... is an acronym for SQLPhrase Index. It is a standalone search engine, although it integrates nicely with MySQL and otherdatabases for fetching the data thatit then indexes. Sphinx is intended ... functionality, more and more webapplications and services are available and required. These applications and services are replac-ing traditional desktop applications and legacy ways of doing things; ... Maria Storage Engine as the default storage engine. The goal of MariaDB is to keep up with MySQL development and maintain user compatibility, butalso to keep improving the database and adding...
... Richard Braun, Dante Amengual, Stefano Puddu, and seminar participants at CNMV; VI Seminar on Risk, Financial Stability, and Banking of the Banco Central do Brasil; XIX Finance Forum (Granada, 2011); ... deviations between CDS and bond spreads?Suppose that an investor buys a bond at its par value witha maturity equal to T years anda yield-to-maturity equal to ytm. Also, assume that at the ... cumulative trading prof-its witha declining time-averaged variance anda probability of loss that converges to zero as time passes. Bearing in mind that within the logic of this methodology the existence...
... What accents itself inthe mind of the layman who makes even a cursory study of the sculptors andtheir works at the Panama-Pacific International Exposition is the fine, inspiring sincerity and ... previous Expositions, but it goes hand in hand withthe architecture, poignantly existing for its own sake and adding greatly to the decorative architectural effects. In many cases the architecture ... far reaching. The mind that loves this art and understands its language will more and more insist on a certain order and decorum in visual life. It opens an avenue for the expression of aesthetic...
... of amino acids 23, 26 and 27 completely abolishedinteraction with GalDBD-AR.LBD and alanines at posi-tions 24 and 25 increased the interaction capacity. Allalanine substitutions of amino acids ... the 23FQNLF27motif in AR N/C interaction, these amino acidswere substituted by 24/25AA. In both the yeast and mammalian protein interaction assay, GalAD-AR.NTD24/25AA and AR.NTD24/25AA formed evenmore active ... betweenboth assays is the coupling of AR.NTD to GalAD in the yeast assay, andthe absence of a second transactivationdomain linked to AR NTD inthe mammalian assay. The latter assay completely...
... to separate, but was not inflamed and appeared normal despite being intact. I reassured Mother that this was OK, provided information about what was normal/abnormal and advised her thatthe "stump" ... to their routine as a hospitalisation would be necessary. For myself as a nurse, it was paramount that Jack be fed safely, maintain his weight and have some 'quality of life'. (Quality ... aneedanda demand for the specialty area. • The focus of the specialty is a defined population or a defined area of activity which provides a major support service within the discipline and...
... 2). Data providing information about the amountof soluble produced protein was obtained from the SDS ⁄ PAGE and western blotting analyses and com-pared withthe data obtained when analyzing the ... ACACCC-ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 wasamplified. TEHA3: ACACAGATCTCTGCAGTGAAATG-AGCTGTTGACAATTA and TEHA4: ACACCCATGGT-CTGTTTCCTGTG were used for trc amplification. The exact nucleotide sequence of each promoter ... GGGATGTTGAAACGCTTGTTG and GFP6_R: CGGTCACGAACTCCAGCAG,respectively. The input of total RNA was 2 lg. A mixturecontaining total RNA, dNTPs (Invitrogen, Carlsbad, CA,USA) and 5 pmol of each...
... horns played several tunes adapted to the day, anda recruiting party drawn up before the doors with drums and fifes playing at intervals had a very pleasing effect." In 1667 a London and ... house was illuminated ina very elegant manner with variegated lamps, the principal figure in which was the letters 'G.R.' immediately over the coat-of-arms. A band of music with horns ... Oxford Coach was[Pg 24] performing the 54 miles between the two cities in two days, halting for the intervening night at Beaconsfield: andinthe same year the original Bath Coach was the subject...
... wasadded for the standard TH assay, and 0.02% SDS wasadded for DO activity. For dopa titration, 50 lL10mmsodium periodate was added, andthe increase in A 475immediately determined. A small ... multipotent lac-case anda tyrosinase in Marinomonas mediterranea[11,13].We have now found in R. solanacearum thatthe twotyrosinase-like genes andthe laccase-like gene areindeed expressed ... wild-type and mutated R. sol-anacearum strains to carboxylated ⁄ decarboxylated substrates using the L-tyrosine ⁄ tyramine and L-dopa ⁄ dopamine pairs. Kinetic parame-ters are summarized in Table...
... walk. The database is a set of definite clauses. Predicates used inthe constraints and predicates that appear inthe bodies of the definite clauses inthe database should have their definition ... Translating a Unification Grammarwith Disjunctions into Logical Constraints Mikio Nakano and Akira Shimazu* NTT Basic Research Laboratories 3-1 Morinosato-Wakamiya, Atsugi 243-0198 Japan ... reason we have chosena unification-based approach is that it enables us to describe grammar declaratively, making the development and amendment of grammar easy. Analysis systems that are...
... withthe results ofHasegawa et al. [13] who questioned the paraphyly of the order rodentia using the same data as Graur. In contrast, the distance matrix algorithms again placed the guinea pigtogether ... synthesis an adapter comprising the T7promoter sequence combined witha NotIandaSmaIsitewas ligated to both ends of the cDNA pool. Using a combination of a primer complementary to the adapter(adapter ... preprotein witha calculated molecular mass of 57.7 kDa. An arrowheadindicates the presumptive cleavage site for the mitochondrial matrix associated protease. Numbers on the left denote amino acids,...
... is also another characteristic of the grammar formalism. One also sees thatthe grammar is declarative in nature, and thus it is interpretable both for analysis and for generation (for example, ... rules inagrammar forms a formal grammar, ie. it defines a language, in fact two languages, one of strings andthe other of trees. At the moment, there is no large applications of the STCG, ... methodological issues in machine transla- tion of natural languages, COLGATE Universit~ New York, August 1985. [Zaharin 86] Zaharin Y. "Strategies and heuristics inthe analysis of a natural...