Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis Brian Koebmann, Christian Solem and Peter Ruhdal Jensen Microbial Physiology and Genetics, BioCentrum-DTU, Technical University of Denmark, Kgs Lyngby, Denmark Keywords glycolysis; Lactococcus; las; metabolic control analysis; operon Correspondence P R Jensen, Microbial Physiology and Genetics, BioCentrum-DTU, Technical University of Denmark, Building 301, DK-2800 Kgs Lyngby, Denmark Tel: +45 4525 2510 Fax: +45 4593 2809 E-mail: prj@biocentrum.dtu.dk (Received 23 December 2004, revised 28 February 2005, accepted March 2005) doi:10.1111/j.1742-4658.2005.04656.x In Lactococcus lactis the enzymes phosphofructokinase (PFK), pyruvate kinase (PK) and lactate dehydrogenase (LDH) are uniquely encoded in the las operon We used metabolic control analysis to study the role of this organization Earlier studies have shown that, at wild-type levels, LDH has no control over glycolysis and growth rate, but high negative control over Jformate formate production (CLDH ¼ À1:3) We found that PFK and PK exert no control over glycolysis and growth rate at wild-type enzyme levels but both enzymes exert strong positive control on the glycolytic flux at reduced Jformate activities PK exerts high positive control over formate (CPK ¼ 0:9 À 1:1) Jacetate and acetate production (CPK ¼ 0:8 À 1:0), whereas PFK exerts no control over these fluxes at increased expression Decreased expression of the entire las operon resulted in a strong decrease in the growth rate and glycolytic flux; at 53% expression of the las operon glycolytic flux was reduced to 44% and the flux control coefficient increased towards Increased las expression resulted in a slight decrease in the glycolytic flux At wild-type levels, control was close to zero on both glycolysis and the pyruvate branches The sum of control coefficients for the three enzymes individually was comparable with the control coefficient found for the entire operon; the strong positive control exerted by PK almost cancels out the negative control exerted by LDH on formate production Our analysis suggests that coregulation of PFK and PK provides a very efficient way to regulate glycolysis, and coregulating PK and LDH allows cells to maintain homolactic fermentation during glycolysis regulation Over the last three decades increasing attention has been paid to how metabolic pathways are controlled Metabolic control analysis [1,2] has been applied successfully to determine the flux control of many single enzymes [3–7], but much less attention has been paid to determine flux control by individual enzymes cotranscribed in prokaryotic operons In Lactococcus lactis, an industrially important organism used extensively in the fermentation of dairy products, the three glycolytic enzymes phosphofructokinase (PFK), pyruvate kinase (PK) and lactate dehydrogenase (LDH) are clustered in the so-called las operon [8] This organization of glycolytic genes is unique and has given rise to speculation that the three enzymes might play an important role in the control and regulation of lactic acid production by this organism We have previously shown that small changes in the activity of PFK result in pronounced changes in metabolite pools, glycolytic flux and growth rate in L lactis, but control by PFK has not been quantified [9] LDH was shown to have no control over either growth or glycolytic flux at wild-type levels, but a strong negative control over the minor flux to mixed acids via pyruvate formate lyase (PFL) [10] In this study, the activities of PFK and PK were modulated individually by changing expression of the Abbreviations LDH, lactate dehydrogenase; PFK, phosphofructokinase; PFL, pyruvate formate lyase; PK, pyruvate kinase 2292 FEBS Journal 272 (2005) 2292–2303 ª 2005 FEBS B Koebmann et al corresponding genes We measured the control exerted by each of the las enzymes on the glycolytic flux, growth rate and product formation We also studied strains with modulated expression of the entire las operon, and show that the data fit well with the individual determination of flux control coefficients by PFK, PK and LDH The role of the las operon is discussed on the basis of the distribution of flux control for PFK, PK and LDH Results PFK has no control over glycolytic flux, growth rate or product formation PFK converts fructose 6-phosphate to fructose 1,6-bisphosphate and is encoded by the first gene in the las operon (Fig 1) To study the control of glycolysis and formate flux by PFK we used strains with modulated PFK activities A library of strains with increased PFK activities ranging from 1.4 to 11 times the wildtype level was available from a previous study [11] (Fig 2A) Strains with reduced levels of PFK, HWA217 (39% PFK activity) and HWA232 (60% Control analysis of the las operon PFK activity) were obtained by Andersen et al [9], who also showed that such decreases in PFK resulted in a strong decrease in both growth rate and glycolytic flux [9] Together these PFK mutants cover the range of enzyme activities necessary for studies of flux control Five selected strains with increased PFK activity were grown exponentially at 30 °C in defined SAL medium supplemented with glucose and analysed with respect to growth rate, glycolytic flux and