Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase as a novel partner of the scaffolding protein human homolog of disc-large Oumou Maıga1, Monique Philippe1, Larissa Kotelevets2, Eric Chastre2, Samira Benadda3, ¨ Dominique Pidard1, Roger Vranckx1 and Laurence Walch1 ´ INSERM U698, Universite Paris 7, France ´ INSERM U773, Centre de Recherche Biomedicale Bichat Beaujon, Paris, France Plateau de Microscopie Confocale ICB-IFR 02, Paris, France Keywords human disc-large homolog; human vascular smooth muscle cells; MAPK ERK kinase 2; scaffold protein; synapse-associated protein 97 Correspondence L Walch, INSERM U698, Cardiovascular Haematology, Bio-Engineering and Remodelling, Bichat-Claude Bernard Hospital, 46 rue Henri Huchard, F-75877, Paris, Cedex 18, France Fax: +33 40 25 86 02 Tel: +33 40 25 75 22 E-mail: laurence.walch@inserm.fr (Received 11 January 2011, revised 29 April 2011, accepted 20 May 2011) doi:10.1111/j.1742-4658.2011.08192.x Human disc-large homolog (hDlg), also known as synapse-associated protein 97, is a scaffold protein, a member of the membrane-associated guanylate kinase family, implicated in neuronal synapses and epithelial– epithelial cell junctions whose expression and function remains poorly characterized in most tissues, particularly in the vasculature In human vascular tissues, hDlg is highly expressed in smooth muscle cells (VSMCs) Using the yeast two-hybrid system to screen a human aorta cDNA library, we identified mitogen-activated protein ⁄ extracellular signal-responsive kinase (ERK) kinase (MEK)2, a member of the ERK cascade, as an hDlg binding partner Site-directed mutagenesis showed a major involvement of the PSD-95, disc-large, ZO-1 domain-2 of hDlg and the C-terminal sequence RTAV of MEK2 in this interaction Coimmunoprecipitation assays in both human VSMCs and human embryonic kidney 293 cells, demonstrated that endogenous hDlg physically interacts with MEK2 but not with MEK1 Confocal microscopy suggested a colocalization of the two proteins at the inner layer of the plasma membrane of confluent human embryonic kidney 293 cells, and in a perinuclear area in human VSMCs Additionally, hDlg also associates with the endoplasmic reticulum and microtubules in these latter cells Taken together, these findings allow us to hypothesize that hDlg acts as a MEK2-specific scaffold protein for the ERK signaling pathway, and may improve our understanding of how scaffold proteins, such as hDlg, differentially tune MEK1 ⁄ MEK2 signaling and cell responses Structured digital abstract l hDlg and MEK2 colocalize by fluorescence microscopy (View Interaction 1, 2, 3) l hDlg physically interacts with MEK2 by two hybrid (View Interaction 1, 2, 3) l hDlg physically interacts with MEK2 by anti bait coimmunoprecipitation (View Interaction 1, 2) l MEK2 physically interacts with hDlg by anti bait coimmunoprecipitation (View Interaction 1, 2) Abbreviations CHO, Chinese hamster ovary; ERK, extracellular signal-responsive kinase; GK, guanylate kinase; hDlg, human disc-large homolog; HEK-293, human embryonic kidney 293; hVSMC, human vascular smooth muscle cell; MAGUK, membrane-associated guanylate kinase; MAPK, mitogen-activated protein kinase; MEK1 ⁄ 2, MAPK ERK kinase ⁄ 2; PDZ, PSD-95, disc-large, ZO-1 FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS 2655 hDlg in ERK cascade O Maga et al ă Introduction The mitogen-activated protein kinases (MAPKs) are a family of S ⁄ T-protein kinases, including p38, c-Jun N-terminal kinase and extracellular signal-responsive kinase (ERK)1 ⁄ 2, which control several biological processes such as proliferation, differentiation, survival and apoptosis The ERK signaling pathway includes three major components that are activated in cascade by phosphorylation Raf phosphorylates two serine residues in the activation loop of mitogen-activated protein ⁄ ERK kinase (MEK)1 ⁄ MEK ⁄ phosphorylates ERK1 ⁄ on both the threonine and tyrosine residues in the conserved TEY sequence [1] and activated ERK phosphorylates the serine or threonine residues on the S ⁄ T-P consensus site in more than 100 nuclear, cytosolic or membrane substrates with diverse functions [2] The outcomes of ERK activation are as various as the ERK substrates, and so an accurate regulation of the ERK signaling pathway is necessary This pathway is under the control of different regulatory elements such as phosphatases, docking domains and scaffold proteins [2–4] Docking domains are consensus sequences that MAPK recognize both on their substrates, as well as on relevant down-regulating phosphatases and scaffold proteins [4] The latter can be divided into two categories [2] Upstream scaffold proteins interact with at least one MAPK implicated in ERK activation to facilitate a functional interaction and regulate the localization and the duration of the signal For example, the MEK partner directs the ERK cascade to the surface of the late endosomes [5] Downstream scaffold proteins bind ERK and direct it to specific substrates For example, the phosphoprotein enriched in astrocyte-15 binds ERK1 ⁄ and ribosomal protein S6 kinase 2, a direct substrate of ERK, thereby enhancing the activation of this latter kinase [6] Human disc-large homolog (hDlg) is a member of the membrane-associated guanylate kinase (MAGUK) scaffold protein family [7] Interaction with MAGUK