... valid cases This rate varied between kg/ha (a situation where a small amount of manure only was applied) and 1,524 kg/ha (a situation where a field came out of alfalfa, a very large amount of ... capacity asa standard manufacturing requirement This lack of standardization for manure spreaders has forced on farmers the additional task of acquiring a weight calibration for their spreaders ... understanding of manure generation and utilization asa soil resource Manure is often considered to be a cropland resource; however, application to rangeland and grass pasture is often practiced...
... urine analysis and urine cytology were negative anda urine culture was sterile An ultrasound examination revealed a thickened bladder wall anda small bladder capacity but normal kidneys Cystoscopy ... ketamine is being used increasingly asa recreational drug we expect ketamine-associated cystitis to become more prevalent in young adults Health care workers should be aware of the problem and ... hydroxynorketamine can be measured in high quantities in the urine of patients using ketamine [6] It is possible that ketamine and its active metabolites cause significant bladder irritation Conclusion As...
... children, Anne and Andy, ages and who attend a daycare facility licensed and regulated by the state Randall's work-related expenses are $6,000 for the year Randall's employer has a dependent care assistance ... legally separated under a decree of divorce or separate maintenance, are separated under a written separation agreement, or lived apart at all times during the last months of the calendar year, ... school that provides lunch anda few educational activities as part of its preschool childcare service The lunch and educational activities are incidental to the childcare, and their cost cannot...
... "continuity and cooperation", and six questions addresses "facilities, availability and accessibility" Data management and data analysis All data were recorded usinga relational database Forms ... view of the concept ofqualityof health care focusing on structure, process and outcome ofcare [1], patient satisfaction is part of the treatment result and at the same time a good indicator of ... measures (such as health status, qualityof life or costs) in measuring the qualityof general practice care [3,4] The increased useofcomplementaryand alternative medicine (CAM) in the Western...
... outcome and length of stay for admissions to adult, general critical care units in England, Wales and Northern Ireland: the Intensive Care National Audit & Research Centre Case Mix Programme Database ... be familiar to critical care clinicians Potentially, the effects on mortality of both random effects and unmeasured factors (such as the qualityof care) can be teased out By continuous real-time ... deterministic because random effects and unmeasured factors, such as the effect of the qualityof the process of care, contribute to outcome for an individual patient [3] A validated model that accurately...
... classification (BACKCHANNEL and OTHER are merged) using hand-labeled data ofa single meeting asa test set and the remaining data as training material; for this experiment, we used the same training ... cross-validation in a four-way classification task, at each step retaining the hand-labeled data ofa meeting for testing and the rest of the data for training Table summarizes the performance of ... (Ravichandran et al., 2003) that compares maximum entropy classification and re-ranking on a question answering task Table Speaker ranking features Feature sets Baseline Structural Durational...
... Holland, Great Britain and France gave an international scope to postal operations as their merchant fleets carried mail as well as cargo to ports in Asia, Africa and the Middle East With the advance ... the savings facility takes the form ofa national savings organization (NSO), as in Bangladesh and India, or national savings bank (NSB), as in Malaysia and Sri Lanka Principal-Agent relationships, ... DESA with information: Algeria, Brazil, Cameroon, Cape Verde, Iraq, Ireland, Israel, Kenya, Democratic People’s Republic of Korea, Libyan Arab Jamahiriya, Madagascar, *Malaysia, Mali, Namibia,...
... (Table 2) Patients’ mean age was 59.7 years (36-80), M: F ratio was 1:1 and the origin of the primary malignant disease was colorectal (n = 4), appendiceal (n = 2) and ovarian (n = 2) All patients ... CRS and HIPEC enabled the repair of concomitant abdominal wall hernias and facilitated liberal resection of abdominal wall tumors Biomaterial mesh prevented evisceration on repeat laparotomy and ... chemotherapy and the bowel is usually firmly adherent to the abdominal with associated evisceration and/ or the formation of enterocutaneous fistulae The useof synthetic mesh as adjuvant to abdominal...
... Canada 5Department of Medicine, Université Laval, Québec, Canada 6Canadian Partnership Against Cancer, Québec, Canada 7University of Calgary, Calgary, Alberta, Canada Authors’ contributions All authors ... be barriers and/ or facilitators to implementation ofquality colonoscopy services, and they must include a measurement ofquality outcomes Screening and data abstraction All titles and abstracts ... miss rate for adenomas was 24% overall, 27% for adenomas less than mm, 13% for adenomas ranging from to mm, and 6% for adenomas of cm and more A Manitoba retrospective study of 36,000 individuals...
... OAA and LT have received a speaker’s honorarium from Astra-Zeneca, GlaxoSmithKline, Janssen-Cilag and Bristol Myers Squibb LT has also received a speaker’s honorarium from Sanofi-Aventis IM have ... mental illness Acta Psychiatric Scand 2008, 118:297-304 16 Birkenaes AB, Søgaard AJ, Engh JA, Jonsdottir H, Ringen A, Vaskin A, et al: Sociodemographic Characteristics and Cardiovascular Risk Factors ... is that the prevalence of antipsychotic combination treatment increased with number of hospital admissions, severity of the disease as measured with PANSS, and level of dysfunction, as measured...