fermentation products (Fig 2B,C) At increased PFK activity we found a slight decrease in both growth rate and glycolytic flux (Fig 2B,C) The strains remained homolactic with only a slight decrease in formate production compared with the wild-type strain The data obtained for strains with modulated PFK activity above the wildtype level were fitted to linear curves (Fig 2B,C) and the respective flux controls were calculated as described in Experimental procedures (Fig 2D) From these data it is clear that at the wild-type level PFK Jglucose has no control over the glycolytic flux (CPFK % 0) or Jl growth rate (CPFK % 0), and no control over the fluxes Jlactate Jformate to lactate (CPFK % 0), formate (CPFK % 0) or acetate Jacetate (CPFK % 0) at the wild-type level and above Fig Glycolysis and the las operon in Lactococcus lactis.The las operon in L lactis consists of the three genes pfk, pyk and ldh, coding for phosphofructokinase (PFK), pyruvate kinase (PK) and lactate dehydrogenase (LDH), respectively FEBS Journal 272 (2005) 2292–2303 ª 2005 FEBS 2293 Control analysis of the las operon B Koebmann et al Fig Modulation of PFK activity and the effects on growth and fluxes (A) Library of strains with modulated PFK activities The PFK activities were measured in extracts from strains in which an additional pfk gene transcribed from synthetic promoters was integrated on the chromosome by site-specific recombination in a phage attachment site The specific PFK activity in MG1363 was determined to 0.55 mg)1 protein [11] Selected strains indicated by white bars were cultivated in SAL medium supplemented with glucose and studied with respect to (B) growth rate (including flux control by PFK on growth rate), (C) metabolic fluxes and (D) flux control coefficients by PFK on metabolic fluxes Curve fitting is described in Experimental procedures PK has no control over glycolysis but full control over mixed acid production PK, which converts phosphoenolpyruvate to pyruvate, is encoded by the second gene in the las operon (Fig 1) In order to obtain strains with increased PK activity an additional copy of the pyk gene was recombined into the TP901-1 attachment site using the site-specific recombination vector pLB85 as described in Experimental procedures The pyk gene was here preceeded by the leader of the ald gene, see Experimental Procedures This resulted in a library of 37 strains 13 of which were characterized with respect to PK activities The characterized strains were found to have PK activities ranging from 100 to 330% of wild-type level, whereas the activities of PFK and LDH were reduced compared with the wild-type level (Fig 3A) In order to obtain a strain with lower PK activity one of the strains with an additional copy of the pyk gene, CS1897 (120% PK activity), was used The native pyk gene in CS1897 was deleted by a double cross-over event as described in Experimental procedures and shown in Fig The resulting strain, CS1929 (37% PK activity), thus contains only a single pyk gene under the control of a synthetic promoter 2294 The relative PFK activity in strain CS1929 was found to increase to over 160% of the wild-type level, whereas the relative LDH activity was reduced to 80% of the wild-type level (Fig 3A) In order to study the control exerted over the metabolic fluxes by PK, strains with PK activities altered around the wild-type level were grown in defined SAL medium supplemented with glucose A slight decrease in growth rate and glycolytic flux was observed at increased PK activities (Figs 3B and 5) For strain CS1929 we found a strong decrease in growth rate and glycolytic flux, almost proportional to the change in PK activity The data points for growth and glucose flux were then fitted against the PK activities in order to determine the control exerted by PK over the growth rate (Fig 3B) and glycolytic flux (Fig 5) from which we conclude that PK exerted no significant control over either growth rate or glycolytic flux at the wild-type level However, reducing the PK activity to 37% enhances the control exerted by PK over growth Jl rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a decrease in lactate produc- FEBS Journal 272 (2005) 2292–2303 ª 2005 FEBS B Koebmann et al A Control analysis of the las operon equations were, as for growth rate and glycolytic flux, used to calculate the control exerted by PK on the metabolic fluxes (Figs 3B and 5) Interestingly, we found a very high positive flux control coefficient by PK on the flux to formate at the wild-type level Jformate (CPYK ¼ 0:9 À 1:1) (Fig 5) Similarly, the control exerted by PK over the flux to acetate was determined Jacetate to be CPK ¼ 0:8 À 1:0 (Fig 5) Modulation of the entire las operon B Fig Modulation of PK activity and the effect on growth rate (A) Enzyme activities of PFK, PK and LDH relative to the wild-type level in strains with modulated PK activities The enzyme activities were measured in extracts from strains in which the pyk gene placed after a range of synthetic promoters with different strengths was integrated on the chromosome by site-specific recombination in a phage attachment site In strain CS1929 the native pyk gene was deleted from the las operon The specific PK activity in MG1363 was determined to 0.25 mg)1 