permits the formation of multiprotein complexes, stable subcellular localizations of interacting partners and the coordination of their activities MAGUK contain a number of protein–protein interaction domains, such as PSD-95, disc-large, ZO-1 (PDZ), Src-homology and guanylate kinase (GK) domains In particular, PDZ domains contain a specific GLGF sequence that constitutes a hydrophobic cavity where the X-S ⁄ T-XV ⁄ L C-terminal motif of their target proteins binds [8] hDlg expression has been established in a variety of cells, including neurons, astrocytes, epithelial cells and T lymphocytes, where hDlg interacts with cytoskeleton proteins, ion channels, receptors or signaling proteins, 2656 such as kinases The association of hDlg with kinases allows the orchestration of cell-specific signaling pathways For example, hDlg ⁄ p38 association coordinates T cell receptor signaling in T lymphocytes, whereas hDlg recruits phosphatidylinositol 3-kinase to E-cadherin complexes, allowing integrity of the adherent junction in epithelial cells [9,10] It should be noted that there has been no demonstration to date showing that MAGUK are implicated in the ERK cascade Little is known about the role of hDlg in the cardiovascular system Previous studies have shown that hDlg is expressed in the myocardium where it can form complexes with K+ channels such as the inwardly-rectifying K+ channel 2.2 or the voltage-gated K+ channel, allowing functional channel clustering and an enhancement of the K+ current [11–13] However, the putative expression and functions of hDlg remain to be established in vascular tissues To gain insight into hDlg expression and specific functions in human vascular tissues, we examined hDlg expression in human arteries and, more particularly, in human vascular smooth muscle cells (hVSMCs), and searched for PDZ domain-dependent binding partners A screening of a human aorta cDNA library by the yeast two-hybrid assay allowed us to identify MEK2 as a new potential binding partner for hDlg This interaction was then validated by biochemical procedures, including coimmunoprecipitation and confocal immunomicroscopy colabeling using cultured hVSMCs, as well as Chinese hamster ovary (CHO) and human embryonic kidney 293 (HEK-293) cells as models Results hDlg protein is present in hVSMCs As shown in Fig 1A, immunohistochemical labeling of hDlg carried out on sections of nonpathological human mammary arteries revealed that, among the arterial tissue layers, the media specifically exhibited a strong staining Because VSMCs are the only cell type found in the healthy arterial media, hDlg expression and subcellular localization were then investigated in cultured primary hVSMCs Immunoblot analysis of total or subcellular protein extracts prepared from confluent hVSMCs identified the presence of two molecular immunoreactive species both in the total extract and in the membrane fraction (Fig 1B), whereas they were absent in the cytosolic fraction Taken together, these data suggest that hDlg is associated with membrane components By immunofluorescent labeling FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS B Total A Cytosol hDlg in ERK cascade Membranes O Maga et al ă hDlg Ct hDlg N-cadherin 200 µm RSK C D E Fig Detection of hDlg in hVSMCs (A) Serial frozen sections of human mammary artery were stained with monoclonal hDlg antibody or an irrelevant mouse IgG1 (Ct) (B) Total hVSMC lysate, or a lysate fractionated into membrane-associated and cytosolic proteins, was submitted to western blot detection of hDlg and the fraction markers N-cadherin and ribosomal S6 kinase (RSK) (C–F) Cultured hVSMCs were stained for hDlg (green signal) and, as a red signal, (C) calreticulin, an endoplasmic reticulum marker, (D) GM130, a Golgi marker, (E) tubulin or (F) F-actin Cells were analyzed by confocal microscopy; colocalization (overlay) appears in yellow and is indicated by white arrowheads coupled with confocal microscopy, hDlg was observed to be widely distributed within the cytoplasm of hVSMCs (Fig 1C–E) Costaining with various organelle markers showed that hDlg partially colocalized with endoplasmic reticulum-associated calreticulin (Fig 1C), with Golgi-associated GM130 (Fig 1D) and with tubulin at the cell periphery, as well as in the cytoplasm (Fig 1E), and locally with cortical F-actin (Fig 1F) Taken together, these data suggest that hDlg is mainly associated with internal membrane structures and with the cytoskeleton in hVSMCs F Two hDlg isoforms are expressed in human arteries hDlg mRNAs are known to contain three regions that encompass alternatively spliced exons (Fig 2A), leading to several hDlg isoforms [14,15] To further characterize hDlg isoforms expressed in hVSMCs, primer pairs were chosen within the exons that surround the region of alternative splicing (Fig 2A) and RT-PCR experiments were carried out on human de-endothelialized pulmonary arterial RNA extracts (Fig 2B–D), FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS 2657 hDlg in ERK cascade O Maga et al ă A L27 β1 β2 CXC β3 α1 GUK PDZ1 // // SH3 Ι1Α Ι1Β // 12 // // 13 Ι3 Ι2 Ι5 Ι4 14 15 // 19 Primers Primers Primers B bp 600 500 C Primers 1 Primers 2 400 300 D E Primers 400 300 bp 300 200 Primers GAPDH Fig Two hDlg isoforms predominate in human arterial tissues (A) Schematic representation of the