... Walter J, Orlow SJ, Marchuk DA: Familial segregation of hemangiomas and vascular malformations as an autosomal dominant trait Arch Dermatol 1998, 134:718-722 Meera AV, Sen S, Raghupathy P, Walter ... and Yamamoto et al [4] highlight the efficacy of angiography and arterial embolism in the diagnosis and treatment of hemangiomas The MRI appearance of splenic hemangiomas has been described as ... similar to that of hepatic hemangiomas However, larger hemangiomas may have a variable MRI pattern because of complicating features such as hemorrhage, infarction and thrombosis Differentiation of...
... dynamics of the mammalian MAPK1,2 signaling network: bifan motif regulation of C-Raf and B-Raf isoforms by FGFR and MC1R FASEB J 2008, 22:1393-1403 Lipshtat A, Purushothaman S, Iyengar R, Ma’ayan ... molecular and functional brain architectures, to human communication [4] To underpin such a large-scale program, he also offered a more coherent formalization and provided a mathematical treatment of ... Edelman has the theoretical credit of having integrated the classical mathematical frameworkof degeneracy with a new topobiological interpretation that knits together the structural and functional...
... Bentley A, Bright J, Walter D: Clinical review: mass casualty triage - pandemic influenza and critical care Crit Care 2007, 11:212-212 19 Department of Health: Pandemic flu: managing demand and capacity ... vital signs and patient characteristics that are readily available at initial presentation, was proposed in 2007 by Talmor and colleagues [14] asa potential alternative tool in predicting death ... to the ICU had SOFA scores ranging from to and an STSS score of The patient with the SOFA score of was admitted to the ICU after days as an in-patient Adeniji and Cusack Critical Care 2011, 15:R39...
... linguistically- mixed classes was using the L2 as the medium of teaching and the language teaching placed an emphasis on the spoken language A sudden and immediate removal of L1 from the classroom happened ... have a lasting influence on ESL/ EFL classrooms The move away from L1 use was later reinforced by Audiolingualism (1940s1960s) which saw language asa matter of habit formation L1 was seen as ... Gowers and Walters “Teaching Practice Handbook” (1983) In contrast, Januleviciene and Kavaliauskiene (2002) assume that language interference is an important characteristics of second language learning...
... textbooks and the application of TBM in every English classroom in Vietnam 15 II.2 Tasks in task-based syllabus As can be seen from the characteristics of task-based syllabus, tasks can function asa ... use language In this case, the assumption is that learners will be able to analyze grammatical and lexical usage during the process ofusing the target language to communicate Grammar-Translation ... method is an overall plan for the orderly presentation of language material A method is procedural No part ofa method contradicts and all of the method is based upon a selected approach And lastly,...
... SLCK5 5’ ATAGAGAAGTTTAGTGGTTTCCCTCCGTCAGT PROLIGO GAATTCGAGCAAAAAAATACGTACGCTGCAG GTCGAC SLCK3 5’ GATAAATTACAGTTTTTGGGTCTATATACTAC PROLIGO TCTAAAAATGCGGTGGCATGAATTCGAGCTC G Table 16 : PCR Reaction ... was done in both a random anda targeted fashion The presence of phospholipid related domains was used as the basis of targeted selection of ORFs One hundred and twenty yeast strains were profiled ... averaged for comparison of TAG profiles 2.5.5 Computational Analyses of Mass Spectral Data Mass spectrometric data was acquired using MasLynx 4.0 software (Waters Corp., Milford, MA) The text files...
... absorbance measurement was made at 410 nm against a blank sample Batch culture The experiment was carried out in a batch culture using wastewater and soil as inoculum Bacterial source was pre-grown ... research, it can be concluded that AIK7 isolate could be a good candidate asa PHA producer by using this low-grade waste glycerol asa sole carbon source REFERENCES Anderson A J and Dawes E A ... mL of the working solvent and 1.2 mL of sodium periodate were added Afterwards, 1.2 mL of acetylacetone solution was added and the mixture was placed in a water bath at 70ºC for An absorbance...
... between semantics and pragmatics and covers some of the basic techniques and key concepts involved in studying and analyzing pragmatic meaning narrowest interpretation of pragmatics Đ Olshtain, E ... communication in a foreign language and partly in Communicative encouraging in English and Vietnamese asa speech act Language Teaching 1.3 SCOPE OF THE STUDY 1.2 AIMS AND OBJECTIVES 1.2.1 Aims of The ... STATEMENT OF THE PROBLEM teachers and learners of English as well as other potential interactants In the past, a series of studies regarding different speech acts of international communication...