0

integrating complementary and conventional care using quality use of medicines as a framework

Animal waste utilization   effective use of manure as a soil resource

Animal waste utilization effective use of manure as a soil resource

Môi trường

... valid cases This rate varied between kg/ha (a situation where a small amount of manure only was applied) and 1,524 kg/ha (a situation where a field came out of alfalfa, a very large amount of ... capacity as a standard manufacturing requirement This lack of standardization for manure spreaders has forced on farmers the additional task of acquiring a weight calibration for their spreaders ... understanding of manure generation and utilization as a soil resource Manure is often considered to be a cropland resource; however, application to rangeland and grass pasture is often practiced...
  • 319
  • 5,613
  • 0
Báo cáo y học:

Báo cáo y học: " Cystitis due to the use of ketamine as a recreational drug: a case report" pot

Báo cáo khoa học

... urine analysis and urine cytology were negative and a urine culture was sterile An ultrasound examination revealed a thickened bladder wall and a small bladder capacity but normal kidneys Cystoscopy ... ketamine is being used increasingly as a recreational drug we expect ketamine-associated cystitis to become more prevalent in young adults Health care workers should be aware of the problem and ... hydroxynorketamine can be measured in high quantities in the urine of patients using ketamine [6] It is possible that ketamine and its active metabolites cause significant bladder irritation Conclusion As...
  • 3
  • 391
  • 0
Child and Dependent Care Expenses For use in preparing 2012 Returns Get potx

Child and Dependent Care Expenses For use in preparing 2012 Returns Get potx

Ngân hàng - Tín dụng

... children, Anne and Andy, ages and who attend a daycare facility licensed and regulated by the state Randall's work-related expenses are $6,000 for the year Randall's employer has a dependent care assistance ... legally separated under a decree of divorce or separate maintenance, are separated under a written separation agreement, or lived apart at all times during the last months of the calendar year, ... school that provides lunch and a few educational activities as part of its preschool childcare service The lunch and educational activities are incidental to the childcare, and their cost cannot...
  • 18
  • 366
  • 0
báo cáo hóa học:

báo cáo hóa học: " Patient satisfaction with primary care: an observational study comparing anthroposophic and conventional care" pptx

Hóa học - Dầu khí

... "continuity and cooperation", and six questions addresses "facilities, availability and accessibility" Data management and data analysis All data were recorded using a relational database Forms ... view of the concept of quality of health care focusing on structure, process and outcome of care [1], patient satisfaction is part of the treatment result and at the same time a good indicator of ... measures (such as health status, quality of life or costs) in measuring the quality of general practice care [3,4] The increased use of complementary and alternative medicine (CAM) in the Western...
  • 15
  • 383
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Comparative analysis of heart functions in micropigs and conventional pigs using echocardiography and radiography" docx

Báo cáo khoa học

... snoitcnuf caidrac lacigoloisyhp derusaem eht wohs 5-3 selbaT lamron yllarutcurts erew slamina lla fo straeh ehT slamina lla ni deniatbo ylisae saw weiv rebmahc-5 lacipa ehT yhpargoidracohce lanoisnemid-owt ... stnemirepxe lamina llA slaminA sdohteM dna slairetaM noitaplap naht setamirp namuhnon ni stfargonex rof snoitcnuf caidrac giporcim gnissessa rof dohtem evitisnes erom hcum a si yhpargoidracohce taht wohs ... ± naem a sa desserpxe era seulav derusaem eht fo llA sisylana lacitsitatS ytilauq lamitpo eht fo gnieb sa dedrager stnemerusaem laitneuqes evif ot eerht morf eulav naem eht era gip hcae rof snoitaluclac...
  • 8
  • 309
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " A Process monitoring in intensive care with the use of cumulative expected minus observed mortality and risk-adjusted p charts" ppt

Báo cáo khoa học

... outcome and length of stay for admissions to adult, general critical care units in England, Wales and Northern Ireland: the Intensive Care National Audit & Research Centre Case Mix Programme Database ... be familiar to critical care clinicians Potentially, the effects on mortality of both random effects and unmeasured factors (such as the quality of care) can be teased out By continuous real-time ... deterministic because random effects and unmeasured factors, such as the effect of the quality of the process of care, contribute to outcome for an individual patient [3] A validated model that accurately...
  • 9
  • 305
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Identifying Agreement and Disagreement in Conversational Speech: Use of Bayesian Networks to Model Pragmatic Dependencies" docx

Báo cáo khoa học

... classification (BACKCHANNEL and OTHER are merged) using hand-labeled data of a single meeting as a test set and the remaining data as training material; for this experiment, we used the same training ... cross-validation in a four-way classification task, at each step retaining the hand-labeled data of a meeting for testing and the rest of the data for training Table summarizes the performance of ... (Ravichandran et al., 2003) that compares maximum entropy classification and re-ranking on a question answering task Table Speaker ranking features Feature sets Baseline Structural Durational...
  • 8
  • 497
  • 0
Postal Savings and the Provision of Financial Services: Policy Issues and Asian Experiences in the Use of the Postal Infrastructure for Savings Mobilization pdf