hDlg genomic structure Open boxes represent constitutive exons and gray boxes indicate alternatively spliced exons Three b exons encode an Lin-2,-7 domain (b isoform) and one a exon a cystein doublet (a isoform) Various combinations of two (I1A and I1B) or four (I2–I5) insertions were described as being transcribed in a tissue-specific manner Arrows show the relative position of the primer pairs used for RT-PCR (B–E) Transcripts obtained by RT-PCR, using (B) primer pair 1, (C) primer pair 2, (D) primer pair or (E) primers directed against GAPDH, on mRNAs extracted from three different pulmonary artery samples followed by amplification product sequencing (Fig S1) Taken together, the results allow us to conclude that the larger form of hDlg expressed in hVSMCs corresponds to the I1A–I1B and I3–I5 insertions, whereas the shorter form contains I1B and I3–I5 insertions Both isoforms contain a Lin-2,-7 domain hDlg interacts with MEK2 as assessed by the yeast two-hybrid system We then sought to identify hDlg interacting partners in hVSMCs Accordingly, we used a vector encoding the hDlg PDZ1 and PDZ2 domains as bait in a yeast two-hybrid screening assay of a human aorta cDNA library Interestingly, two independent clones were identified as containing the C-terminal region of the human MEK2 cDNA To analyze in more detail the interacting sites within hDlg and MEK2, mutant derivatives of PGKBT7-PDZ-1-2 and pACT2-MEK2 were constructed On the one hand, the conserved GLGF sequences present in the PDZ1 and PDZ2 domains were mutated to the positively charged inactive GRRF sequence [16] On the other hand, the C-terminal RTAV putative PDZ-binding motif of MEK2 was either mutated to RAAV, or deleted The expression levels of the mutated forms and of their wild-type counterparts were similar in yeasts (Fig 3B, D) These data suggest that the PDZ1 and PDZ2 domains of hDlg are separately able to interact with the C-termi2658 nus of MEK2, even though the interaction implicating PDZ2 is stronger, whereas the PDZ3 domain shows no interaction Coexpression of the MEK2 mutant forms with wild-type PDZ-1-2 abolished yeast growth (Fig 3C), demonstrating the crucial involvement of the MEK2 C-terminus in the interaction Taken together, these results indicate that the PDZ2 domain of hDlg and the C-terminal RTAV sequence of MEK2 are required for the optimal interaction of the two protein partners Coimmunoprecipitation of endogenous hDlg and MEK2 proteins To determine whether endogenous hDlg and MEK2 physically interact, coimmunoprecipitation assays were carried out in HEK-293 (used as a cell model) and in confluent hVSMC cell lysates The specific hDlg antibody was able to coimmunoprecipate MEK2 from HEK-293 (Fig 4A) and hVSMC (Fig 4C) cell lysates, whereas, reciprocally, the specific MEK2 antibody coimmunoprecipitated hDlg from both cell lysates (Fig 4B, D) hDlg and MEK2 were not (or minimally) detectable after immunoprecipitation with irrelevant antibodies These results suggest that the hDlg isoforms expressed endogenously in HEK-293 cells or in confluent hVSMCs can physically interact with MEK2, even though only a small fraction of MEK2 is coimmunoprecipitated with hDlg, as shown by the large FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS PDZ3 PDZ-1-2 PDZ3 PDZ-1mut-2 PDZ-1-2 kDa 50 Media Ct B PDZ-1-2mut A PDZ-1-2mut hDlg in ERK cascade PDZ-1mut-2 O Maga et al ă WB Myc 37 SD-LT 25 50 AD 50 GAPDH Del RAAV Ct 50 Del RAAV D RTAV C RTAV SD-LT + X-α-gal Myc 37 SD-LT 50 AD SD-LT + X-α-gal 50 GAPDH Fig The PDZ2 domain of hDlg strongly interacts with the C-terminal sequence RTAV of MEK2 (A, C) Interactions were analyzed by a yeast two-hybrid assay (A) The PDZ-1–2 domains of hDlg, either wild-type or mutated on the GLGF sequence in either the PDZ1 domain (PDZ-1mut-2) or the PDZ2 domain (PDZ-1-2mut), or the hDlg PDZ3 domain, all fused to the GAL4 DNA-binding domain, were co-expressed in yeasts with the C-terminus of MEK2 fused to the GAL4 activating domain (C) The PDZ-1-2 domains of hDlg fused to the GAL4 DNA-binding domain were co-expressed in yeasts with the C-terminus of MEK2, encompassing the PDZ binding sequence, which was intact (RTAV), replaced by an irrelevant sequence (RAAV), or deleted (Del), all fused to the GAL4 activating domain Yeasts were grown on two selection media: SD-LT that selects double transformants, and SD-LTHA + X-a-gal that selects protein–protein interactions with high stringency Yeasts grow and turn blue when GAL-4-responsive genes, which encode galactodidases, are activated (B, D) Western blotting of fusion protein expression: hDlg PDZ domains fused to the Myc-tagged GAL4 DNA-binding domain were detected by Myc antibody (Myc), and MEK2 C-terminus fused to the GAL4 activation domain was detected using GAL4 activation domain antibody (AD) Nontransfected yeast protein extracts were used as control (Ct) and GAPDH detection as a loading control amount of MEK2 remaining after hDlg precipitation in hVSMCs (Fig S2A) Subsequently, the ability of hDlg to interact with other members of the ERK cascade was tested Under our experimental conditions, the hDlg antibody was unable to coimmunoprecipate MEK1, Raf or ERK1 ⁄ proteins from hVSMCs (Fig S2B) Colocalization of hDlg and MEK2 The localization of transfected full-length EGFP-hDlg and human HA-MEK2 in CHO cells was assessed