find the maximum value and return a pointer to it

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... subjected to TSA treatment, we used a chromatinimmunoprecipitation assay (ChIP) and evaluated the acetylation status of the so-called B- and nucleosome F [4] and compared these patterns with the M13 ... 2004genes. The studies have revealed that both histone acetyl-transferases (HATs) and histone deacetylases (HDACs)play a vital role in gene regulation by either allowingtranscription or establishing ... earlyaddition of TSA. In this case, the nucleosome B area isdistinctly hypersensitive to MNase action, especially at highconcentrations. Late addition of TSA, on the other hand,had virtually...

Money and happiness a guide to living the good life

Danh mục: Tâm lý - Nghệ thuật sống

... a road map to wealth with practical financial tools and positive strategies for creating the good life” in a personally mean-ingful way. It looks at how to identify our authentic values and ... drew a line in the sand and said, ‘We’re in debt and we’re not going to get into any more debt.’ It was a tense time. My husband wasn’t happy about it, and the childrenwere not initially happy about ... book to help you figure out the values and qualities on which you want to baseyour life, and how money can become a tool to facilitate that reality.2 MONEY AND HAPPINESSJulie earns $34,000 a...

T-Shirts and Suits A Guide to the Business of Creativity pptx

Danh mục: Tài chính doanh nghiệp

... in a pure way, free of the constraints and pressures of business. Perhaps it is better to separate earning a living on the one hand and creativity on the other so as to do each one to the ... need to assess our assets, reputation, knowledge of the market and intellectual capital. Evaluating Strengths and Weaknesses Rather than simply attempting to write down all the strengths and ... more than the sum total of individuals’ expertise and belongs to the organisation rather than (or as well as) the people working within it. In a creative enterprise, constant learning and the...

The Idea Hunter: How to Find the Best Ideas and Make them Happen

Danh mục: Quản trị kinh doanh

... capacity to find great ideas and putthem into play.”—Michael Raynor, director, Deloitte ConsultingLLP, and author, The Strategy Paradox and The about innovation and what it takes to be an ‘ideaperson.’ ... over the past century.There’s a larger point about the value of ideas big and smal. It has to do with the profound differencebetween a thing and an idea, between a mereobject and a creative act. ... is, to no smal degree, a measure of attitude, of the realization that the best ideas exist outside ofyour brain and are there for the taking.So let the learning and the unlearning—begin.—Andynot...

Postal banking in the United States and Japan: a comparative analysis docx

Danh mục: Ngân hàng - Tín dụng

... that a postal bank can play a beneficial role as an alternative to mandatory insurance for household deposits. This was,in fact, the reasoning that led postal savings to be accepted in the United ... postal savings bank. Advocates invariably cited the predicament of rural citizens who lived many miles from a bank, and the lack of savingsfacilities available in certain regions, particularly the ... justification of postal savings – in the United States as well as in Japan and Europe– it has not proved to be the major source of demand for postal savings, even if it wasimportant to a few rural...

Báo cáo khoa học: "A CONSIDERATION ON THE CONCEPTS STRUCTURE AND LANGUAGE IN RELATION TO SELECTIONS OF TRANSLATION EQUIVALENTS OF VERBS IN MACHINE TRANSLATION SYSTEMS" doc

Danh mục: Báo cáo khoa học

... standpoint and take natural categories of nouns (concepts) as a base and associate to it through case relation pairs of a verb and its translation equivalent. Let a structure of natural categories ... conceptual category, ,numbers of associated pairs of verb and its translation equivalent are generally small and can easily be found. (3) Association of the pair of verb and its translation ... group to which we associate the translation equivalent. In this manner, we can find pairs of verb and its translation equivalent for any noun belonging to a given category. To summarize the advantage...

Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part1 pot

Danh mục: Kế toán - Kiểm toán

... Financial audits attest to the fairness of the financial statements of agencies. Theyexamine the adequacy of the financial records and accounting and internal controls, and they determine the ... facilities and communitycorrectional centers.Additionally, the department contracts with the Correctional Corporationof America and Dominion Management to house Hawaii inmates inOklahoma and ... the Auditor exercises no control function, and its authority is limited to reviewing, evaluating, and reporting on its findings and recommendations to the Legislature and the Governor. THE AUDITORSTATE...

Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part2 docx

Danh mục: Kế toán - Kiểm toán

... an ACO to work overtime,he/she asks the ACOs from the previous watch to fill the vacant post. At the larger facilities (Halawa Correctional Facility and Oahu CommunityCorrectional Center) the ... federal and state laws, rules and regulations, and policies and procedures.3. To make recommendations as appropriate.We audited the financial records and transactions and reviewed the related systems ... Also, the average overtimecompensation for all employees at all facilities averaged $4,710 for the fiscal year ended June 30, 2001. The department was not aware of the situation and was unable to...

Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part3 pot

Danh mục: Kế toán - Kiểm toán

... 2001.Except as discussed in the preceding paragraph, we conducted our auditin accordance with auditing standards generally accepted in the UnitedStates of America and the standards applicable to financial ... versionwww.adultpdf.com23Chapter 3: Financial Audit The AuditorState of Hawaii:We have audited the combined financial statements of the Department ofPublic Safety, State of Hawaii (department), as of and for the ... back to the department because the Judiciary was not able to locate the victim.These payments were credited back to the inmates’ accounts.In addition, facility and fiscal staff informed us that...

Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part4 pptx

Danh mục: Kế toán - Kiểm toán

... estimates and assumptions thataffect the reported amounts of assets and liabilities and disclosures ofcontingent assets and liabilities at the date of the combined financialstatements and the reported ... described above is a materialweakness.This report is intended solely for the information and use of the Auditor,State of Hawaii, and the management of the department and is notintended to be and ... the StateLegislature that permit a state agency, within established fiscal and budgetary controls, to incur obligations and to make expenditures.Appropriations are allotted quarterly. The allotted...

Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part5 pptx

Danh mục: Kế toán - Kiểm toán

... Statebelieves that, given the inherent variability in any such estimates, the reserves are within a reasonable and acceptable range of adequacy.Reserves are continually monitored and reviewed, and as settlements ... required to contribute to both options at an actuarially determined rate.Measurement of assets and actuarial valuations are made for the entireERS and are not separately computed for individual participatingemployers ... issues a publicly available financial report that includes financial statements and required supplementary information. The report may be obtained bywriting to the ERS at City Financial Tower,...

Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part6 pot

Danh mục: Kế toán - Kiểm toán

... level. It is the Wardens' responsibility to ensure that theirwatch commanders are making appropriate decisions.Patterns of Absence Due to Sickness Program The audit report states that the ... must find another woman to fill the vacancy,even if that woman will be on overtime, and even if there is a male ACO availableon regular time. On the Big Island, the HCCC transports inmates from ... certainlevel of coverage to maintain security and safety.” The department notesthat some facilities, especially the Women’s Community CorrectionalCenter and the Hawaii Community Correctional...

Financial Audit of the Department of Public Safety A Report to the Governor and the Legislature _part7 ppt

Danh mục: Kế toán - Kiểm toán

... unfortunately the reality. We are fully aware of the problem and of what it will take to arrive at a solution, and we are making every effort to address it. Nevertheless, we are pleased to report that ... ofovertime that the ACO has already worked. The Department worked with the UPWon the procedures for assigning overtime work on a fair and equitable basisfor the larger facilities, Oahu Community Correctional ... and Maui Community Correctional Center (MCCC). In addition,Kulani and Kauai Community Correctional Center have historically had lowerrates of overtime. The Wardens at these facilities have been...

Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Danh mục: Hóa học - Dầu khí

... AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUANS/1 6A( 5U) AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUANS/1 6A( 6U) AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUAPB2 AGCAGUAGCAAGAGGAUUUUUAPB2/6U ... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAAUUGUCUCAA(UCA)NP AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUCUGACUUUAAUUUUCUCCAGGAAUGUUG(CUA)M AGCAGUAGCAAGGGGAUUUUUUCAAGGUAA(UUA)NSbAGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAA(UUA) a ... AGCAGUAGCAAGAGGAUUU(UUA)PB1 AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAGCCCCUCC(UCA)P3 AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA)HEF AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAAUUGUCUCAA(UCA)NP...