otx otd functional equivalence as a means to support a common origin of the cns in bilaterians
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked increase in the cesarean delivery rate We propose a new workload-driven ... patient-controlled analgesia pumps The OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal ... general anesthesia Maternal death due to anesthesia is the sixth leading cause of pregnancyrelated death in the United States [6] and most anesthesia-related deaths occur during general anesthesia...
- 14
- 610
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII ... transfected with synthesized siRNAs [nontargeting, 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), ... GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors RanGTP is abundant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange...
- 12
- 454
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... and Site-3 binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide ... by Luciakova et al [13] MALDITOF analysis was performed in reflector mode using a Voyager-DE STR MALDI-TOF mass spectrometer (Applied Biosystems) Internal calibration was performed with autodigested...
- 8
- 426
- 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
... Labeling of the primary antibody was carried out using an appropriate biotinylated secondary antibody (Vectastain ABC complex; Vector Laboratories, Inc., Burlingame, CA, USA) and staining was ... in ERK cascade O Maıga et al ¨ Introduction The mitogen-activated protein kinases (MAPKs) are a family of S ⁄ T-protein kinases, including p38, c-Jun N-terminal kinase and extracellular signal-responsive ... encoding the hDlg PDZ1 and PDZ2 domains as bait in a yeast two-hybrid screening assay of a human aorta cDNA library Interestingly, two independent clones were identified as containing the C-terminal...
- 11
- 419
- 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx
... Moreover, there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4.3) Proof of Eilenberg’s theorem ... Actually, a minor modification of the above proof shows that the assumptions of Theorem 1.1 could be weakened: the relations Rn need not be transitive if we assume the uniqueness of a point x in condition...
- 6
- 268
- 0
Báo cáo y học: " Tracheal agenesis as a rare cause of difficult intubation in a newborn with respiratory distress: a case report" pdf
... Life support was discontinued with the agreement of the parents, and the baby was allowed to die At the end of the surgical procedure, an endotracheal tube was inserted into the esophagus and ... findings are a cleft between the arytenoids, as well as associated congenital anomalies Good oxygenation may be maintained with bag-mask ventilation or esophageal intubation The diagnosis is made ... Bag-mask ventilation was continued and an otolaryngologist was consulted for emergency tracheostomy Oxygen saturation was successfully maintained at above 85% with bag-mask ventilation It was...
- 3
- 399
- 0
Báo cáo y học: " Hypertrophic osteoarthropathy as the cause of a super scan of the bone in a patient with prostate cancer: a case report" pps
... including chronic erythema, paresthesia and increased sweating Most commonly it is associated with an intrathoracic malignancy, which can be carcinoma of the lung as well as pulmonary metastasis of ... osteoarthropathy was made with the prostate cancer as an "innocent" bystander Since the patient was rapidly deteriorating palliative care was given The patient died several weeks after admission ... involved in the management of the patient as well as writing the case report Both authors have read and approved the manuscript Consent Informed and verbal consent was obtained from the patient...
- 6
- 353
- 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 ... buffer and [c-32P]-ATP MBP was used as an artificial substrate to assess the kinase activity and GST alone was used as a negative control The top panel shows the kinase assay visualized by autoradiography ... Matsuoka D, Nanmori T, Sato K, Fukami Y, Kikkawa U & Yasuda T (2002) Activation of AtMEK1, an Arabidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active mutants...
- 11
- 700
- 0
Tài liệu Why Has The Cost of Navy Ships Risen - A Macroscopic Examination of the Trends in U.S. Naval Ship Costs Over the Past Several Decades doc
... quantities, ultimately leading to a shrinking fleet size To counter the increasing cost, the Navy can target some of the main factors related to escalation, such as those related to the capability and complexity ... fashion and in a way that encompasses as many relevant broad topics as possible Other organizations, such as the Naval Sea Systems Command’s (NAVSEA’s) Ship Design, Integration and Engineering (Code ... under Contract DASW01-01-C-0004 Library of Congress Cataloging -in- Publication Data Arena, Mark V Why has the cost of Navy ships risen? : a macroscopic examination of the trends in U.S Naval ship...
- 124
- 583
- 0
Tài liệu Why Has the Cost of Fixed-Wing Aircraft Risen - A Macroscopic Examination of the Trends in U.S. Military Aircraft Costs over the Past Several Decades pptx
... because the P-1 data include a broader set of systems, such as the T-34 and the Joint Primary Aircraft Training System, most with lower rates of cost increase, that are not in the HAPCA data Data and ... metals and avionics systems, such as navigation equipment), materials and equipment used in aircraft manufacturing have increased in cost at roughly the same rate as other measures of in ation Altogether, ... spare parts, data, contractor support, and training equipment, but are necessary to operate and maintain the fleet Data and Price Trends 11 Table 2.1 Average Annual Cost Escalation for Aircraft...
- 118
- 543
- 0
Báo cáo khoa học: A profile of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor pdf
... Pharmacia Biotech (Piscataway, NJ, USA) DNA polymerase and DpnI endonuclease were obtained from Stratagene (La Jolla, CA, USA) Rabbit anti-(human IP) serum was purchased from Cayman Chemical (Ann ... specific ligand-binding information The ligandbinding data for some mutants, such as W17 6A and L172I, showed an increase that was clearly beyond the standard deviation The substitutions of the hydrophobic ... mutants in the assay, even when increasing amounts of [3H]iloprost were used A combination of the results obtained from the two cell lines and the titration assays demonstrated the involvement of the...