by confocal immunofluorescence microscopy EGFP-hDlg and HA-MEK2 exhibited a diffuse staining with an occasional patchy appearance and both types of labeling partially colocalized in these patches, suggesting the presence of aggregates (Fig 5A) In addition, the localization of endogenous hDlg and MEK2 was assessed in HEK-293 cells and in hVSMCs In HEK293 cells, hDlg exhibited a general diffuse staining, although this appeared to be stronger in the region of the plasma membrane MEK2 appeared to be more homogenously distributed in the cytoplasm, although the two stains overlapped significantly at cell–cell junctions (Fig 5B) In hVSMCs, both hDlg and MEK2 exhibited a diffuse staining, although overlay revealed a colocalization of the two proteins at some perinuclear location (Fig 5C) Taken together, these results suggest that either transfected or endogenous hDlg and MEK2 partially colocalize in mammalian cells Discussion In the present study, we show, for the first time, the expression of hDlg in the human vascular cell population, which is the most abundant in arterial wall tissue (i.e the hVSMCs) This protein exists in the form of two immunoreactive species in membrane fractions Subcellular localization experiments suggest that, in hVSMCs, this MAGUK is mainly associated with the endoplasmic reticulum, as well as with the FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS 2659 hDlg in ERK cascade O Maıga et al ă WB 150 hDlg hDlg 100 50 100 50 MEK2 MEK2 37 37 C D 150 150 hDlg hDlg 100 50 100 50 MEK2 37 IP: IgG kDa IP: MEK2 WB 150 Lysate IP: IgG1 IP: hDlg kDa B Lysate A MEK2 37 Fig Coimmunoprecipitation of endogenous hDlg and MEK2 proteins in human cells Lysates derived from either HEK-293 cells (A, B) or hVSMCs (C, D) were immunoprecipitated using monoclonal hDlg antibody (A, C), polyclonal MEK2 antibody (B, D) or a control IgG Lysates and immunoprecipitates were subjected to western blotting with hDlg- or MEK2-specific antibodies An experiment representative of three independent ones is shown in each panel microtubular network located both in the cytoplasm and at the cell periphery hDlg has been previously shown to be associated with the endoplasmic reticulum in cultured neurons [17–20], where hDlg is implicated in the trafficking of newly-synthesized receptors, AMPAR and NMDAR, and voltage-gated K+ channel 4.2 from the reticulum to the plasma membrane The interaction of hDlg and various microtubule-associated proteins, such as adenomatous polyposis coli, and the motor proteins kinesin and dynein, has also been previously highlighted in different cell types [19,21,22] In this context, hDlg controls intracellular trafficking and cell polarity during oriented migration Previews studies performed on various tissues outside the vascular system, including the brain, liver and heart, have initially revealed the existence of several isoforms of the hDlg protein, containing various combinations of alternatively spliced insertions: I1A, I1B, I2, I3, I4 and I5 [15,23] More recently, two additional alternative motifs located in the N-terminal region of hDlg have been described, defining the a and b isoforms [14] A CXC motif is present in the a isoform, with both cysteines being potentially palmitoylated, and thus conferring membrane targeting to the protein The b isoform contains a Lin-2,-7 domain that allows 2660 dimerization or interaction with other partners [24] We found that the two isoforms of hDlg expressed in hVSMCs are b-I1A-I1B-I3-I5 and b-I1B-I3-I5 Indeed, Godreau et al [25] have described the presence of two hDlg isoforms expressed in the human atrial myocardium To date, the I1A and I1B insertions are known to form a src-homology binding domain that may, for example, modulate hDlg self-association, whereas the I3 insertion may direct hDlg to the plasma membraneassociated actin cytoskeleton, particularly through interaction with protein 4.1 [15,23,26,27] The presence of an I3 insertion in both hDlg isoforms detected in hVSMCs is thus in agreement with our findings indicating that this scaffold protein partly colocalizes with F-actin at the cell periphery To our knowledge, the potential function(s) of the I5 insertion have not yet been investigated A salient finding of the present study concerns the direct interaction of hDlg with MEK2 Using the PDZ-1-2 domains of hDlg as bait in a yeast twohybrid screening assay, we identified the MAPK MEK2 as a potential, yet unrecognized, interacting partner of hDlg in human aorta PDZ domains are known to associate with a C-terminally-located X-S ⁄ T-X-L ⁄ V motif in their target proteins [8] On the basis of site-directed mutagenesis of both interactants, we confirmed the major involvement of the PDZ-2 domain of hDlg in the interaction with the C-terminal sequence RTAV of MEK2 Furthermore, we observed that hDlg and human MEK2 ectopically expressed in CHO cells partially colocalize in the cytoplasm, thus supporting a direct interaction of the two proteins This interaction was further observed in HEK-293 cells and confluent hVSMCs through coimmunoprecipitation assays performed on endogenous proteins We conducted a phylogenic analysis of the MEK1 and MEK2 amino acid sequence using the Entrez Protein database (http://www.ncbi.nlm.nih.gov/ protein), which revealed a conservation of the MEK2 C-terminal sequence RTAV