protein (B) Growth rates of selected strains (including flux control coefficients) Standard deviations, indicated by error bars, are based on measurement of three individual cultures tion These results show that PK activity plays an important role in the metabolic shift from homolactic to mixed acid fermentation The data points for product formation were then fitted against the PK activities in order to determine the control exerted by PK over the flux to formate Because only one data point was available for PK activity below the wild-type level three or four curves were fitted for each of the studied metabolic fluxes using the best possible suggestions obtained using the software curveexpert The resulting FEBS Journal 272 (2005) 2292–2303 ª 2005 FEBS Strains with altered expression of the entire las operon were previously obtained by replacing the native las promoter with synthetic promoters in a single crossover event [11] From this library consisting of 50 strains with altered expression of the las operon, the enzyme activities of PFK, PK and LDH were determined and eight strains with enzyme activities 0.5–3.5 times the wild-type level were selected for further analysis (Fig 6A) Good correlation among relative enzyme activities of the three enzymes was found These strains then allowed us to study the control exerted by all three las enzymes simultaneously The growth rate and metabolic fluxes for the strains were determined and we also found that growth rate and glycolytic flux were highest when the activities of the las enzymes were at wild-type levels (Figs 6B and 7) The data points were fitted to the equations described in Experimental procedures and are presented in Figs 6B and for calculations of flux control coefficients The sum of flux control on glycolysis and growth rate by the las enzymes at wild-type levels is Jglucose Jl close to (Clas % and Clas % 0) as can be inferred from the primary data However, it is interesting that a slight reduction in las activity resulted in a very strong decrease in growth rate and glycolytic flux: at 53% expression the flux was reduced to 44% At this level, the flux control was found to be as high as Jglucose Jl Clas % (Fig 7) and Clas % (Fig 6B) With respect to the fermentation pattern, little change was observed around the wild-type level, and flux control coefficients on the formate flux Jformate Jacetate ¼ À0:26) and acetate flux (Clas ¼ À0:26) were (Clas smaller than was observed for strains with individual modulation of PK and LDH (Fig 7) Strong negative Jformate % flux controls on formate production (Clas Jacetate ðÀ1:4Þ À ðÀ1:7Þ) and acetate production (Clas % ðÀ1:7Þ À ðÀ2:0Þ) were observed at reduced activities of the las enzymes to 50–60% of wild-type level (Fig 7) When the activities of the las enzymes were increased three times we find a flux control coefficient at Jformate % ðÀ0:4Þ for the formate flux and Clas Jacetate Clas % ðÀ0:4Þ for the acetate flux 2295 Control analysis of the las operon B Koebmann et al Fig Construction of a strain with the pyk gene deleted from the las operon Truncated fragments of PFK and LDH were cloned along each other in pG+host8 which cannot replicate in L lactis at 37 °C [23] Because PK is essential for growth, deletion of pyk was performed in strain CS1897 which contains an additional copy of pyk in the TP9011-1 phage attachment site A double cross-over event of the resulting plasmid, pCS1919, on the las operon resulted in an operon structure in which the pyk gene was deleted Fig Flux control coefficients for PK on metabolic fluxes Flux control coefficients for PK with respect to glycolysis, lactate, acetate and formate production were determined from the fitted equations as described in Experimental procedures Standard deviations, indicated by error bars, are based on measurement of three individual cultures 2296 FEBS Journal 272 (2005) 2292–2303 ª 2005 FEBS B Koebmann et al A Control analysis of the las operon B Fig Modulation of the las operon (A) Enzyme activities of PFK, PK and LDH relative to the wild-type level The enzyme activities were measured in extracts from strains in which the native las promoter was replaced by a library of synthetic promoters with different strengths [11] (B) Growth rates of selected strains (including flux control coefficients) Standard deviations, indicated by error bars, are based on measurement of three individual cultures Fig Flux control coefficients for the las enzymes on metabolic fluxes A selection of strains were analysed with respect to glycolytic flux and metabolic fluxes Flux control coefficients with respect to glycolysis, lactate, acetate and formate production were determined from the fitted equations as described in Experimental procedures Standard deviations, indicated by error bars, are based on measurement of three individual cultures FEBS Journal 272 (2005) 2292–2303 ª 2005 FEBS 2297 Control analysis of the las operon Comparison of control by the las enzymes Based on the data presented here and on earlier data for LDH [10], it is possible to compare the flux controls of the individual enzymes with that of a simultaneous modulation of all the las enzymes, i.e to J J J J test whether: Clas ẳ CPFK ỵ CPK ỵ CLDH With respect to glycolysis, growth rate and