... CGG ATA GAT 3’; sense: 5’ ACT CCC TCA AGA TTG TCA GCA AT 3’]; TNF -a < /b> [antisense: 5’ AGA AGA GGC ACT CCC CCA AAA 3’; sense: 5’ CCG AAG TTC AGT AGA CAG AAG AGC G 3’]; MCP-1/CCL2 [sense: 5’ CAC TAT ... for Luc and < /b> b- Gal activities using a < /b> Promega Luc assay system and < /b> an ONPG (o-nitrophenyl -b- D-galactopyranoside)-based bGal assay b- Gal activity was used to normalize the Luc data for all experiments ... EMSA probes include: wildtype TNF -a < /b> B3 sense (5’-AACAGGGGGCTTTCC-3’) and < /b> antisense (5’AGGAGGGAAAGCCCC-3’), and < /b> mutant TNF -a < /b> B3 sense (5’-AACAGGGGGCTGAGCCTC-3’) and < /b> antisense (5’-GAGGCTCAGCCCCCTGTT-3’)...
... being started by hand But now they are started by electricity a < /b> used b being c But now d are > b 33 This house is often broken off and < /b> a < /b> lot of < /b> things are taken away a < /b> is b broken c off d away ... father a < /b> than b as c but d and < /b> > a < /b> 48 I am teacher a < /b> the ba < /b> c an d no article > b 49 My uncle is good engineer a < /b> the ba < /b> c an d no article > b 50 That is eraser a < /b> the ba < /b> c an d no article ... the ba < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the ba < /b> c an d no article > a < /b> 56 We are in same class a < /b> the ba < /b> c an d no article > a < /b> 57 Your book is the desk a < /b> at b over...
... ! ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À a;< /b> bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv ð1Þ ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! where (aO2, ... the averaged bimole6112 cular oxygenation parameters in the salt-free buffers (Table 1, Average) can be considered as follows The BR rate constant for the a < /b> subunits within triliganded HbA and < /b> ... ligands leaves the b subunits (Table 1, ) Using Eqns (3) and < /b> (4), the dissociation rate constant, k, and < /b> the O2 affinity, K, can be derived for both the a < /b> and < /b> b subunits from the averaged parameters...
... phylogenetic analysis Enzyme Species GenBank/EBI A < /b> transferase A < /b> transferase A < /b> transferase A < /b> (cis A/< /b> B) transferase A-< /b> likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase ... sequences available in the NCBI database The programs used are all available from http://www.infobiogen.fr Chromosome localization The Abo gene was first assigned to a < /b> rat chromosome using a < /b> panel of < /b> ... Ó FEBS 2002 kidney, the urinary bladder, the uterus and < /b> the thymus A < /b> weaker signal was obtained from the pancreas and < /b> very weak, barely detectable, signals were visible from a < /b> salivary gland,...
... the Cardiology Departments of < /b> Hospital Universitario Central Asturias (HUCA) and < /b> Page of < /b> Hospital Universitario Valdecilla-Santander The existence of < /b> cardiac hypertrophy was suspected on the basis ... patients/controls and < /b> obtained the clinical and < /b> anthropometric data EC, MP, CG, MGC, BT, AIC, MD, BM, and < /b> VA performed all the genetic studies All the authors have read and < /b> approved the final ... intracellular signalling pathways Nat Rev Mol Cell Biol 2006, 7:589-600 Jaffré F, Bonnin P, Callebert J, Debbabi H, Setola V, Doly S, Monassier L, Mettauer B, Blaxall BC, Launay JM, Maroteaux L:...
... possible link between the elevated serum levels of < /b> neurokinin A < /b> and < /b> anti-ribosomal P protein antibodies in children with autism Gehan A < /b> Mostafa1,2, Laila Y AL-Ayadhi1 Autism Research and < /b> Treatment ... Cairo, Egypt Corresponding Author: Gehan Ahmed Mostafa Address: Ahmed El-Samman Street off Makram Ebaid, Nasr City, Cairo, Egypt E-mail.: hafezg@softhome.net, gehan_mostafa@hotmail.com Abstract: ... Center, AL-Amodi Autism Research Chair, Department of < /b> Physiology, Faculty of < /b> Medicine, King Saud University, Riyadh, Saudi Arabia and < /b> 2Department of < /b> Pediatrics, Faculty of < /b> Medicine, Ain Shams University,...