among mammalian species (human, mouse, rat, cow), thus providing evidence of an important role for this sequence in MEK2 functions By contrast, the C-terminal sequence of MEK1 (i.e AAGV) does not correspond to the PDZ consensus target pattern The results show that MEK2 coimmunoprecipitated with hDlg, whereas MEK1 did not Taken together, these data suggest that the hDlg interaction with MEK2 implicates a functional difference between the two kinases, MEK1 and MEK2 Finally, we raised the hypothesis that hDlg is an upstream, MEK2-specific scaffold protein for the ERK FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS O Maga et al ă hDlg in ERK cascade A hDlg MEK2 Overlay 10 μm B 10 μm Fig Transfected and endogenous hDlg and MEK2 colocalize in mammalian cells (A) CHO cells were cotransfected to express EGFP-hDlg (green signal) and HA-MEK2 (red signal) (B) Confluent HEK-293 cells and (C) subconfluent hVSMCs were stained for endogenous hDlg (green) and MEK2 (red) The colocalization (overlay) was analyzed by confocal microscopy C signaling pathway Zhang et al [28] have previously shown that membrane-associated GK-3, a PDZ domain-containing protein, facilitates lysophosphatidic acid-induced ERK activation by an unknown mechanism [28] To date, ERK is the only known substrate for MEK2 and, according to this function, MEK2 is known to be part of various protein complexes, including Raf, ERK and scaffold proteins, that stabilize the interaction between the ERK cascade members, direct the complexes to proper subcellular localization, and control signal duration [1] Under conditions that allow hDlg and MEK2 coimmunoprecipitation, Raf1 and ERK were not pulled down with hDlg in hVSMCs Nevertheless, a bioinformatics analysis of the hDlg amino acid sequence, using a motif scanning software (http://www.scansite.mit.edu), revealed the presence of one potential ERK1 ⁄ D-docking domain of medium stringency, KRLQIAQLYPISIFI (conserved amino acids are indicated in bold) [29] located in the GK domain of hDlg, suggesting that an hDlg ⁄ ERK interaction may still be expected The highly dynamic nature of D-domain and ERK1 ⁄ interaction may explain why coimmunoprecipitation assays failed to detect any hDlg-ERK1 ⁄ interaction under our experimental conditions No docking site for ERK and FXFP domain, the other well known 10 μm docking-domain for ERK, was found in the hDlg sequence using the same software To more precisely delineate the location of hDlg in the ERK signaling pathway, it will be necessary to identify other members of the hDlg ⁄ MEK2 complex In conclusion, in the present study, we report a previously unidentified interaction between the hDlg scaffold protein and MEK2, a member of the major ERK signaling pathway, in various human cell types, including hVSMCs A number of studies have established the involvement of ERK activation in hVSMC migration and proliferation, as well as in neointimal formation in a model of balloon arterial injury in rats [30,31] Alternatively, the ERK pathway has been recently implicated in the early secretory pathway in HeLa cells [32] It is of note that, during atherosclerosis, hVSMCs adopt an active synthetic phenotype [33] Because hDlg and MEK2 colocalize in the perinuclear area of hVSMCs, and hDlg is associated with the endoplamic reticulum and microtubules, hDlg and MEK2 may together regulate the trafficking of newlysynthesized proteins to the cell periphery Therefore, a better understanding of the role played by hDlg and MEK2 could lead to an improvement of our knowledge about critical signaling events in hVSMC pathophysiology FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS 2661 hDlg in ERK cascade O Maıga et al ¨ Materials and methods Antibodies The antibodies used were: anti-Dlg (sc-9961) from Santa Cruz Biotechnology (Santa Cruz, CA, USA); anti-MEK2 (ab32517), anti-MEK1 (ab32091), anti-Raf1 (ab18761), anticalreticulin (ab2907), anti-GM130 (ab52649), anti-RSK1 p90 (ab32114), anti-N-cadherin (ab18203) and anti-GAPDH (ab9485) from Abcam (Cambridge, MA, USA); antiMEK2 (610236) from BD Biosciences (Franklin Lakes, NJ, USA); anti-a ⁄ b-tubulin (2148), anti-Myc-Tag (2278) and anti-p44 ⁄ 42 MAPK (4695) from Cell Signaling Technology (Beverly, MA, USA); anti-GAL4 activating domain (630402) from Clontech (Palo Alto, CA, USA); anti-HA.11 (MMS-101R) from Covance (Princeton, NJ, USA); peroxidase-conjugated affiniPure goat anti-(rabbit IgG) (111-035144) and anti-(mouse IgG) (115-035-146) from Jackson ImmunoResearch (West Grove, PA, USA); Mouse TrueBlotÒ ULTRA: anti-mouse Ig HRP from eBioscience (Carlsbad, CA, USA); and Alexa FluorÒ488 goat anti-mouse IgG highly cross-adsorbed (A11029) and Alexa FluorÒ555 goat anti-rabbit IgG highly cross-adsorbed (A21429) from Invitrogen (Carlsbad, CA, USA) the pGKBT7 vector (Clontech) and sequenced (GATC Biotech) The pACT2-MEK2 vector that encodes the 179–400 amino acid sequence of the MEK2 C-terminus resulted from the Human Aorta MATCHMAKER cDNA Library (Clontech) To create inactive PDZ domains within the PDZ-1–2 domains, the conserved residues GLGF were mutated to GRRF; similarly, the putative PDZ target sequence, RTAV in the C-terminus of MEK2 was deleted or mutated to RAAV Mutagenesis was performed by PCR using the QuickChangeÒ II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) in accordance with