lactate flux, the flux control coefficients of the three individual enzymes PFK, PK and LDH added up to a value close to 0, which is in accordance with the low control over the glycolytic flux found for all enzymes in the las operon With respect to control over the formate flux, LDH has previously been found to exert a high negative Jformate control (CLDH ¼ À1:3) [10] In this study, we found that PFK has almost no flux control on formate proJformate duction (CPFK % 0), whereas PK is found to have a Jformate high positive flux control (CPK % 1:0), so addition of these flux control coefficients on formate gives us: Jformate Jformate Jformate CPFK þ CPK þ CLDH ¼ À0:3 Interestingly, when all enzymes from the las operon were modulated simulJformate ¼ À0:26 on the taneously we found a control of Clas formate flux, which again fits very well with the sum of the control by the individual enzymes A similar comparison of flux control was not possible for the acetate flux because this was not measured in the earlier study on LDH [10] However, we expect the sum of the individual flux control coefficients to add up to that found for the combined change of the las enzymes, because mixed acid metabolism under anaerobic conditions is expected to result in equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified the control exerted by the las enzymes on the metabolic fluxes under conditions where any autoregulation of the modulated enzyme in question that might occur in a wild-type cell was eliminated by the introduction of synthetic promoters The method measures so-called ‘inherent control coefficients’ and has previously been applied successfully to the study of DNA supercoiling in Escherichia coli [12,13] and more recently to a study of the control exerted by CTP synthase on the nucleotide pools in Lactococcus [14] The three enzymes PFK, PK and LDH encoded by the las operon in L lactis MG1363 were modulated both individually and simultaneous by changing the expression of the respective genes We found that neither the individual enzymes nor the sum of the las 2298 B Koebmann et al enzymes had significant control on the glycolytic flux at wild-type levels The sum of the flux control coefficients determined for the individual enzymes on glycolysis and on the formate flux fits very well with the coefficients obtained from modulating the entire operon, which demonstrates the solidity of the approach used here Both PFK and PK were found to exert very strong positive control on glycolysis at reduced activities around half the normal enzyme level When expression of the las operon was reduced to 53% the glycolytic flux was reduced to 44%, which amounts to more than a proportional decrease in the flux Moreover, by looking at the las expression range from 53 to 61% of the wild-type level we observe a relative change in the glycolytic flux of 34% In terms of flux control based on the fitted equations, this amounts to a flux control coefficient approaching 3! This is significantly higher than the flux control coefficients for the individual las enzymes at comparable levels From the data for PFK given in Andersen et al [9], the flux control coefficient on the glycolytic flux of PFK activity at 50% of wildtype level can be estimated to 0.45 by fitting the data to a linear curve According to Andersen et al [10], the flux control coefficient on the glycolytic flux for LDH at 50% of wild-type activity was found to be around 0.1–0.2 In this study we found the flux control coefficient on the glycolytic flux by PK at 50% of wild-type activity to be around 1.0 Thus, the sum of the individual enzymes amounts to only 1.6–1.7 The dramatic reduction in growth rate and glycolytic flux at reduced las enzyme activity may be explained by perturbations in metabolite pools In the previous study by Andersen et al it was suggested that the strong effect on growth and glycolytic flux observed when reducing PFK activity could be due to an accumulation of hexose phosphates [9] The stronger effect on the growth rate and glycolytic flux observed in this study when all the las enzymes were reduced to 50% of wild-type levels may then be the result of decreased PK activity which would result in an increased phosphoenolpyruvate pool, which in turn would enhance the activity of the PTS system and thereby result in further increases in hexose phosphate pools The decreased LDH activity may contribute further to this effect by causing an accumulation of pyruvate and then back-pressure on PK We therefore conclude that by placing the pfk and pyk genes together in an operon, L lactis is provided with a very efficient tool for regulating glycolysis: by regulating expression of the las operon two- to threefold the glycolytic flux will be dramatically affected Indeed, regulation of expression of the las operon has FEBS Journal 272 (2005) 2292–2303 ª 2005 FEBS B Koebmann et al been shown to take place at the transcriptional level [15] Deletion of the entire pyk gene from the las operon resulted in a slight disturbance in the relative levels of PFK and LDH, which were altered to 167 and 76% of the wild-type level, respectively (Fig 3A) The mechanism behind these effects is unclear but may reflect a combination of a hierarchical up-regulation [16] of