen sciatic nerve regeneration was prevented. CARPupregulation was particularly important, as reflectedby the logarithmic scale.CARP is robustly upregulated in murine MDs,whereas FoxO1 expression is increasedspecifically in C3-null animalsThe expression levels of the mRNAs measured indenervation conditions were also compared by qRT-PCR in several models of MD: a natural model ofdysferlin deficiency [26], which we backcrossed on aC57BL/6 background and renamed B6.A/J-dysfprmd(model for LGMD2B), and three engineered modelsdeficient in either dystrophin (mdx4Cv[27]), calpain 3(C3-null; unpublished), or a-sarcoglycan (Sgca-null[28]), models of DMD, LGMD2A and LGMD2D,respectively. Every strain was used at an age where thesymptoms of the disease are detectable (4 months ofage for all models except C3-null mice, which wereevaluated at 7 months of age) and was compared to itsrespective control breed. The levels of mRNA expres-sion were measured in five muscles [quadriceps,extensorum digitorum longus (EDL), TA, soleus andpsoas], chosen in order to reflect the muscle impair-ment specificity – which varies between models – andthe type of fibres composing the muscle (see Experi-mental procedures).The results of qRT-PCR showed that the level ofNF-jB-p65 was slightly increased in specific muscles ofevery murine model, especially in the two most inflam-matory models, mdx4Cvand Sgca-null (Fig. 2). FoxO1was upregulated to very similar levels in every muscleof the C3-null strain (about two-fold over control, withP < 0.05 for quadriceps, EDL and psoas), whereasits expression was slightly decreased in all the othermodels (Fig. 2).The expression of Ub was not affected in any ofthe four pathologies considered, whereas that ofE2-14 kDa showed a tendency to decrease in severalmuscles (Fig. 2). In the mdx4Cvmodel, the levels of thethree proteasome subunits (C2, C8 and C9) wereaffected, C2 and C8 being downregulated and C9upregulated. Unexpectedly, considering their role inatrophy, neither MuRF1 nor MAFbx expressionincreased in these animal models, their levels beingeven significantly reduced in some cases (Fig. 2).The most remarkable effect observed herein wasrobust upregulation of CARP mRNA (note the loga-rithmic scale) in most muscles of all models of MDs(Fig. 2). Interestingly, this increase seemed to be higherin the muscles strongly affected by the pathologies.The increase was far more important in the Sgca-nulland in the mdx4Cvmodels, two dystrophies character-ized by a similar pathogenesis and caused by a defectin one of the components of the dystrophin-associatedglycoprotein complex.CARP is expressed at the protein level inmyofibres of denervation-induced atrophymodels and in mononucleated cells of highlyregenerative MD animalsAmong all the genes whose expression was investi-gated in the different models of muscle disorder, wedemonstrated that the CARP gene was the only onewhose expression systematically increased, which isconsistent with CARP’s role as a hub protein partici-pating in common pathological molecular pathway(s).CARP protein expression was hence measured bywestern blot in conditions of denervation-inducedatrophy and in murine models of MD (Fig. 3). Inter-estingly, we observed that the protein was detectedby western blot provided that the mRNA levelreached 60-fold over the basal condition. This ele-ment probably accounts for the inability to detectCARP in many conditions in which its mRNAupregulation is indeed important, although notimportant enough. The protein was thereforedetected from day 3 in both denervation conditions,remaining high until day 21 when the sciatic nervewas sectioned, but dropping to undetectable levelswhen reinnervation occurred during transient dener-vation (Fig. 3A, upper left panel). As regards themurine models of dystrophies, CARP protein wasCardiac ankyrin repeat protein in muscle plasticity L. Laure et al.672 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBSFig. 