the manufacturer’s instructions The sens mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and RTAV-deleted-MEK2: 5¢-CCCGGCACAC CCTAGCGCACCGCCGT-3¢ The resulting plasmids were sequenced The pEGFPC1-hDlg (b isoform containing the I1B, I3 and I5 insertions) and the pMCL-HA-MEK2 vectors encoding the full-length tagged proteins EGFP-hDlg and HAMEK2 were generous gifts from F Peiretti (INSERM U626, Marseille, France) [35] and N Ahn (University of Colorado, Boulder, CO, USA) [36], respectively RT-PCR assay Total mRNAs from de-endothelialized human pulmonary artery segments were extracted in accordance with a method described previously [34] To evaluate which hDlg isoforms are expressed in the arterial media, cDNAs were submitted to PCR using the PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and specific primers: primers 1, forward: 5¢-GATCTGGTGTAGGCGAGGTCACG-3¢ and reverse: 5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers 2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers 3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse: 5¢-CTGTCTTTCATAGGTCCCAAT-3¢ The RT-PCR products were sequenced (GATC Biotech, Konstanz, Germany) Expression vectors, cDNA library and site-directed mutagenesis cDNAs derived from human mammary arteries were amplified by RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGA TGATGAAATTACAAGGG-3¢, and reverse: 5¢GGATCCA TTCTTCAGGTCGATATTGTGCAAC-3¢ PCR products were subcloned by TA-cloning in the PCR2 vector (Invitrogen) Inserts were digested by EcoR1 and BamH1 (New England Biolabs, Beverly, MA, USA) and introduced into 2662 Yeast two-hybrid screening and yeast protein extraction The yeast reporter strain AH109 was cotransformed by the Human Aorta MATCHMAKER cDNA Library plasmids (Clontech) and the pGKBT7-PDZ-1-2 vector in accordance with the manufacturer’s instructions (Matchmaker TwoHybrid System 3; Clontech) Bait and library fusion protein interactions were selected by plating the yeasts on a histidine, adenine-, leucine- and tryptophan-free medium (SD-LTHA) supplemented with X-a-GAL cDNA clones from positives colonies were isolated using the Yeast Plasmid Isolation Kit from Clontech, used to transform Escherichia coli DH5a bacteria (Invitrogen) and identified by DNA sequencing (GATC Biotech) Yeast proteins were extracted in accordance with the urea ⁄ SDS method according to the MatchMaker II procedure (Clontech) Protein concentration was evaluated in each sample by measuring A280 considering that a mgỈmL)1 protein solution has an A280 of 0.66 Finally, 60 lg of proteins were submitted to western blotting Cell cultures and transient transfections Cells were cultured in an incubator at 37 °C with 5% CO2 CHO and HEK-293 cells were maintained with Ham’s F-12 and DMEM high glucose medium (Invitrogen), respectively, supplemented with 10% fetal bovine serum (PAA Laboratories, Pasching, Austria) and the antibiotic cocktail (PAA Laboratories): penicillin (5 mL)1), streptomycin FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ê 2011 FEBS O Maga et al ă hDlg in ERK cascade (0.5 lgỈmL)1) and amphotericin B (25 ngỈmL)1) CHO cells were transfected with the pEGFPC1-hDlg and the pMCL-HA-MEK2 vectors using Fugene reagent (Roche Diagnostics, Basel, Switzerland) in accordance with the manufacturer’s instructions Human lung tissues were obtained from patients who had undergone surgery for lung carcinoma at Bichat Hospital (Paris, France) Segments of pulmonary artery were dissected from macroscopically normal regions of the diseased lungs and arterial media samples were digested with 0.3% (w ⁄ v) collagenase (Sigma, St Louis, MO, USA) and 0.05% (w ⁄ v) pancreatic elastase (Sigma) for h at 37 °C Isolated hVSMCs were cultured in Smooth Muscle Cell Basal medium (Promocell, Heidelberg, Germany) supplemented with the Smooth Muscle Cells Growth Medium kit (Promocell) and the antibiotic cocktail Human internal mammary arteries were obtained from patients undergoing coronary bypass surgery in the Department of Cardiovascular Surgery at Bichat Hospital All experiments involving the use of human tissues and cells were approved by the INSERM Ethics Committee, in conformity with Helsinki standards, with these tissues being considered as surgical waste in accordance with French Ethical Laws (L.1211-3-L.1211-9) Written consent was obtained from each patient labeled with the appropriate Alexa FluorÒ fluorochromeconjugated secondary antibody F-actin was stained with Alexa FluorÒ 633conjugated phalloidin (Invitrogen) Finally, slides were mounted in DAKOCytomation Fluorescent Mouting Medium (Dako, Glostrup, Denmark) and cells were imaged using a confocal microscope (LSM510 META; Carl Zeiss, Oberkochen, Germany) Cell lysate fractionation Western blotting Arterial pulmonary hVSMCs were lysed in mL of 10 mm Tris-HCl, 150 mm NaCl, mm EDTA (pH 7.4) supplemented with Protease Inhibitor Cocktail (P8340) (Sigma) by two freeze ⁄ thaw cycles Lysates were preclarified by centrifugation at 800 g for 15 at °C Half the volume (1 mL) was kept as total lysate, whereas the other half was submitted to an ultracentrifugation (105 000 g) for h at °C The resulting pellets (membrane fraction) were resuspended in mL of lysis buffer supplemented with 1% (v ⁄ v) Triton X-100 The supernatants corresponded to the cytosolic fraction Protein concentrations were