... straightforward, but given a < /b> parking function, finding the associate factorization is not obvious The proof below gives an algorithm for associating a < /b> factorization to any parking function In particular ... leave the the electronic journal of < /b> combinatorics (2002), #N7 reader to check case by case Actually we can also make use of < /b> the further symmetry (1) which was absent in the type A < /b> case Let (a1< /b> ... exists among them some (b1 , , bn ) such that b1 = and < /b> (b2 , , bn ) is a < /b> nondecreasing parking function To see this, arrange the in increasing order, and < /b> consider m = max{ai −i | ≤ i ≤ n} and...
... ttgcactttgaaacaccacatc agcttattttgggcatcttcacc gtagttttgccccatatcacacca cttcacagtcaccatcttcaaca ggtgcaccagctttttcaa ggcaggcgcagttccaccag gacatgtctccggcgtatca caaaaacggcaatgaaggaacc ctggcgagctcatcatagaactgc agaccaccaagtactactgcac ... as a < /b> convenient marker of < /b> SAR [5] There is a < /b> plethora of < /b> information about SAR and < /b> PR genes < /b> related to several model plants, especially, Arabidopsis thaliana [2], and < /b> members of < /b> the Solanaceae ... when apple Table 3: Primers used for RT-PCR and < /b> probe synthesis Gene name Primer Sequence (5' → 3') PR- 1a < /b> gctcagccgtaatacaatcctctc tacccccactactgcacctcact gtttgctgcgcccattag ttgcactttgaaacaccacatc...
... concentrated by rotary evaporation The crude extract was partitioned between 1:2 (v/v) acetonitrile and < /b> hexanes and < /b> the acetonitrile layer was collected and < /b> dried via rotary evaporation to deliver a < /b> ... were washed with 10 mL of < /b> 5% NaHCO3, water and < /b> brine The organic layer was dried over Na2SO4 and < /b> the solvent was removed on a < /b> rotary evaporator After silica gel chromatography 18.0 mg of < /b> a < /b> yellow ... °C, and < /b> dried under vacuum to afford fractions A1< /b> A5 One fraction was obtained from each column Fractions A1< /b> -A5< /b> were then labelled with an IAF tag 2-3 This was accomplished by dissolving fractions...
... 232.3 O 338 Appendix HO O 5-33 C14H16O3 232.3 OH FT-IR Data 339 AcO O O 5-32 C16H18O4 274.3 340 Appendix AcO O OAc 5-35 C18H20O5 316.3 FT-IR Data 341 AcO O 5-38 C18H20O6 332.3 OAc O 342 Appendix ... C43H36O9S2 760.9 OBn OTs O FT-IR Data 325 O OH OBn 5-11 C29H24O5 452.5 OH O 326 Appendix O O O OBn 5-12 C29H24O5 452.5 O FT-IR Data 327 O O O 5-13 C44H32O8 688.7 O O O O O 328 Appendix OTs 5-18 ... I 316 Appendix OTs 3-2 C22H19IO7S2 586.4 TsO O I FT-IR Data 317 OBn 3-3 C13H12O 184.2 318 Appendix TsO O OTs 3-24 C57H48O15S4 1101.2 OBn OTs O OTs FT-IR Data 319 3-5 C29H24O7 484.5 O OBn OH HO...