the las operon at low PK activity and a polar effect of the pyk deletion on expression of ldh An important question is whether this affects the conclusions drawn from our control analysis But we already know that PFK has no control over growth rate, glycolytic flux or formate flux at wild-type levels and above and therefore changes in PFK should not affect the control by PK Furthermore, if LDH expression is decreased due to a polar effect, this would result in an underestimation of the flux control by PK on mixed acid production We therefore believe that it is safe to use strain CS1929 for the current metabolic control analysis Overexpression of pyk resulted in a proportional increase in the flux to mixed acid products In a recent study by Ramos et al [17] it was found that the fermentation pattern in a PK-overproducing strain showed a typical homolactic metabolism under anaerobic conditions At first, this seems to contradict our results However, in practice, the flux to formate at the wild-type level amounts to only 3.5% of the pyruvate metabolism, and a doubling in formate flux would amount to only 7%, which would still be considered to be homolactic fermentation The magnitude of the control exerted by PK Jformate (CPK ¼ 0:9 À 1:1) over formate production was almost comparable but of the opposite sign compared with the negative control found previously for LDH Jformate (CLDH % À1:3) [10] Because the control by PFK on the flux to formate was found to be 0, the sum of control on the formate flux was only slightly negative Jformate % À0:3), which explains why changing expres(Clas sion of the las operon around the normal level led to little change in the production pattern By coregulating PK and LDH cells can maintain homolactic fermentation The fact that the effects of PK and LDH almost cancel each other out may also add to the explanation of why the genes are organized in an operon in L lactis When L lactis needs to up- or down-regulate the glycolytic flux it can so without interfering with the pattern of product formation Indeed, L lactis appears to strongly favour the homolactic route despite the fact that significantly less ATP is gained compared with mixed acid production Because L lactis is resistant to high concentrations of lactic acid it may benefit from FEBS Journal 272 (2005) 2292–2303 ª 2005 FEBS Control analysis of the las operon homolactic fermentation by efficiently inhibiting the growth of its competitors In this analysis we have considered only metabolic fluxes, flux control coefficients and, to some extent, external metabolite concentrations However, organization of the las operon may also play an important role in keeping internal metabolite pools constant, by coregulating enzymes early and late in glycolysis when changes in the flux are required [18] A simple explanation for why prokaryotic genes are organized in operons could be to efficiently regulate pathways by regulating only a few genes, for example, in order to save energy and protein synthesizing capacity This would be preferable to placing all the genes involved in the pathway in the same operon; the cell can then respond quickly to changes in the environment by changing the expression of only a few genes and using the protein-synthesizing capacity to express these genes when needed Here we have studied a set of enzymes that are needed by these cells under all growth conditions, because glycolysis is the energyproducing pathway Indeed, in contrast to many other systems, only a few fold regulations of the genes have been shown to take place [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may benefit from the way in which the las operon is organized We believe that such analysis would not have been possible using traditional functional analysis with gene knockouts and overexpression of enzymes from a plasmid Experimental procedures Bacterial strains and plasmids For cloning purposes was used Escherichia coli strain ABLE-C {E coli C lac(LacZ–)[Kanr McrA– McrCB– McrF– Mrr– HsdR (rk– mk–)][F’proAB lacIqZDM15 Tn10(Tetr)]} (Stratagene) or KW1 {metB, strA, purB(aad-uid-man), hsr, hsm+,gusA–} [19] L lactis ssp cremoris MG1363, a prophage-cured and plasmid-free derivative of NCDO712 [20], was used as a model organism for modulating gene expression L lactis LB436 is a derivative of MG1363 containing a plasmid, pLB65, that harbours a gene coding for the temperate lactococcal bacteriophage TP901-1 integrase [21] The strain was used as the host for site-specific integration in the chromosomal attB site of phage TP901 The E coli vector plasmid pRC1 [22] was used for integration of synthetic promoters upstream to the las operon The plasmid pLB85 harbouring attP of TP901-1 and a promotorless gusA gene encoding b-glucuronidase [21] was used as plasmid vector for site-specific integration of extra gene copies 2299 Control analysis of the las operon on the TP901-1 attB locus on the chromosome of MG1363 The replication-thermosensitive plasmid pG+host8, which contains a gene for tetracycline resistance [23], was used to delete the pyk gene from the las operon on the chromosome Growth media and growth conditions E coli strains were grown aerobically at 37 °C in Luria– Bertani broth [24] L lactis strains were routinely cultivated