2. Gene expression profiles in murine models of MD. Each graph demonstrates the expression level for a gene of interest (FoxO1,NF-jB-p65, Ub, E2-14 kDa, C2, C8, C9, MuRF1, MAFbx and CARP ) as assessed by qRT-PCR in quadriceps, EDL, TA, soleus and psoasmuscles of C3-null, B6.A/J-dysfprmd, Sgca-null and mdx4Cvanimals (n = 3–4 for each point). Results are expressed as percentage of expres-sion level measured in the respective control muscles (129svPasIco and C57BL/6). P-values for significance between wild-type and deficientanimals: *P < 0.05 and **P < 0.01.L. Laure et al. Cardiac ankyrin repeat protein in muscle plasticityFEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 673detected in Sgca-null animals only (Fig. 3A, lowerleft panel).In order to clarify CARP cellular distribution withinthe muscle, immunodetection of the protein wasperformed on sections of muscles from denervated(3 days after denervation), a-sarcoglycan-deficient anddystrophin-deficient animals, and their appropriatecontrol strains. Specificity of the CARP antibody wasT0 T3 T9 T14 T3C3-null 129SvPasIco T3C57BL/6 B6.A/J-Dysf T3CARPPonceau redCARPPonceau redControlDenervatedControlSgca-nullDay3 after denervationSgca-nullControlCARP Pax7 Merge255.00.01440.0 pixels1560.0 pixels1440.0 pixels1560.0 pixels25500.0ABCDET21 D3 D9 D14 D21Sgca-nullC57BL/6mdx4cnmdx4cnmdx4cn50 µm 50 µm50 µmCardiac ankyrin repeat protein in muscle plasticity L. Laure et al.674 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBSfirst confirmed by the very specific staining observed incultured HER911 cells transfected with a plasmidencoding CARP (data not shown). In all sections (con-trol, denervated and MD animals), intense stainingwas seen within scattered clusters of small myofibres(Fig. 3B). No difference in the number of these clusterswas observed between conditions, indicating that theincrease in CARP expression did not originate fromthese cells. In denervation-induced atrophy, additionaldiffuse checked-pattern staining of higher-calibre fibreswas also detected, with a higher intensity in denervatedmuscles than in control sections (Fig. 3C). Consideringthe dystrophic process present in Sgca-null and mdx4Cvanimals, it is difficult to evaluate whether such upregu-lation also occurred in these models. In any case, veryintense foci corresponding to the cytoplasm of smallround cells flanking the muscle fibres were observed inSgca-null and mdx4Cvanimals (Fig. 3D). These cellsexpressed Pax7, the first transcription factor activatedduring myogenesis (Fig. 3E). Immunostaining of theneurofilament protein (NF) failed to reveal any colo-calization with CARP (data not shown).The p21WAF1/CIP1gene expression profile parallelsCARP in both MD and denervation-inducedatrophy modelsIn an attempt to dissect the molecular mechanismsactivated downstream of the CARP gene, the geneexpression of three relevant target genes chosen onaccount of CARP targets in cardiac and vascular tis-sues was measured by qRT-PCR in both denervationand MD models: the slow isoform of myosin lightchain MLC-2v [23], its paralogous gene in skeletalmuscle fast fibres, myosin light chain, fast (MLC-f),and the cell cycle inhibitor p21WAF1/CIP1[24]. Althoughit was previously reported to be expressed at low levelsin skeletal muscle [29], MLC-2v gene expressionremained undetectable in our conditions (data notshown). Whereas MLC-f expression was inverselycorrelated with CARP level in denervated animals, itslevel was generally unaffected, or even slightlyincreased, in muscles of MD models (data not shown).As neither MLC-2v nor MLC-f expression were corre-lated consistently with CARP level, neither of theseproteins seems to be involved in the CARP signallingpathway in skeletal muscle. In contrast, in both dener-vation and MD models, p21WAF1/CIP1gene expressionparalleled the CARP profile, i.e. increased when muscledegeneration occurred, and progressively decreasedback to control level during the