determined in each sample using the BCA Protein Assay (Pierce, Rockford, IL, USA) Finally, the same volumes of all three fractions, corresponding to 20 lg of proteins in the total lysates, were submitted to western blotting Samples in Laemmli buffer were separated by SDS ⁄ PAGE Proteins were then transferred onto nitrocellulose membranes (AmershamÔHybondÔECL; Amersham Bioscience, Little Chalfont, UK), membranes were blocked with NaCl ⁄ Tris-Tween containing 5% (w ⁄ v) skimmed milk or BSA for h at room temperature, incubated overnight with the primary antibody at °C and, finally, with the suitable secondary antibody coupled with peroxydase Immune complexes were revealed by enhanced chemiluminescence (ECL+; Amersham Bioscience) and vizualized by exposure to films (Amersham HyperfilmÔECL; Amersham Bioscience) Immunocytochemistry Cells were grown on four-chamber Permanox Lab-Tek slides (Nalgene Nunc Corp., Rochester, NY, USA) coated (HEK-293) or not (hVSMCs and CHO) with fibronectin Cells were fixed with 3.7% (w ⁄ v) paraformaldehyde for 15 min, permeabilized with 0.1% (v ⁄ v) Triton X-100 for and blocked with 1% (w ⁄ v) BSA Wells were then incubated with the suitable primary antibody for h at room temperature Negative control staining was performed using nonrelevant IgG or whole rabbit serum Cells were Immunoprecipitation Cells were lysed with 1% (v ⁄ v) Igepal CA-630, 20 mm TrisHCl, 75 mm NaCl (pH 6.8) [35], supplemented with Protease Inhibitor Cocktail and Phosphatase Inhibitor Cocktail and (Sigma) Lysates were preclarified by centrifugation (15 000 g at °C for 15 min) Immunoprecipitation was performed by incubating 600 lg of proteins with lg of antibody for h at °C Irrelevant IgG were used as controls Magnetic beads (30 lL; Ademtech, Pessac, France) coupled with Protein A or to Protein G were used to precipitate the immunocomplexes in accordance with the manufacturer’s instructions Immunoprecipitates were finally eluted from the beads by boiling for in a SDS ⁄ PAGE buffer containing bmercaptoethanol Samples were submitted to western blotting Immunohistochemistry Serial frozen sections of human mammary artery were fixed with acetone and treated with 3% (v ⁄ v) H2O2 in deionized H2O to quench endogenous peroxydase activity Nonspecific binding was blocked with NaCl ⁄ Tris containing 0.02% (v ⁄ v) Tween 20 and 0.06% (w ⁄ v) casein (Sigma) Slides were incubated for 90 at room temperature with hDlg antibody or an irrelevant IgG1 as control Labeling of the primary antibody was carried out using an appropriate biotinylated secondary antibody (Vectastain ABC complex; Vector Laboratories, Inc., Burlingame, CA, USA) and staining was obtained using the DAB substrate chromogen system (Dako) Sections were counterstained with Mayer’s haematoxylin (Sigma) FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS 2663 hDlg in ERK cascade O Maıga et al ¨ Acknowledgements The authors are grateful to Xavier Norel and the laboratory of Anatomy and Pathological Cytology, CHU X, Bichat, for providing the pulmonary tissues We would also like to thank Mary Pellegrin-Osborne for her kind editorial assistance 14 15 References Kolch W (2005) Coordinating ERK ⁄ MAPK signalling through scaffolds and inhibitors Nat Rev Mol Cell Biol 6, 827–837 Ramos JW (2008) The regulation of extracellular signalregulated kinase (ERK) in mammalian cells Int J Biochem Cell Biol 40, 2707–2719 Pouyssegur J, Volmat V & Lenormand P (2002) Fidelity and spatio-temporal control in MAP kinase (ERKs) signalling Biochem Pharmacol 64, 755–763 Raman M, Chen W & Cobb MH (2007) Differential regulation and properties of MAPKs Oncogene 26, 3100–3112 Teis D, Wunderlich W & Huber LA (2002) Localization of the MP1-MAPK scaffold complex to endosomes is mediated by p14 and required for signal transduction Dev Cell 3, 803–814 Vaidyanathan H, Opoku-Ansah J, Pastorino S, Renganathan H, Matter ML & Ramos JW (2007) ERK MAP kinase is targeted to RSK2 by the phosphoprotein PEA-15 Proc Natl Acad Sci USA 104, 19837–19842 Funke L, Dakoji S & Bredt DS (2005) Membrane-associated guanylate kinases regulate adhesion and plasticity at cell junctions Annu Rev Biochem 74, 219–245 Jelen F, Oleksy A, Smietana K & Otlewski J (2003) PDZ domains – common players in the cell signaling Acta Biochim Pol 50, 985–1017 Round JL, Humphries LA, Tomassian T, Mittelstadt P, Zhang M & Miceli MC (2007) Scaffold protein Dlgh1 coordinates alternative p38 kinase activation, directing T cell receptor signals toward NFAT but not NF-kappaB transcription factors Nat Immunol 8, 154–161 10 Laprise P, Viel A & Rivard N (2004) Human homolog of disc-large is required for adherens junction assembly and differentiation of human intestinal epithelial cells J Biol Chem 279, 10157–10166 11 Leonoudakis D, Mailliard W, Wingerd K, Clegg D & Vandenberg C (2001) Inward rectifier potassium channel Kir2.2 is associated with synapse-associated protein SAP97 J Cell Sci 114, 987–998 12 Murata M, Buckett PD, Zhou J, Brunner M, Folco E & Koren G (2001) SAP97 interacts with Kv1.5 in heterologous expression systems Am J Physiol Heart Circ Physiol 281, H2575–H2584 13 Godreau D, Vranckx R, Maguy A, Rucker-Martin C, Goyenvalle C, Abdelshafy S, Tessier S, Couetil JP & 2664 16 17 18 19 20 21 22 23 24 25 Hatem SN (2002) Expression, regulation and role of the MAGUK protein SAP-97 in human atrial