Postal Savings and the Provision of Financial Services: Policy Issues and Asian Experiences in the Use of the Postal Infrastructure for Savings Mobilization pdf

Ngân hàng - Tín dụng

... Holland, Great Britain and France gave an international scope to postal operations as their merchant fleets carried mail as well as cargo to ports in Asia, Africa and the Middle East With the advance ... the savings facility takes the form of a national savings organization (NSO), as in Bangladesh and India, or national savings bank (NSB), as in Malaysia and Sri Lanka Principal-Agent relationships, ... DESA with information: Algeria, Brazil, Cameroon, Cape Verde, Iraq, Ireland, Israel, Kenya, Democratic People’s Republic of Korea, Libyan Arab Jamahiriya, Madagascar, *Malaysia, Mali, Namibia,...
  • 38
  • 645
  • 3
Báo cáo khoa học:

Báo cáo khoa học: "Early results on the use of biomaterials as adjuvant to abdominal wall closure following cytoreduction and hyperthermic intraperitoneal chemotherapy" ppt

Báo cáo khoa học

... (Table 2) Patients’ mean age was 59.7 years (36-80), M: F ratio was 1:1 and the origin of the primary malignant disease was colorectal (n = 4), appendiceal (n = 2) and ovarian (n = 2) All patients ... CRS and HIPEC enabled the repair of concomitant abdominal wall hernias and facilitated liberal resection of abdominal wall tumors Biomaterial mesh prevented evisceration on repeat laparotomy and ... chemotherapy and the bowel is usually firmly adherent to the abdominal with associated evisceration and/ or the formation of enterocutaneous fistulae The use of synthetic mesh as adjuvant to abdominal...
  • 7
  • 382
  • 0
báo cáo khoa học:

báo cáo khoa học: " User’s perspectives of barriers and facilitators to implementing quality colonoscopy services in Canada: a study protocol" pps

Báo cáo khoa học

... Canada 5Department of Medicine, Université Laval, Québec, Canada 6Canadian Partnership Against Cancer, Québec, Canada 7University of Calgary, Calgary, Alberta, Canada Authors’ contributions All authors ... be barriers and/ or facilitators to implementation of quality colonoscopy services, and they must include a measurement of quality outcomes Screening and data abstraction All titles and abstracts ... miss rate for adenomas was 24% overall, 27% for adenomas less than mm, 13% for adenomas ranging from to mm, and 6% for adenomas of cm and more A Manitoba retrospective study of 36,000 individuals...
  • 9
  • 337
  • 0
Báo cáo y học:

Báo cáo y học: " Previous hospital admissions and disease severity predict the use of antipsychotic combination treatment in patients with schizophrenia" pps

Báo cáo khoa học

... OAA and LT have received a speaker’s honorarium from Astra-Zeneca, GlaxoSmithKline, Janssen-Cilag and Bristol Myers Squibb LT has also received a speaker’s honorarium from Sanofi-Aventis IM have ... mental illness Acta Psychiatric Scand 2008, 118:297-304 16 Birkenaes AB, Søgaard AJ, Engh JA, Jonsdottir H, Ringen A, Vaskin A, et al: Sociodemographic Characteristics and Cardiovascular Risk Factors ... is that the prevalence of antipsychotic combination treatment increased with number of hospital admissions, severity of the disease as measured with PANSS, and level of dysfunction, as measured...
  • 7
  • 332
  • 0
Báo cáo y học:

Báo cáo y học: "Co-existence of a giant splenic hemangioma and multiple hepatic hemangiomas and the potential association with the use of oral contraceptives: a case report" potx

Báo cáo khoa học

... Walter J, Orlow SJ, Marchuk DA: Familial segregation of hemangiomas and vascular malformations as an autosomal dominant trait Arch Dermatol 1998, 134:718-722 Meera AV, Sen S, Raghupathy P, Walter ... and Yamamoto et al [4] highlight the efficacy of angiography and arterial embolism in the diagnosis and treatment of hemangiomas The MRI appearance of splenic hemangiomas has been described as ... similar to that of hepatic hemangiomas However, larger hemangiomas may have a variable MRI pattern because of complicating features such as hemorrhage, infarction and thrombosis Differentiation of...
  • 5
  • 384
  • 0
Báo cáo y học:

Báo cáo y học: " Network, degeneracy and bow tie. Integrating paradigms and architectures to grasp the complexity of the immune system" pps

Báo cáo khoa học

... dynamics of the mammalian MAPK1,2 signaling network: bifan motif regulation of C-Raf and B-Raf isoforms by FGFR and MC1R FASEB J 2008, 22:1393-1403 Lipshtat A, Purushothaman S, Iyengar R, Ma’ayan ... molecular and functional brain architectures, to human communication [4] To underpin such a large-scale program, he also offered a more coherent formalization and provided a mathematical treatment of ... Edelman has the theoretical credit of having integrated the classical mathematical framework of degeneracy with a new topobiological interpretation that knits together the structural and functional...
  • 16
  • 255
  • 0
Báo cáo y học:

