... increase from about to 6.4 and constant around this value which was the same pH range as that using lower CO2 flow rate As the growth recovered at the same time during the gradual increase of ... temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-1 7A (Kyoto, Japan) equipped with flame ionization ... concentration Higher CO2 flow rate decreased the pH but during nitrogen starvation, the pH was practically stable at around As can be seen from Figure 1, at CO2 flow rate of 200 mL/min, the growth was...
... increase from about to 6.4 and constant around this value which was the same pH range as that using lower CO2 flow rate As the growth recovered at the same time during the gradual increase of ... temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-1 7A (Kyoto, Japan) equipped with flame ionization ... concentration Higher CO2 flow rate decreased the pH but during nitrogen starvation, the pH was practically stable at around As can be seen from Figure 1, at CO2 flow rate of 200 mL/min, the growth was...
... xylose, N-acetylglucosamine (GlcNAc), and N-acetylgalactosamine (GalNAc) were purchased from Sigma The Re mutant of LPS (E coli D31m4) was from List Biological Laboratory Inc (Campbell, CA, USA) Peptidoglycan ... mgỈmL)1 or BSA at 1.0 mgỈmL)1 (as a control) was used in agglutination of micro-organisms as described previously [21] Binding of 125 I-labeled hemolin to bacteria and yeast Hemolin was labeled with ... was added to LTA-coated microtiter plates and incubated for h at room temperature The binding assay was performed as described in Experimental procedures Each point represents the mean ± SD from...
... a wider range of devices, and as machines and objects rather than humans become the main users, then broadband will give birth to a wide range of devices and applications, as yet unimagined Again, ... broadband economy In that year, in addition to the market leaders, broadband penetration in a further three Asian economies exceeded per 100 inhabitants, in Taiwan, China (9.4), Japan (7.4) and ... Telecommunication Indicators Database and AT&T 10 Broadband 2002 2007 2008 DRAFT Broadband and economic growth The example of China catching up with the United States, and of other developing Asian nations prospering...
... environment variables The Cochran-Armitage trend test was performed in order to test if a gradual increase in sickness absence was associated with increase in risk of disability pension The SAS procedure ... than days of absence per annum decreased from 2.77 to 2.68, and remained significant There was an increased risk of disability pension for people who were smokers at baseline, whereas there was ... questionnaire and disability pension data derived from DREAM among the 4177 persons categorized as 18-45 year old employees at baseline Outcome A disability pension case was defined from onset...
... in autonomic neurotransmission In this formulation, the physical complaints typical of social phobia, are associated with rapid release of catecholamines (noradrenaline, adrenaline, and/or dopamine) ... circuit (amygdala, hippocampus, insula, temporal lobe as well as anterior cingulate, medial, orbito, and dorsolateral prefrontal cortices) of social phobic patients are greater than those of controls ... and arousal Task performance: Accuracy of emotion labeling SP ¼ CTL Valence: SP and CTL groups similarly perceived angry faces more unpleasant than neutral faces Arousal: Angry faces were more arousing...
... possibility that a cognitive factor À ‘‘bias,’’ if that is what it is À plays a causal role in social phobia Bias in this context, rather than referring to any activity characterizing social phobia, fits ... questionnaire are unavailable, as are most elements of validity For now, it is hard to tell what exactly the CSAQ is a measure of Fear of Negative Evaluation (FNE: Watson & Friend, 1969) As the SAD ... (Foa et al., 1996) were replicated An additional difference to emerge was that social phobic subjects reported an anticipated emotional reaction to negative events to last days whereas normal...
... normal counterparts Are Social Skills Deficits Characteristic of a Subtype of Social Phobia? Are social skills deficits typical of a certain subtype of social phobia, rather than social phobia as ... that it makes a difference and that it has a myriad of predictable consequences) Such independent demonstrations are scarce Inadequate Social Skills 229 The advantage that the trait approach ... construct of social skills has been assessed in research Assessment of Social Skills of Social Phobic Individuals As the assessment of social skills had to be fashioned out of the conceptual imprecision...
... appeasement and avoidance of conflict typical of social phobic individuals Parental Alcoholism David et al (1995) found an association between parental alcoholism and phobia (both social and agoraphobia); ... (shy, anxious) behavior by the teacher as well as peer assessment of social behavior (popularity, aggression, and isolation) at school At the age of no association was found between shy and anxious ... non-human animals (comparative ethology) 276 What Causes Social Phobia? The attachment theory maintains that the human infant has a set of preadapted behaviors that will unfold with maturation...
... rather sweeping assertions of ‘‘brain abnormalities.’’ Sheehan (1986) advocates a broadly similar approach Although in his book The anxiety disease social phobia is broached tangentially Àas ... phobia These are typically elements in marketing campaigns orchestrated by pharmaceutical companies Pharmaceutical Marketing, a trade publication, ‘‘singled out social phobia asa positive example ... the similarly undefined term disease.) The third strategy, which so far as I am aware has never yet been adopted, at least for a psychiatric classification, is to provide an operational definition...