... Appendix Low-Resolution-Mass Data AcO O OAc 5-35 C18H20O5 316.3 375 AcO O 5-38 C18H20O6 332.3 OAc O 376 Appendix Low-Resolution-Mass Data HO O 5-40 C14H16O4 248.3 O OH 377 378 Appendix ... O 358 Appendix O OTs 5-10 C43H36O9S2 760.9 OBn OTs O Low-Resolution-Mass Data 359 O OH OBn 5-11 C29H24O5 452.5 OH O 360 Appendix O O O OBn 5-12 C29H24O5 452.5 O Low-Resolution-Mass Data 361 O ... Low-Resolution-Mass Data 353 OH O 5-2 C18H14O3 278.3 O 354 Appendix Low-Resolution-Mass Data 355 O 5-4 C36H24O4 520.6 O O O O O 5-6 C36H24O4 520.6 O O 356 Appendix Low-Resolution-Mass Data I OH 5-8...
... High-Resolution-Mass Data 395 O O OTs OTs OBn 5-10 C43H36O9S2 760.1801 396 Appendix O O OH OH OBn 5-11 C29H24O5 452.1624 High-Resolution-Mass Data 397 O O O O OBn 5-12 C29H24O5 452.1624 398 Appendix ... O 410 Appendix O HO O 5-28 C14H16O3 232.1099 High-Resolution-Mass Data 411 O HO OH 5-33 C14H16O3 232.1099 412 Appendix O AcO O 5-32 C16H18O4 274.1205 High-Resolution-Mass Data 413 O AcO OAc 5-35 ... OBn OTs O OTs High-Resolution-Mass Data 383 HO O OH 3-4 C29H24O7 484.1522 OBn OH O OH 384 Appendix 3-5 C29H24O7 484.1522 O OBn OH HO O O O High-Resolution-Mass Data 385 HO O HO O O O 3-26 C44H32O12...
... WinNMR ACTIVITIES & INTERESTS • Sports (Cycling, Soccer, Basketball) • Travelling (Africa, Asia, Australia, Europe) • Music PERSONAL PARTICULARS • Date of < /b> birth: July 1975 • Place of < /b> birth: Bernkastel-Kues, ... Development of < /b> anti-malaria therapeutics Boehringer Ingelheim, Vienna, Austria Research Scientist – Cancer Research Work focused on ground-breaking kinase inhibitor research and < /b> has led to a < /b> patent ... D., Baiga T J., Noel J P., DiPasquale A < /b> G., Rheingold A < /b> L., La Clair J J Discovery of < /b> Laetiporina A < /b> as a < /b> Selective Mitotic Blocker (poster presentation) PROFESSIONAL POSITIONS Member American...
... development of < /b> atopy and < /b> atopic diseases (Mackay and < /b> Rosen, 2001; Arshad, 2002; Marshall, 2004) 1.1 Definition of < /b> atopy and < /b> atopic diseases 1.1.1 Atopy Allergy is an inappropriate and < /b> harmful response ... macrophages, neutrophils and < /b> epithelial cells.” Asthma is characterized by a < /b> reversible airflow obstruction and < /b> airway inflammation, persistent airway hyperreactivity and < /b> airway remodeling (National ... transduction and < /b> the activation of < /b> a < /b> variety of < /b> transcription factors, including GATA-3, nuclear factor of < /b> activated T cells-c (NFATc), and < /b> c-maf (Roitt and < /b> Delves, 2001; Kay, 2001; Maddox and < /b> Schwartz,...
... of < /b> DIPEA or absence of < /b> base afforded no cyclization products (Table 1, entries 13 and < /b> 14) This way, it was established that both base nature and < /b> metallic counter-ion are essential to achieve good ... assistance at acquiring spectral data Supplementary data Scheme Preparation of < /b> precursor Supplementary data (experimental procedures and < /b> spectral data for compounds 1–2, 7, 8a< /b> b, 13) associated ... Nuria Esterau, (a)< /b> Ishikawa, N K.; Yamaji, K.; Taharab, S.; Fukushi, Y.; Takahashi, K Phytochemistry 2000, 54, 777; (b) Ishikawa, N K.; Fukushi, Y.; Yamaji, K.; Tahara, S.; Takahashi, K J Nat Prod...