Báo cáo y học: " The Simple Triage Scoring System (STSS) successfully predicts mortality and critical care resource utilization in H1N1 pandemic flu: a retrospective analysis" doc

Báo cáo khoa học

... Bentley A, Bright J, Walter D: Clinical review: mass casualty triage - pandemic influenza and critical care Crit Care 2007, 11:212-212 19 Department of Health: Pandemic flu: managing demand and capacity ... vital signs and patient characteristics that are readily available at initial presentation, was proposed in 2007 by Talmor and colleagues [14] as a potential alternative tool in predicting death ... to the ICU had SOFA scores ranging from to and an STSS score of The patient with the SOFA score of was admitted to the ICU after days as an in-patient Adeniji and Cusack Critical Care 2011, 15:R39...
  • 9
  • 309
  • 0
An investigation into teachers' and students' attitudes toward the use of mother tongue in English language classrooms at Hongai High school

An investigation into teachers' and students' attitudes toward the use of mother tongue in English language classrooms at Hongai High school

Thạc sĩ - Cao học

... linguistically- mixed classes was using the L2 as the medium of teaching and the language teaching placed an emphasis on the spoken language A sudden and immediate removal of L1 from the classroom happened ... have a lasting influence on ESL/ EFL classrooms The move away from L1 use was later reinforced by Audiolingualism (1940s1960s) which saw language as a matter of habit formation L1 was seen as ... Gowers and Walters “Teaching Practice Handbook” (1983) In contrast, Januleviciene and Kavaliauskiene (2002) assume that language interference is an important characteristics of second language learning...
  • 48
  • 920
  • 0
A study on the teachers' application of task-based method and the 10th form students' use of learning strategies in their listening lessons at Tran Phu High Sch

A study on the teachers' application of task-based method and the 10th form students' use of learning strategies in their listening lessons at Tran Phu High Sch

Sư phạm

... textbooks and the application of TBM in every English classroom in Vietnam 15 II.2 Tasks in task-based syllabus As can be seen from the characteristics of task-based syllabus, tasks can function as a ... use language In this case, the assumption is that learners will be able to analyze grammatical and lexical usage during the process of using the target language to communicate Grammar-Translation ... method is an overall plan for the orderly presentation of language material A method is procedural No part of a method contradicts and all of the method is based upon a selected approach And lastly,...
  • 69
  • 833
  • 0
Discovery of lipid enzymes and their modulators using metabolite profiling of yeast (saccharomyces cerevisiae) mutants

Discovery of lipid enzymes and their modulators using metabolite profiling of yeast (saccharomyces cerevisiae) mutants

Tổng hợp

... SLCK5 5’ ATAGAGAAGTTTAGTGGTTTCCCTCCGTCAGT PROLIGO GAATTCGAGCAAAAAAATACGTACGCTGCAG GTCGAC SLCK3 5’ GATAAATTACAGTTTTTGGGTCTATATACTAC PROLIGO TCTAAAAATGCGGTGGCATGAATTCGAGCTC G Table 16 : PCR Reaction ... was done in both a random and a targeted fashion The presence of phospholipid related domains was used as the basis of targeted selection of ORFs One hundred and twenty yeast strains were profiled ... averaged for comparison of TAG profiles 2.5.5 Computational Analyses of Mass Spectral Data Mass spectrometric data was acquired using MasLynx 4.0 software (Waters Corp., Milford, MA) The text files...
  • 110
  • 219
  • 0
Screening of PHA-Producing Bacteria Using Biodiesel- Derived Waste Glycerol as a Sole Carbon Source

Screening of PHA-Producing Bacteria Using Biodiesel- Derived Waste Glycerol as a Sole Carbon Source

Môi trường

... absorbance measurement was made at 410 nm against a blank sample Batch culture The experiment was carried out in a batch culture using wastewater and soil as inoculum Bacterial source was pre-grown ... research, it can be concluded that AIK7 isolate could be a good candidate as a PHA producer by using this low-grade waste glycerol as a sole carbon source REFERENCES Anderson A J and Dawes E A ... mL of the working solvent and 1.2 mL of sodium periodate were added Afterwards, 1.2 mL of acetylacetone solution was added and the mixture was placed in a water bath at 70ºC for An absorbance...
  • 9
  • 688
  • 0
A contrastive analysis of encouraging as a speech act in english and vietnamese

A contrastive analysis of encouraging as a speech act in english and vietnamese

Khoa học xã hội

... between semantics and pragmatics and covers some of the basic techniques and key concepts involved in studying and analyzing pragmatic meaning narrowest interpretation of pragmatics Đ Olshtain, E ... communication in a foreign language and partly in Communicative encouraging in English and Vietnamese as a speech act Language Teaching 1.3 SCOPE OF THE STUDY 1.2 AIMS AND OBJECTIVES 1.2.1 Aims of The ... STATEMENT OF THE PROBLEM teachers and learners of English as well as other potential interactants In the past, a series of studies regarding different speech acts of international communication...
  • 13
  • 1,583
  • 8

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008