- 10
- 354
- 0
cottey a., edmunds t., forster a. femocratic control of the military in postcommunist europe. guarding the guards. 2002
... President of the Atlantic Council of Slovenia, President of the Slovenian Emigrant’s Association and Vice-Chairman of the Atlantic Treaty Association in Paris Alex J Bellamy is a Lecturer at the Defence ... Of cer at the Lithuanian Ministry of National Defence Ilmars Viksne is Commandant of the Latvian National Defence Academy in Riga Marie Vlachová is Director of the Research Department at the Ministry ... for democratic control of the military are determined by a single factor or a common combination of factors Instead, we argue that a wide range of domestic and international factors, outlined below,...
- 287
- 428
- 0
Báo cáo khoa học: "Mucin pattern reflects the origin of the adenocarcinoma in Barrett''''s esophagus: a retrospective clinical and laboratorial study" ppsx
... were the pathologists and involved in laboratory investigation AVSR was involved in collecting data, laboratory investigation, carried out the immunoassays All authors read and approved the final ... expressed at seven of the ABE in this investigation So, an area with gastric metaplasia within the specialized Barrett's epithelium could originate an expansion clone capable of initiate the carcinogenesis ... and tumor Characteristics Patient Cell type (gastric or intestinal) predominance in the specialized columnar epithelium 10 11 12 13 intestinal intestinal similar intestinal Gastric Gastric Gastric...
- 8
- 410
- 0
Báo cáo khoa học: "A giant hemolymphangioma of the pancreas in a 20-year-old girl: a report of one case and review of the literature" pptx
... in laboratory data including tumor markers such as CEA and CA19-9 At laparotomy there was a black polycystic, retroperitoneal tumor extending from coeliac axis to the origin of the head of pancreas ... Computed tomography demonstrating a large tumour with partial blood flow(arrow) in abdominal cavity This tumor may be asymptomatic for a long time Abdominal pain and awareness of abdominal mass are the ... although the case reported by Banchini [4] had a slight increase in alkaline phosphatase and gamma-glutamyl transferase Serum carcinoembryonic antigen (CEA) and CA19-9 are within normal limits Imaging...
- 3
- 377
- 0
Báo cáo y học: "Do synovial biopsies help to support evidence for involvement of innate immunity in the immunopathology of Behçet’s disease" pot
... group has studied SF extensively in various other arthropathies, such as spondyloarthropathy (SpA) and RA, and comparisons may be made with historical data Comparing SF samples between SpA and other ... that are exposed to exogenous factors, or more intensively treated BD patients These results can then be compared with various other inflammatory diseases in order to obtain greater insight into ... (intercellular adhesion molecule-1 and vascular cell adhesion molecule-1) and endothelial growth factor markers such as E-selectin, P-selectin, and endoglin are linked to SPR [9] Infiltrating cells are mainly...
- 3
- 352
- 0
Báo cáo y học: " Pre-notification of arriving trauma patient at trauma centre: A retrospective analysis of the information in 700 consecutive cases" doc
... participated in analyzing and interpretation the data, and participated in drafting and finalizing the manuscript LH conceived and designed the study, participated in analyzing and interpretation the ... the trauma bay, the unnecessary utilization of teams may result in decrease of the team morale Normally trauma admitting hospitals, including our, base their trauma team activation criteria on ... The aim of the present study was to analyze the information provided by pre-notifications of arriving trauma patients, and to analyze the response on the trauma team activation (TTA) in regard to...
- 5
- 249
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... symptoms in STAT5 mice are due to defective Treg cells [48] Another player in the IL-2 signaling cascades is the Jak3 kinase Jak3 -/- mice display symptoms of autoimmunity and accumulation of auto-reactive ... cells in vivo, and leads to an increase of their functionality [89] These findings have prompted research into the use of combining IL-2 and rapamycin therapies In NOD mice, IL-2 synergizes with the ... Combination therapy with cellular infusion The idea of cellular therapy has also been examined The major challenge in this case is the very low abundance of Treg cells The possibility of expanding...
- 12
- 573
- 0
báo cáo hóa học: " Saliva soluble HLA as a potential marker of response to interferon-β1a in multiple sclerosis: A preliminary study" pdf
... Of particular interest, the increase in sHLA-II values was associated with a decline on brain MRI activity as demonstrated by post-contrast T1-weighted axial brain images Initially, six patients ... of the patient as well as to the MRI brain scan findings Statistical analysis Using the Friedman non-parametric method [19], we compared the mean values for saliva sHLA-II in study subjects and ... measured in a recent study and reported to be an indicator of therapeutic efficacy [23] Efforts have also been made to determine clinical and demographic indicators of disease activity in an...
- 6
- 424
- 0
Báo cáo y học: "Osteoarthritis and nutrition. From nutraceuticals to functional foods: a systematic review of the scientific evidence" pps
... decreased the IL1-induced aggrecanase activity and basal aggrecanase and collagenase activity, whereas, in contrast, n-6 stimulated the basal aggrecanase and collagenase activity n-3 also decreased ... affected the activities of lysosomal enzymes, decreasing the activities of arylsulfatase A and arysulfatase B, an N-acetylgalactosaminidase-4-sulfatase, but increasing the activity of acid phosphatase ... Uncaria tomentosa and Uncaria guianensis (cat's claw) Cat's claw is a vine from the basin of the Amazon River There are two species, U tomentosa and U guianensis, that are traditionally used in...
- 22
- 547
- 0
Báo cáo y học: " Pelvic digit as a rare cause of chronic hip pain and functional impairment: a case report and review of the literature" pps
... described in the literature For example, Lame [5] and Granieri and Bacarini [7] described a total of six cases, all consisting of a bony structure of at least two bony elements and at least one ... similar configuration was reported by Casey et al [3] Similarly, variable origins for the digits have been described According to some authors, the anomaly can originate from a displaced costal ... the distal sacral vertebra but was not directly attached to the sacrum Histological assessment after There are some variations in the numbers of bony segments and (pseudo-) articulations of pelvic...
- 3
- 289
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008