... (see also Adams, 1964) 46 What is the Nature of Social Phobia? The Measurement of Social Anxiety As we have seen earlier, a variety of meanings are attached to the term anxiety (and fear) This ... the social domain (social anxiety) and social phobia in particular Consequently, as concepts cannot meaningfully be used divorced from the way they are measured (and vice versa), I shall examine ... social phobic children (mean age 10) were compared to 22 normal control children (mean age 12) on asocial phobia and anxiety inventory for children (SPAI-C) and on a behavioral assessment task...
... caution Agoraphobia and Anxiety Program Washington DC (USA) SP 34 APD Local advertisements California (USA) Hofmann et al (199 5a) Features SR social anxiety SR depressed mood Social phobia scales ... (USA) (199 5a) Study Table 5.5 (cont.) Social Phobia asa Hypothetical Construct 101 rates among relatives of social phobic individuals were far greater than that of social phobia Social Phobia ... studies a variety of cardiovascular, respiratory and skin-conductance (as well as resistance) functions were measured so as to establish whether any were characteristic of social phobia The most...
... community mental health teams Graduates were hired throughout the mental health system at standard rates of pay As case manager aides they helped their clients with a variety of tasks, such as applying ... increased demand for inpatient psychiatric care (Abas et al., 2003), and, while poverty and substance abuse are not necessarily related, poverty often increases the degree of harm that occurs at any ... frequency of hospitalisation (McGurk and Mueser, 2003; Sengupta et al., 1998) 167 Social factors asa basis for treatment Integration of vocational rehabilitation and mental health services Supported...
... supplier management, using your suppliers asa resource, allows both companies to move past the traditional adversarial relationship toward a partnership with deep mutual value creation Innovative ... management In Japan, supplier management is viewed as an essential management function Suppliers are viewed as the "hidden factory." This perspective is largely missing in all too many companies ... seek situations where they can be managed asa resource, creating innovations that benefit both customer and supplier; they shun situations where supplier management is a one-sided affair Key...
... leader mRNA from the L lactis ald gene as follows A PCR fragment was generated using primer CP-pyk (5Â-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA ... GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3Â) (N ẳ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, containing synthetic promoters ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
... proliferation and invasion Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase or as later invasive stage [46–48] Thus, in most cases, choriocarcinoma ... reproductive and cardiovascular pathophysiology Proc Natl Acad Sci USA 96, 9322–9327 62 Imachi, H., Murao, K., Sayo, Y., Hosokawa, H., Sato, M., Niimi, M., Kobayashi, S., Miyauchi, A. , Ishida, T & Takahara, ... cell association was calculated as the difference between total and nonspecific cell association In a parallel set of experiments, the cell association of [3H]CE-HDL3 by choriocarcinoma cells was...
... brassicae CSPMbraA6 [32] We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid and ASA both associated with W81 in the same ligand binding site The ligand ... 5¢-GAGCCCGGATCCACCATGAA GGTCTCAATAATT 3¢; 3¢ primer, 5¢-CTGACG GAAT TCTTAAACATTAATGCC 3¢ These primers encoded a Kozak consensus sequence as well as BamHI and EcoRI restriction sites The PCR-amplified ... evolutionary divergent from the Lepidopteran OBPs [37], were classified into three subclasses of antennalspecific proteins (ASP), namely ASP1, ASP2 and ASP3 [20,38] ASP1 has been shown to be associated...
... Anup Kumar Singh, for carrying out a statistical analysis, and team of Anil Awasthi, Rajni Kant and Pradeep for providing a secretarial assistance REFERENCES 10 World Health Organisation Treatment ... was Indian Journal of Tuberculosis also recorded over the same study-period for a comparative analysis with EPTB cases Analysis of treatment outcome was done for EPTB cases, whose data was available ... disease Exact cause for the rise in annual TB cases in area needs to be better defined The study has shown that the percentage of annual case detection has been gradually declining for PTB (from...
... the great majority of potential mates cannot easily be gathered Rosenfeld and Thomas, Searching for a Mate P.1 In this paper we exploit unique features of a new nationally representative dataset ... Hortaỗsu and Ariely 2010; Robnett and Feliciano 2011) Furthermore, the great variety of political vantage points and cultures available Castells (2000) has noted that, paradoxically, the great ... technology are highly geographically concentrated in areas such as Silicon Valley, California, because the face-to-face networks are crucial for the cross fertilization of ideas Rosenfeld and Thomas,...
... 1,048 valid cases This rate varied between kg/ha (a situation where a small amount of manure only was applied) and 1,524 kg/ha (a situation where a field came out of alfalfa, a very large amount ... farmers who had applied total nitrogen at rates of at least 309 kg/ha The average phosphorus (P2O5) application rate was 140 kg/ha as illustrated in Figure Calculations were based on 1,048 valid ... neither waste nor asset (Dittrich, 1993) Manure was largely viewed asa farm asset up until the early 1960s At that time the theme of manure asa waste, as something to be disposed of, began to...