reinnervation phase oftransient denervation (Fig. 4). It is worth mentioningthat p21WAF1/CIP1upregulation was of the same orderof magnitude as CARP upregulation, as reflected bythe logarithmic scale.CARP overexpression in wild-type mouse TAmuscle does not induce atrophy, but alters fibretype compositionConsidering that the upregulation of CARP persistedin definitive denervation and was consistent in MDmodels, we tried to understand its contribution tothese conditions and therefore investigated its func-tion(s) in skeletal muscle. A pseudotyped adeno-associ-ated virus 2/1 (AAV2/1) vector in which the CARPcoding sequence is fused with the yellow fluorescentprotein (YFP) sequence was injected into the TA mus-cle of normal mice. One month after injection, directobservation of the skinned injected muscle using con-focal fluorescence microscopy allowed the visualizationof a high level of YFP fluorescence. Measurement ofthe level of CARP mRNA by qRT-PCR confirmedstrong expression of the transgene (more than 60 timesthe level of mRNA in the control experiment,P < 0.01; Fig. 5A,B). This was indeed reflected by theappearance of a band corresponding to CARP expres-sion in western blots (Fig. 5C).Fig. 3. Analysis of CARP protein level and cellular localization in denervation-induced atrophy and in murine models of MD. (A) In conditionsof both transient (T) and definitive (D) denervation, the level of expression of CARP protein was assessed on equivalent amounts of lysateproteins resolved by western blot. The standardization of the loading was verified by Ponceau red staining. The expression of CARP proteincorrelates perfectly with the mRNA profile. The expression of CARP protein was estimated by the same method in the psoas muscle (allmodels but C3-null) or the deltoid muscle (C3-null mice) of the different MD models (comparison made in each case with the adequate wild-type strain). We previously verified that the upregulation of the level of CARP transcripts is similar in both deltoid and psoas in the C3-nullstrain (five-fold over wild-type control, data not shown). The results show that the upregulation of the expression of CARP protein can bevisualized in the Sgca-null model only. (B) CARP was detected by specific immunostaining (in green) on transverse sections of control(129svPasIco), denervated (129svPasIco), Sgca-null and mdx4Cvmuscles. Staining with dystrophin (in red) was used to delimit the fibres. Aview of each muscle taken with a 40· objective is presented, showing the very specific staining observed within clusters of small myofibres.Scale bars: 30 lm. (C) Surface plots representing the density of pixels from whole muscle sections after immunostaining show that CARPexpression increases after denervation. Original images were processed usingIMAGEJ software (8-bit images, Fire look-up table; http://rsb.info.nih.gov/ij/). (D) Very intense foci of mononucleated cells are observed in Sgca-null and mdx4Cvmuscles, but not in control muscles. Scalebars: 50 lm. (E) Costaining for CARP and Pax7 shows that the cells identified in (D) are positive for Pax7.L. Laure et al. Cardiac ankyrin repeat protein in muscle plasticityFEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 675We next investigated whether any phenotype wasapparent following CARP expression. In these condi-tions, the TA muscle weight was not affected(Fig. 5D). The histological appearance of the muscleswas normal (Fig. 5E). Morphometric analyses per-formed on sliced muscles (Fig. 5F) revealed no differ-ences in terms of number or mean diameter of fibresin comparison with the untreated control, althoughthe slight switch of the curve detected in the presenceof CARP might reflect a tendency to generate biggerfibres. Muscle sections were negative for terminaldeoxynucleotidyl transferase dUTP nick end labelling(TUNEL) staining, a marker of apoptosis (data notshown). As members of the CARP family wererecently suggested to play a role in