at 30 °C without aeration in M17 broth [25] or in chemically defined SA medium [26] modified by exclusion of acetate and inclusion of lgỈmL)1 lipoic acid (SAL medium) The media were supplemented with or 10 gỈL)1 glucose and appropriate selective antibiotics L lactis growth experiments were performed as batch cultures (flasks) at 30 °C in 100 mL of SAL medium [26] supplemented with 0.12% (w ⁄ v) of glucose when determining biomass yield on glucose, Yg, or else 1% (w ⁄ v) of glucose Antibiotics were only used in precultures and not in the growth experiments Enzyme activities and product formation were determined by using the same cultures thereby assuring that genetic constructions were intact A slow stir with magnets was used to keep the culture homogenous Regular measurements of A600 were made, and HPLC samples taken for measuring the product formation and glycolytic flux Cell density was correlated to the cell mass of L lactis to be 0.36 gdwỈL)1 SA medium for A600 ¼ [10] All fluxes were calculated from changes in concentration of metabolites measured by HPLC from Shimadza Corp (Kyoto, Japan) as previously described [9] Antibiotics Antibiotics were used at the following concentrations: Erythromycin: lgỈmL)1 for L lactis and 200 lgỈmL)1 for E coli Tetracycline: lgỈmL)1 for L lactis and lgỈmL)1 for E coli Enzymes All enzymes used in the enzymatic assays for PFK, PK and LDH were purchased from Roche A ⁄ S (Hvidovre, Denmark) DNA techniques All manipulations were performed as described by Sambrook et al [24] Taq DNA polymerase (New England Biolabs, Frankfurt am Main, Germany) was applied for analytical purposes and PCR products intended for cloning were generated using ElongaseR enzyme mix (Invi˚ trogen, Tastrup, Denmark) Chromosomal DNA from L lactis was isolated using a method described previously [27] with the modification that cells were treated with 2300 B Koebmann et al 20 lg lysozyme per mL for h before lysis Digestion with restriction enzymes (Fermentas, St.-Leon, Germany; Amersham, Hillerød, Denmark), treatment with T4 DNA ligase (Fermentas) and shrimp alkaline phosphatase (Fermentas) were carried out as prescribed by the manufacturers DNA fragments were purified from agarose gels using GFX PCR DNA and Gel Band Purification Kit (Amersham) E coli was transformed by electroporation Cells were plated on Luria–Bertani plates supplemented with appropriate antibiotics Plasmid DNA was isolated from E coli by using Qiaprep Spin Miniprep Kit (Qiagen, Hilden, Germany) Cells of L lactis were made electrocompetent by growth in GM17 medium containing 1% glycine, and DNA was introduced by electroporation as previously described by Holo and Nes [28] After electroporation cells were plated on GM17 supplemented with appropriate antibiotics Enzyme measurements The activities of PFK, PK and LDH were measured in cell extracts obtained by sonication Cells were grown in SAL medium and harvested at A600 % 0.5 The cells were washed twice with ice-cold 0.2% (w ⁄ v) KCl and then resuspended in ice-cold sonication buffer Sonication buffer for LDH and PK activity measurements: 50 mm triethanolamine, 10 mm KH2PO4, 10 mm EDTA, 50% (v ⁄ v) glycerol, pH 4.7; sonication buffer for PFK activity measurements, 50 mm Tris ⁄ HCl, 0.1 mm EDTA, 50% (v ⁄ v) glycerol, mm dithiothrietol, pH 7.5 The cell suspension was sonicated three times for 45 s with an interval of 30 s The preparation was kept on ice during the sonication Following sonication, cell debris and intact cells were removed by centrifugation (10 min, 20 000 g, °C) As a measure for the degree of cell disruption the A280 was used The enzyme activities were determined from the consumption of NADH using a Zeiss M500 spectrophotometer PFK was assayed according to Fordyce et al [29] with the following modifications Final concentrations in assay: mm ATP, mm fructose 6-phosphate, 0.2 mm NADH, 10 mm MgCl2, 10 mm NH4Cl, 0.3 mL)1 triose phosphate isomerase, mL)1 glycerol 3-phosphate dehydrogenase and 0.3 U aldolase PK was assayed as described by Crow and Pritchard [30] Final concentrations in assay was: mm GDP, mm PEP, mm fructose 1,6-bisphosphate, 10 mm MgCl2, 0.2 mm NADH and 6.3 mL)1 LDH LDH was measured according to Crow and Pritchard [31] Final concentrations in assay was: 10 mm pyruvate, 0.2 mm NADH, mm fructose 1,6-bisphosphate All measured enzyme activities were related to the A280 of the extract, for the purpose of determining relative activities The specific activities of PFK and PK and LDH in MG1363 were determined as mg)1 of protein, where a unit (U) is defined as the amount of enzyme producing lmol of NADH per FEBS Journal 272 (2005) 2292–2303 ª 2005 FEBS B Koebmann et al minute The relative values of simultaneous modulation of the three las enzymes are calculated as the average of the three individual relative activities Construction of strains with modulated expression of pyk Strains with increased PK activity were obtained by introducing an additional copy of the gene on the chromosome transcribed from synthetic promoters At first we tried to use the natural leader of the pyk gene, but this resulted in merely 25% increased PK activity We then inserted the leader mRNA from the L lactis ald gene as follows A PCR fragment was generated using primer CP-pyk (5Â-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3Â) (N ẳ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, containing synthetic promoters followed by an ald leader and a full-length pyk gene, were digested with SpeI and NsiI and cloned in the vector pLB85 digested with XbaI and PstI Following ligation the plasmids were introduced directly to L lactis LB436, carrying plasmid pLB65 in which pLB85 and other plasmids containing the attB site from TP901-1 will integrate with high frequency at the corresponding attachment site for phage TP901-1 on the L lactis chromosome [21] The cells were plated on GM17 plates supplemented with lgỈmL)1 erythromycin and 200 lgỈmL)1 5-bromo-4-chloro-3-indolyl-beta-d-glucuronide (X-gluc) (Biosynth AG, Switzerland) Construction of a strain with reduced PK activity was performed by deleting the native pyk gene in strain CS1897 which already contains an additional copy of the pyk gene at the TP901-1 phage attachment site PCR products upstream to pyk using primer pyk1 (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned in identical restriction sites in plasmid pG+host8, using E coli KW1 as cloning host The resulting plasmid, pCS1919, was used to delete pyk from the las operon by a double crossover event as previously described [11] Control analysis of the las operon metabolic fluxes for the entire range of enzyme activity (ax), the experimental data points were fitted to equations For strains with modulated PFK activity the data points were fitted to linear equations by the least square method using excel (Microsoft) The experimental data points for strains with modulated PK activity and las activity were fitted by the least square method using curveexpert 1.3¢ (Hyams Development, Hixson, TN, USA) using the Levenberg–Marquardt regression to solve nonlinear regressions This resulted in the following functions: PFK: Jl(aPFK) ¼ )0.0077 * aPFK + 0.886, Jglucose(aPFK) ¼ )0.234 * aPFK + 22.9, Jlactate(aPFK) ¼ )0.414 * aPFK + 42.7, Jformate(aPFK) ¼ )0.0806 * aPFK + 1.80: Jacetate(aPFK) ¼ )0.0237 * aPFK + 3:4 1.17, PK: Jl aPK ị ẳ 0:0298 18:7 aPK ị e7:9aPK ị ỵ 1=aPK 0:641 aPK (Modied 0:315, Jglucose aPK ị ẳ 53:2 0:504 Hoerl Model), Jglucose(aPK) ¼ e3.97)(0.685/aPK))0.641*ln(aPK)) (Vapor Pressure Model), Jglucose ðaPK ị ẳ 0:511 ỵ 56:2 aPK 35:8 a2 ỵ 6:90 a3 (Polynomial Fit), Jglucose aPK ị ẳ PK PK 52:4 aPK 0:533ị=1 ỵ 0:249 aPK ỵ 0:696 aPK ị2 (Rational Function), Jlactate(aPK) ¼ e4.71)(0.782/aPK))0.817*ln(aPK)) (Vapor Pressure Model), Jlactate ðaPK Þ ¼ 111 à 0:4581=aPYK à À0:817 (Modified Hoerl Model), Jlactate ðaPK Þ ẳ 1:21 ỵ 111 aPK aPK 73:6 a2 ỵ 14:5 a3 (Polynomial Fit), Jlactate aPK ị ẳ PK PK 94:0 aPK 0:984ị=1 ỵ 0:00179 aPK ỵ 0:846 a2 ị (RatioPK nal Function), Jformate aPK ị ẳ 3:58 0:535aPK a1:67 (Hoerl PK model), Jformate aPK ị ẳ 1:39 aPK 0:00750ị=1 0:455 aPK ỵ 0:187 a2 ị (Rational function), Jformate aPK ị ẳ PK 0:453 ỵ 2:93 aPK 0:538 a2 (Quadratic t), Jacetate aPK ị ẳ PK (Polyno0:0329 ỵ 1:178 aPYK ỵ 0:276 a2 À 0:165 à a3 PK PK mial fit), Jacetate ðaPK ị ẳ 0:0137 ỵ 1:636 aPK 0:284 a2 PK (Quadratic t), Jacetate aPK ị ẳ 1:91 0:701aPYK a1:177 (Hoerl PK model), Jacetate aPK ị ẳ 0:0500 ỵ 1:034 aPK ị=1 0:350 aPK þ 0:171 à a2 Þ (Rational function), All las enzymes: Jl alas ị ẳ PK 3:2 0:0123 93:9 alas Þ Ã ð1 À eÀ7:1Ãalas Þ À 0:276, Jglucose alas ị ẳ 6a2:1 las ị 33:2 (User dened), 0:693 à ð83:3 À alas Þ Ã ð1 À e 2:1 Jlactate alas ị ẳ 0:919 129 alas Þ Ã ð1 À eÀ6Ãalas Þ À 75:2 (User 3:3 dened), Jacetate alas ị ẳ 0:1135 30:3 alas ị e6alas ịỵ 4:66 (User dened), Jformate alas ị ẳ 0:173 23:7 alas ị 2:3 e5:6alas ị ỵ 6:02 (User dened) User-dened equations were also selected as the functions giving the least sum of squares The control coefficients were then calculated from the equation C J ¼ (dJ(ax) ⁄ J(ax)) ⁄ (d(ax) ⁄ (ax) for the entire range x of ax, where J refers to either a flux or a growth rate The slopes were determined by differentiation of the equations using the quickmath hosted by Verio Web hosting services on the Internet Acknowledgements Curve fitting and calculation of control coefficients To estimate the control of PFK, PK and all las enzymes on the glycolytic flux (Jglucose), growth rate (Jl) and on the FEBS Journal 272 (2005) 2292–2303 ª 2005 FEBS This work was supported by the Danish Dairy Research Foundation (Danish Dairy Board), the Danish Research Agency and the Danish Center for Advance Food Studies (LMC) 2301 Control analysis of the las operon B Koebmann et al References Kacser H & Burns JA (1973) The control of flux In Rate Control of Biological Processes (Davies DD, ed.), Cambridge Symposium in Experimental Biology, Vol 27, pp 65–104 Cambridge University Press, Cambridge Heinrich R & Rapoport TA (1974) A linear steady-state treatment of enzymatic chains: general properties, control and effector-strength Eur J Biochem 42, 89–95 Niederberger P, Prasad R, Miozzari G & Kacser H (1992) A strategy for increasing an in vivo flux by genetic manipulations The tryptophan system of yeast Biochem J 287, 473–479 Snoep JL, Arfman N, Yomano LP, Westerhoff HV, Conway T & Ingram LO (1996) Control of glycolytic flux in Zymomonas mobilis by glucose-6-phosphate dehydrogenase activity Biotechn Bioeng 51, 190–197 Jensen PR, Michelsen O & Westerhoff HV (1993) Control