myocardium Cardiovasc Res 56, 433–442 Schluter OM, Xu W & Malenka RC (2006) Alternative N-terminal domains of PSD95 and SAP97 govern activity-dependent regulation of synaptic AMPA receptor function Neuron 51, 99–111 McLaughlin M, Hale R, Ellston D, Gaudet S, Lue RA & Viel A (2002) The distribution and function of alternatively spliced insertions in hDlg J Biol Chem 277, 64066412 Ishidate T, Matsumine A, Toyoshima K & Akiyama T (2000) The APC-hDLG complex negatively regulates cell cycle progression from the G0 ⁄ G1 to S phase Oncogene 19, 365–372 Sans N, Racca C, Petralia RS, Wang YX, McCallum J & Wenthold RJ (2001) Synapse-associated protein 97 selectively associates with a subset of AMPA receptors early in their biosynthetic pathway J Neurosci 21, 7506–7516 Mauceri D, Cattabeni F, Di Luca M & Gardoni F (2004) Calcium ⁄ calmodulindependent protein kinase II phosphorylation drives synapse-associated protein 97 into spines J Biol Chem 279, 23813–23821 Jeyifous O, Waites CL, Specht CG, Fujisawa S, Schubert M, Lin EI, Marshall J, Aoki C, de Silva T, Montgomery JM et al (2009) SAP97 and CASK mediate sorting of NMDA receptors through a previously unknown secretory pathway Nat Neurosci 12, 1011–1019 Gardoni F, Mauceri D, Marcello E, Sala C, Di Luca M & Jeromin A (2007) SAP97 directs the localization of Kv4.2 to spines in hippocampal neurons: regulation by CaMKII J Biol Chem 282, 28691–28699 Manneville JB, Jehanno M & Etienne-Manneville S (2010) Dlg1 binds GKAP to control dynein association with microtubules, centrosome positioning, and cell polarity J Cell Biol 191, 585–598 Etienne-Manneville S, Manneville JB, Nicholls S, Ferenczi MA & Hall A (2005) Cdc42 and Par6-PKCzeta regulate the spatially localized association of Dlg1 and APC to control cell polarization J Cell Biol 170, 895–901 Lue RA, Marfatia SM, Branton D & Chishti AH (1994) Cloning and characterization of hDlg: the human homologue of the Drosophila discs large tumor suppressor binds to protein 4.1 Proc Natl Acad Sci USA 91, 9818–9822 Doerks T, Bork P, Kamberov E, Makarova O, Muecke S & Margolis B (2000) L27, a novel heterodimerization domain in receptor targeting proteins Lin-2 and Lin-7 Trends Biochem Sci 25, 317–318 Godreau D, Vranckx R, Maguy A, Goyenvalle C & Hatem SN (2003) Different isoforms of synapse-associated protein, SAP97, are expressed in the heart and have distinct effects on the voltage-gated K+ channel Kv1.5 J Biol Chem 278, 47046–47052 FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ê 2011 FEBS O Maga et al ă 26 Lue RA, Brandin E, Chan EP & Branton D (1996) Two independent domains of hDlg are sufficient for subcellular targeting: the PDZ1-2 conformational unit and an alternatively spliced domain J Cell Biol 135, 1125–1137 27 Hanada T, Takeuchi A, Sondarva G & Chishti AH (2003) Protein 4.1-mediated membrane targeting of human discs large in epithelial cells J Biol Chem 278, 34445–34450 28 Zhang H, Wang D, Sun H, Hall RA & Yun CC (2007) MAGI-3 regulates LPA-induced activation of Erk and RhoA Cell Signal 19, 261–268 29 Enslen H & Davis RJ (2001) Regulation of MAP kinases by docking domains Biol Cell 93, 5–14 30 Muslin AJ (2008) MAPK signalling in cardiovascular health and disease: molecular mechanisms and therapeutic targets Clin Sci (Lond) 115, 203–218 31 Gennaro G, Menard C, Michaud SE, Deblois D & Rivard A (2004) Inhibition of vascular smooth muscle cell proliferation and neointimal formation in injured arteries by a novel, oral mitogen-activated protein kinase ⁄ extracellular signal-regulated kinase inhibitor Circulation 110, 3367–3371 32 Farhan H, Wendeler MW, Mitrovic S, Fava E, Silberberg Y, Sharan R, Zerial M & Hauri HP (2010) MAPK signaling to the early secretory pathway revealed by kinase ⁄ phosphatase functional screening J Cell Biol 189, 997–1011 33 Rudijanto A (2007) The role of vascular smooth muscle cells on the pathogenesis of atherosclerosis Acta Med Indones 39, 86–93 hDlg in ERK cascade 34 Chomczynski P & Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Anal Biochem 162, 156–159 35 Peiretti F, Deprez-Beauclair P, Bonardo B, Aubert H, Juhan-Vague I & Nalbone G (2003) Identification of SAP97 as an intracellular binding partner of TACE J Cell Sci 116, 1949–1957 36 Skarpen E, Flinder LI, Rosseland CM, Orstavik S, Wierod L, Oksvold MP, Skalhegg BS & Huitfeldt HS (2008) MEK1 and MEK2 regulate distinct functions by sorting ERK2 to different intracellular compartments FASEB J 22, 466–476 Supporting information The following supplementary material is available: Fig S1 Nucleotide and deduced amino acid sequences of the RT-PCR products obtained for hDlg alternative splice form determination Fig S2 Coimmunoprecipitation of endogenous hDlg and the members of the ERK cascade in hVSMCs This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS 2665 ... Polymerase (Invitrogen) and the primers: PDZ-1 -2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGA TGATGAAATTACAAGGG-3¢,... ribosomal protein S6 kinase 2, a direct substrate of ERK, thereby enhancing the activation of this latter kinase [6] Human disc-large homolog (hDlg) is a member of the membrane-associated guanylate... ERK cascade O Maga et al ă Introduction The mitogen-activated protein kinases (MAPKs) are a family of S ⁄ T -protein kinases, including p38, c-Jun N-terminal kinase and extracellular signal-responsive