fibre typing [30],immunohistochemistry of sections was performedusing an antibody against slow myosin. A shifttowards a reduction of slow-twitch fibre type wasobserved in the presence of CARP (P < 0.05;Fig. 5G).DiscussionIn this study, in an attempt to identify proteinsinvolved in the physiopathology of muscle wasting, weexamined the variation in the expression levels of sev-eral atrophy-associated genes during transient anddefinitive denervation and in four models of MD. Themain results gained from these studies are: (a) that thelevels of essential components of the UPS are aug-mented rapidly and transiently during denervation-induced atrophy, but are not elevated in most MDmuscles; (b) that FoxO1 mRNA expression is signifi-cantly increased in an LGMD2A model; and (c) thatCARP is robustly upregulated in numerous murineMD models and in denervation-induced atrophy.First, in line with their documented role in atrophy[31–33], we demonstrated that the expression levels ofmost investigated components of the UPS increasetransitorily during transient and definitive denervation.However, the mRNA expression levels of both Ub andE2-14 kDa, previously reported to be upregulated inatrophic conditions [5], do not increase, suggesting thatneither protein is rate-limiting in this atrophic situa-tion. Consistent with this result, the role of E2-14 kDahas lately been reconsidered, as the inactivation of thecorresponding genes does not seem to induce atrophyresistance, at least in the conditions tested [34]. In con-trast to the denervation situation, the mRNA expres-sion levels of the UPS elements were almost neverincreased in the four MDs tested, suggesting that theUPS is not overly activated in these diseases. Whetherthis reflects the slow progression of the diseases withrespect to the atrophy phenomenon or weak involve-ment of the UPS in the pathogenesis remains to bedetermined.Second, FoxO1 was demonstrated to be specificallyupregulated in every muscle of the C3-null strain.Besides raising the interesting possibility that FoxO1could be used as a diagnostic marker for LGMD2A,our results indicate that FoxO1 expression increases asa consequence of the absence of calpain 3, eitherbecause of a functional relationship between the twoproteins, or by a specific pathophysiological mecha-nism unique to calpain 3 deficiency. Regardless of itscause, this upregulation of FoxO1 is very likely to playan important role in the atrophy observed in this dis-ease, as its in vivo overexpression was previously dem-onstrated to induce reduction of muscle mass [6,35].However, this phenomenon does not seem to proceedthrough MuRF1 and MAFbx, as their expressionlevels did not increase in our C3-null strain, but mightp21WAF1/CIP1p21WAF1/CIP1Fig. 4. Gene expression profiles of p21WAF1/CIP1after transient or definitive denervation and in murine models of MD. The gene expression ofp21WAF1/CIP1was measured by qRT-PCR in TA muscles subjected to denervation-induced atrophy (n = 2–6 for each time point), and in quadri-ceps, EDL, TA, soleus and psoas muscles of the four MD models (n = 3–4 for each point). T, transient denervation; D, definitive denervation.Results are expressed as percentage of expression level measured in the respective control muscles for MDs (129svPasIco and C57BL/6)or in the sham-operated muscles for denervation models. In every situation, p21WAF1/CIP1gene expression reflects CARP level.Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al.676 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBSinstead involve other FoxO1-dependent signallingcascades, such as the autophagy pathway [36–38] and/or the control of satellite cell proliferation [39], twomechanisms important for muscle mass regulation [40].Provided that upregulation of FoxO1 is found also inLGMD2A patients, it seems highly likely that imped-ing FoxO1 increase and/or inhibiting its activity mightimprove the phenotype.0204060Control +CARPTA weight (mg)Control + CARP020406080100Control + CARP***0500010 00015 00020 00025 000Control CARPCARP mRNA level(% of control)WB CARPPonceau red+ CARPControl0100200300400500600700800900 0–10 10–20 20–30 30–40 40–50 50–60 60–70 70–80 80–90 90–100 100–110Control+ CARPFibre number/TAFibre diameter (µm)Mean number of slow-twitchfibres/section**ADFGBCEFig. 