analysis of the dependence of Escherichia coli physiology on the H+-ATPase Proc Natl Acad Sci USA 90, 8068–8072 Jensen PR, Westerhoff HV & Michelsen O (1993) Excess capacity of H+-ATPase and inverse respiratory control in Escherichia coli EMBO J 12, 1277–1282 Solem C, Koebmann BJ & Jensen PR (2003) Glyceraldehyde-3-phosphate dehydrogenase has no control over glycolytic flux in Lactococcus lactis MG1363 J Bacteriol 185, 1564–1571 Llanos RM, Harris CJ, Hillier AJ & Davidson BE (1993) Identification of a novel operon in Lactococcus lactis encoding three enzymes for lactic acid synthesis: phosphofructokinase, pyruvate kinase, and lactate dehydrogenase J Bacteriol 175, 2541–2551 Andersen HW, Solem C, Hammer K & Jensen PR (2001) Twofold reduction of phosphofructokinase activity in Lactococcus lactis results in strong decreases in growth rate and in glycolytic flux J Bacteriol 183, 3458–3467 10 Andersen HW, Pedersen MB, Hammer K & Jensen PR (2001) Lactate dehydrogenase has no control on lactate production but has a strong negative control on formate production in Lactococcus lactis Eur J Biochem 268, 6379–6389 11 Solem C & Jensen PR (2002) Modulation of gene expression made easy Appl Environ Microbiol 68, 2397–2403 12 Jensen PR, van der Weijden CC, Jensen LB, Westerhoff HV & Snoep JL (1999) Extensive regulation compromises the extent to which DNA gyrase controls DNA supercoiling and growth rate of Escherichia coli Eur J Biochem 266, 865–877 13 Snoep JL, van der Weijden CC, Andersen HW, Westerhoff HV & Jensen PR (2002) DNA supercoiling in Escherichia coli is under tight and subtle homeostatic control, involving gene-expression and metabolic regula- 2302 14 15 16 17 18 19 20 21 22 23 24 25 26 27 tion of both topoisomerase I and DNA gyrase Eur J Biochem 269, 1662–1669 Jørgensen CM, Hammer K, Jensen PR & Martinussen J (2004) Expression of the pyrG gene determines the pool sizes of CTP and dCTP in Lactococcus lactis Eur J Biochem 271, 2438–2445 Luesink EJ, van Herpen RE, Grossiord BP, Kuipers OP & de Vos WM (1998) Transcriptional activation of the glycolytic las operon and catabolite repression of the gal operon in Lactococcus lactis are mediated by the catabolite control protein CcpA Mol Microbiol 30, 789–798 Westerhoff HV & van Workum M (1990) Control of DNA structure and gene expression Biomed Biochim Acta 49, 839–853 ´ Ramos A, Neves AR, Ventura R, Maycock C, Lopez P & Santos H (2004) Effect of pyruvate kinase overproduction on glucose metabolism of Lactococcus lactis Microbiology 150, 1103–1111 Thomas S & Fell DA (1998) A control analysis exploration of the role of ATP utilisation in glycolytic-flux control and glycolytic-metabolite-concentration regulation Eur J Biochem 258, 956–967 Wilson KJ, Gilles KE, Jefferson RA (1991) Beta-glucuronidase (GUS) operon fusion as a tool for studying plant–microbe interactions In Advances in Molecular Genetics of Plant–Microbe Interactions (Hennecke H & Verma DPS, eds), pp 226–229 Kluwer Academic, Dordrecht Gasson MJ (1983) Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing J Bacteriol 154, 1–9 Brøndsted L & Hammer K (1999) Use of the integration elements encoded by the temperate lactococcal bacteriophage TP901-1 to obtain chromosomal single-copy transcriptional fusions in Lactococcus lactis Appl Environ Microbiol 65, 752–758 Le Bourgeois P, Lautier M, Mata M & Ritzenthaler P (1992) New tools for the physical and genetic mapping of Lactococcus strains Gene 111, 109–114 ´ Maguin E, Prevost H, Ehrlich SD & Gruss A (1996) Efficient insertional mutagenesis in lactococci and other gram-positive bacteria J Bacteriol 178, 931–935 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Terzaghi BE & Sandine WE (1975) Improved medium for lactic streptococci and their bacteriophages Appl Microbiol 29, 807–813 Jensen PR & Hammer K (1993) Minimal requirements for exponential growth of Lactococcus lactis Appl Environ Microbiol 59, 4363–4366 Johansen E & Kibenich A (1992) Characterization of Leuconostoc isolates from commercial mixed strain mesophilic starter cultures J Dairy Sci 75, 1186–1191 FEBS Journal 272 (2005) 2292–2303 ª 2005 FEBS B Koebmann et al 28 Holo H & Nes IF (1989) High-frequency transformation, by electroporation of Lactococcus lactis subsp cremoris grown with glycine in osmotically stabilized media Appl Environ Microbiol 55, 3119–3123 29 Fordyce AM, Moore CH & Pritchard GG (1982) Phosphofructokinase from Streptococcus lactis Methods Enzymol 90, 77–82 FEBS Journal 272 (2005) 2292–2303 ª 2005 FEBS Control analysis of the las operon 30 Crow VL & Pritchard GG (1982) Pyruvate kinase from Streptococcus lactis Methods Enzymol 90, 165–170 31 Crow VL & Pritchard GG (1977) Fructose 1,6-diphosphate-activated 1-lactate dehydrogenase from Streptococcus lactis: kinetic properties and factors affecting activation J Bacteriol 131, 82–91 2303 ... GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3Â) (N ẳ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, containing synthetic... ð83:3 À alas Þ Ã ð1 À e 2:1 Jlactate alas ị ẳ 0:919 129 alas ị à ð1 À eÀ6Ãalas Þ À 75:2 (User 3:3 defined), Jacetate alas ị ẳ 0:1135 30:3 alas ị e6alas ịỵ 4:66 (User dened), Jformate alas Þ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may benefit from the way in which the las operon