5. Effect of CARP overexpression in muscle. (A) One month after intramuscular injection of AAV–CARP–FP into the TA muscle, trans-duction efficiency was visualized by fluorescence microscopy. Note that most observable fibres expressed the construct, apart from a fewnegative fibres, which reflected the fluorescence background level. Scale bar: 50 lm. (B) The level of CARP transcript overexpression wasevaluated by qRT-PCR. Results are expressed as percentage of expression level measured in untransduced control muscles. n = 5–7;**P < 0.01 for significance between AAV–CARP–FP-injected TA muscle and contralateral control. (C) Expression of CARP protein was evalu-ated by western blot. Equivalent amounts of proteins were resolved, and Ponceau red staining was also used to confirm the standardizationof the loading. (D) Weights of injected TA muscles (n = 13) were compared to those of control samples. No significant difference wasobserved. (E) Histological analyses of muscles. Frozen sections of injected TA muscles (right panel) stained with haematoxylin–phloxin–sa-fran show features identical to normal sections (left panel). Scale bars: 20 lm. (F) Morphometric analysis of muscles overexpressing CARP.The number of fibres and their minimum diameter in injected muscles are not significantly different as compared to the control (n = 4). (G)Slow fibres were detected using slow myosin immunostaining, and their numbers were determined on three slices of the TA muscle mid-section. The number of slow fibres is reduced significantly (*P < 0.05) in CARP-expressing muscles as compared to noninjected muscles,indicating that CARP can influence the fibre type (n = 6).L. Laure et al. Cardiac ankyrin repeat protein in muscle plasticityFEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 677Third, the most striking evidence obtained from ourinvestigation is that CARP expression appears to bepersistently upregulated in denervation-induced atro-phy and is also elevated in all the MD models investi-gated. This last observation adds to the panel of musclepathologies already reported to be associated with anincrease in CARP expression: DMD, spinal muscularatrophy, facio-scapulo-humeral muscular dystrophy,amyotrophic lateral sclerosis, and peroxisome prolifera-tor-activated receptor-induced myopathy [41], as wellas the mdx, Swiss Jim Lambert (SJL) and musculardystrophy with myositis (MDM) animal models, defi-cient respectively in dystrophin, dysferlin and titin [42–48]. Overall, CARP seems to be a general marker ofmuscle damage. The reason(s) for CARP upregulationremain(s) obscure, and whether CARP expression par-ticipates in or represents an attempt to resist the unre-lenting muscle degeneration is an important issue.It is of interest that CARP is the only protein show-ing a variation of profile between transient and defini-tive denervation, with persistence of upregulation inthe latter condition. The CARP profile preciselyreflects muscle atrophy, which could be consistent withthe idea that CARP is an important factor in thismechanism. However, several facts support the ideathat CARP probably has no active part to play inmuscle atrophy per se. First, there is no consistentpositive correlation between CARP expression andatrophic situations [9,11], and it can even be upregulatedwhen skeletal muscle mass increases [18–21]. Second,in our hands, CARP overexpression in a normalmuscle background failed to induce significant changesin the number and calibre of fibres.Interestingly, although CARP is upregulated to verysimilar levels in both denervation and MD models,two different CARP expression sites are observed, inPax7-positive mononucleated cells and within the cyto-plasm of large myofibres, suggesting that CARP playsa role in myogenic activation, as well as in maturefibres. It is possible that a common molecular signal-ling pathway encompassing CARP and p21WAF1/CIP1occurs at these two locations. Indeed, among the threepotential target genes tested herein, the p21WAF1/CIP1gene is the only one whose expression matches strictlywith CARP level. In addition, p21WAF1/CIP1expressionwas observed at the same locations (proliferating myo-blasts [49] and terminally differentiated myotubes [50])as CARP overexpression. First, in the skeletal myo-genic lineage, p21WAF1/CIP1upregulation leads to theirreversible withdrawal of myoblasts from the cellcycle, stimulates differentiation, and confers protectionagainst apoptosis [49]. However, intense regenerationis still ongoing in both the Sgca-null and mdx4Cvmod-els, which suggests that either p21WAF1/CIP1is notinhibiting the cell cycle or else that the inhibition pro-cess is not entirely efficient. Second, p21WAF1/CIP1haspreviously been reported to be upregulated within themyonuclei of denervated muscles, a location where itmight be required to protect fibres against denerva-tion-induced apoptosis [50]. Taken as a whole, thefindings in the MD and denervation models studiedherein suggest that the systematic upregulation ofp21WAF1/CIP1whenever CARP expression increasesmight oppose cell proliferation and/or inhibit apop-tosis, thus preventing muscle remodelling.It should also be noted that muscle ankyrin repeatproteins, which include CARP, have recently been sug-gested to be important for sarcomere length stabilityand muscle stiffness and to have an inhibitory role inthe regenerative response of muscle tissue [30]. Here,we showed that CARP overexpression induces a switchtowards fast-twitch fibres. All of these elements add tothe previous observations related to the effects ofp21WAF1/CIP1, and support the idea that CARP plays aglobal role in muscle plasticity. Accordingly, the main-tenance of CARP expression during chronic denerva-tion suggests that this protein plays an active part inthis static condition and might contribute actively tothe prevention of remodelling through blockade ofadaptive pathways during deleterious muscle processes.Interestingly, besides MDs, CARP has been reportedto be upregulated in many other pathological tissues(hypertrophic hearts [12–17], nephropathic kidneys[51], and wounded epidermis [52]), which suggests thatCARP is a widely spread marker of tissue alterations.If the consequences of CARP overexpression proveto be detrimental for the skeletal muscle, impedingCARP expression would seem to be especially interest-ing, as CARP expression is increased in many differentmuscle diseases. Considering that transforming growthfactor-b, tumour necrosis factor-a and interleukin-1aare known stimuli of CARP expression, pharmacologi-cally targeting these pathways might be an option.Indeed, as it has already been demonstrated that drug-mediated inhibition of tumour necrosis factor-a [53] ortransforming growth factor-b [54] in the mdx mousemodel greatly improves the muscle histology, it wouldbe interesting to investigate the role of CARP in thesesignalling pathways.Experimental proceduresAnimalsAll mice were handled in accordance with the Europeanguidelines for the humane care and use of experimentalCardiac ankyrin repeat protein in muscle plasticity L. Laure et al.678 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS[...]... TTTGGATTCCAGATTTGTGTTTGACAGACCA 392mC2.R: GGATCTGGGTTTTGCTTCCA 343mC8.F: TCTTGCAGACAGAGTGGCCA 391mC8.P: CGCTGTTAGACCTTTTGGCTGCAGTTTC 439mC8.R: CGCACTGTAAGACCCCAACA 6mC9.F: TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT 83E2_14.F: GGGATTTCAAGCGATTGCAA... CGCCCCATCTGAAAACAACATCATGC 191E2_14.R: GGTGTCCCTTCTGGTCCAAA 1297mFoxO1.F: CTAAGTGGCCTGCGAGTCCT 1369mFoxO1.P: CCAGCTCAAATGCTAGTACCATCAGTGGGAG 1445mFoxO1.R: GTCCCCATCTCCCAGGTCAT 1235mMafBx.F, CTGGAAGGGCACTGACCATC 1265mMafBx.P, CAACAACCCAGAGAGCTGCTCCGTCTC 1353mMafBx.R, TGTTGTCGTGTGCTGGGATT 396mMLCfast.F: TGGAGGAGCTGCTTACCACG 423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA 500mMLCfast.R: TCTTGTAGTCCACGTTGCCG... 381mMLC-2V.F: GAAGGCTGACTATGTCCGGG 403mMLC-2V.P: ATGCTGACCACACAAGCAGAGAGGTTCTC 461mMLC-2V.R: GCTGCGAACATCTGGTCGAT 958mMurf1.F AGGGCCATTGACTTTGGGAC 995mMurf1.P AGGAGGAGTTTACAGAAGAGGAGGCTGATGAG 1047mMurf1.R CTCTGTGGTCACGCCCTCTT M1833p65.F: GGCGGCACGTTTTACTCTTT M1857p65.P: CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT... ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: GTGCTTTGACACCCACGGTA 22mUbiq.F: TCGGCGGTCTTTCTGTGAG 51mUbiq.P: TGTTTCGACGCGCTGGGCG 96mUbiq.R: GTTAACAAATGTGATGAAAGCACAAA ultracentrifugation followed by dialysis against sterile NaCl/Pi After DNA extraction by successive treatments with DNase I and proteinase K, viral genomes were quantified by a TaqMan real-time... Cardiac ankyrin repeat protein in muscle plasticity L Laure et al 45 Nakada C, Oka A, Nonaka I, Sato K, Mori S, Ito H & Moriyama M (2003) Cardiac ankyrin repeat protein is preferentially induced in atrophic myofibers of congenital myopathy and spinal muscular atrophy Pathol Int 53, 653–658 46 Porter JD, Khanna S, Kaminski HJ, Rao JS, Merriam AP, Richmonds CR, Leahy P, Li J, Guo W & Andrade FH (2002) A chronic... 13, 364–376 42 Bakay M, Zhao P, Chen J & Hoffman EP (2002) A web-accessible complete transcriptome of normal human and DMD muscle Neuromuscul Disord 12(Suppl 1), S125–S141 43 Nakamura K, Nakada C, Takeuchi K, Osaki M, Shomori K, Kato S, Ohama E, Sato K, Fukayama M, Mori S et al (2002) Altered expression of cardiac ankyrin repeat protein and its homologue, ankyrin repeat protein with PEST and proline-rich... doxorubicin CARP, a nuclear modulator of gene expression in cardiac progenitor cells and cardiomyocytes J Biol Chem 272, 22800– 22808 Zou Y, Evans S, Chen J, Kuo HC, Harvey RP & Chien KR (1997) CARP, a cardiac ankyrin repeat protein, is downstream in the Nkx2-5 homeobox gene pathway Development 124, 793–804 Kanai H, Tanaka T, Aihara Y, Takeda S, Kawabata M, Miyazono K, Nagai R & Kurabayashi M (2001) Transforming... PCR assay using primers and probes complementary to the inverted terminal repeat region The primer pairs and TaqMan MGB probes used for inverted terminal repeat amplification were: 1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC ATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATT FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS L Laure et al AACCC-3¢... RM, Opalenik SR, Wolf E, Goppelt A & Davidson JM (2005) CARP, a cardiac ankyrin repeat protein, is up-regulated during wound healing and induces angiogenesis in experimental granulation tissue Am J Pathol 166, 303– 312 53 Grounds MD & Torrisi J (2004) Anti-TNFalpha (Remicade) therapy protects dystrophic skeletal muscle from necrosis FASEB J 18, 676–682 54 Cohn RD, van Erp C, Habashi JP, Soleimani AA,... atrophic muscles in amyotrophic lateral sclerosis Pathobiology 70, 197–203 44 Nakada C, Tsukamoto Y, Oka A, Nonaka I, Takeda S, Sato K, Mori S, Ito H & Moriyama M (2003) Cardiacrestricted ankyrin- repeated protein is differentially induced in Duchenne and congenital muscular dystrophy Lab Invest 83, 711–719 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors Journal compilation ª 2008 FEBS 683 Cardiac . TCTGCACCCTCACCGTCTTC58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT135mC9.R: GGCTTCCATGGCATACTCCACARP Cardiac ankyrin repeat protein NM_013468 616mCARP.F:. TCGGCGGTCTTTCTGTGAG51mUbiq.P: TGTTTCGACGCGCTGGGCG96mUbiq.R: GTTAACAAATGTGATGAAAGCACAAA Cardiac ankyrin repeat protein in muscle plasticity L. Laure et al.680 FEBS Journal 276 (2009)
- Xem thêm -

Xem thêm: Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot, Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot, Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot