Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens Anne Cailleau-Thomas 1 ,Be ´ atrice Le Moullac-Vaidye 1 ,Je ´ zabel Rocher, 1 Danie ` le Bouhours 2 , Claude Szpirer 3 and Jacques Le Pendu 1 1 INSERM U419, Institut de Biologie, Nantes, France; 2 INSERM U539, Faculte ´ de Me ´ decine, Nantes Cedex, France; 3 IBMM, Universite ´ Libre de Bruxelles, Gosselies, Belgium The complete coding sequence of a BDIX rat gene homo- logous to the human ABO gene was determined. Identifi- cation of the exon–intron boundaries, obtained by comparison of the coding sequence with rat genomic sequences from data banks, revealed that the rat gene structure is identical to that of the human ABO gene. It localizes to rat chromosome 3 (q11-q12), a region homolo- gous to human 9q34. Phylogenetic analysis of a set of sequences available for the various members of the same gene family confirmed that the rat sequence belongs to the ABO gene cluster. The cDNA was transfected in CHO cells alreadystablytransfectedwithana1,2fucosyltransferase in order to express H oligosaccharide acceptors. Analysis of the transfectants by flow cytometry indicated that A but not B epitopes were synthesized. Direct assay of the enzyme activity using 2¢ fucosyllactose as acceptor confirmed the strong UDP-GalNAc:Fuca1,2GalaGalNAc transferase (A transferase) activity of the enzyme product and allowed detection of a small UDP-Gal:Fuca1,2GalaGal transferase (B transferase) activity. The presence of the mRNA and of the A and B antigens was searched in various BDIX rat tissues. There was a general good concordance between the presence of the mRNA and that of the A antigen. Tissue distributions of the A and B antigens in the homozygous BDIX rat strain were largely different, indicating that these antigens cannot be synthesized by alleles of the same gene in this rat inbred strain. Keywords:ABO;N-acetylgalactosaminyltransferase; histo- blood group; antigen; rat. Histo-blood group antigens A and B are oligosaccharides carried by glycolipids and glycoproteins or present as free oligosaccharides in some biological fluids such as milk or urine. The immunodominant A and B epitopes correspond to the trisaccharides GalNAca1,3(Fuca1,2)Galb-and Gala1,3(Fuca1,2)Galb-, respectively. In humans, the ABO gene is polymorphic with A alleles encoding A transferases, B alleles encoding B transferases and O alleles encoding inactive products. The A transferases catalyse the transfer of an N-acetylgalactosamine to acceptor H substrates (Fuca1,2Galb-) whereas the B transferases catalyse the transfer of a galactose to the same substrates [1]. ABH antigens are found in many species and have a wide tissue distribution. Their main sites of expression appear to be epithelia in contact with the external environment such as the gut, the higher respiratory tract and the genito-urinary tract. In some primates, they are present on the vascular endothelium of all tissues and in chimpanzee, gorilla and man they are additionally present on erythrocytes, hence their name blood group antigens [2]. The molecular genetic basis of the human ABO alleles has been elucidated. Although many mutations have been described to date, only some of these are functionally relevant [3]. Functional analyses have been performed to determine which amino-acids are responsible for the A or B enzyme activities. These studies revealed that the amino- acids at positions 266 and 268 and to a lesser extent at position 235 were critical in determining whether the enzyme transfers an N-acetylgalactosamine, a galactose or both [4]. For example, the presence of a glycine at position 268 allows the transfer of an N-acetylgalactosamine (GalNAc). But this activity is modulated by amino-acids at the other two positions as, depending on these, transfer of Gal may become possible in addition to the transfer of GalNAc. The biological meaning of the ABO phenotypes is still largely obscure. Yet, the above mentioned tissue distribu- tion and some associations between the ABO polymor- phism and infectious diseases suggest a role in the interaction with pathogens. For example, a strong associ- ation is found between blood group O and susceptibility to cholera [5]. Moreover, various strains of bacteria can adhere to either A, B or H antigens, suggesting that microbes use them as receptors and that their host range may be influenced by the individual blood group phenotype [6]. Histo-blood group antigens or structurally related carbo- hydrates may be present on pathogens. Protective antibod- ies directed against these structures may therefore be Correspondence to J. Le Pendu, Inserm U419, Institut de Biologie, 9 Quai Moncousu, F-44093, Nantes, France. Fax: + 33 240 08 40 82, Tel.: + 33 240 08 40 99, E-mail: jlependu@nantes.inserm.fr Abbreviations: A transferase, UDP-GalNAc:Fuca1,2GalaGalNAc transferase; B transferase, UDP-Gal:Fuca1,2GalaGal transferase; CHO, Chinese hamster ovary; GalNAc, N-acetylgalactosamine; Gal, galactose; Fuc, fucose; FITC, fluorescein isothiocyanate; AEC, 3-amino-9-ethylcarbazol. Enzymes: UDP-GalNAc:Fuca1,2GalaGalNAc transferase (EC 2.4.1.40). (Received 22 March 2002, revised 12 June 2002, accepted 5 July 2002) Eur. J. Biochem. 269, 4040–4047 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03094.x differentially generated by the host, depending on the blood group phenotype [7]. The differential host range for adhesion of pathogens and the presence of protective antibodies mean that all individuals would not be equally sensitive to a given pathogen. This would provide a mechanism of protection against the pathogenic strain at the level of the population and a selective force to maintain polymorphism at the ABO locus [6]. In the present work, we report the isolation of a BDIX rat cDNA homologous to the human ABO sequences encoding for an A histo-blood group enzyme. Examination of the tissue distribution of the corresponding mRNA and of the A and B antigens in the BDIX strain of rat was performed, allowing some aspects of the ABO genetics in this species to be considered. MATERIALS AND METHODS Cloning of a rat ABO-like cDNA An EMBL-3 rat genomic DNA phage library (Clontech) was screened with a cDNA probe (P718), derived from the human blood group A transferase and corresponding to nucleotides 148–865 of the human cDNA sequence [8]. Positive recombinants were purified, digested with EcoRI and analyzed by Southern Blot using the pb718 probe. Two hybridization-positive fragments (4.0 and 3.5 kb) were obtained and digested by HinfI. The products were ligated into the pUC18 vector (Pharmacia) and sequenced. One clone, from the 4 kb fragment digest, contained an insert of 406 bp, a stretch of which was 84.4% similar to exon 6 of the human blood group A gene coding sequence. The complete coding sequence was obtained by RACE/PCR using primers deduced from this fragment. To this end, total RNA from BDIX rat stomach was extracted using the SV Total RNA isolation kit from Promega. This RNA preparation was used to obtain mRNA using the Oligotex kit from Qiagen. Double stranded cDNA synthesis, adaptor ligation and RACE/PCR were performed using the Clon- tech Marathon cDNA Amplification kit. Elongation in the 5¢ direction was performed using an inverted primer deduced from the 406 bp fragment homologous to the human A gene (GTCGATGTTGAAGGTCCCCTCCCA GATG) and the adaptor AP1 primer provided by the supplier. The second nested PCR was performed using a nested inverted primer deduced from the same fragment sequence (TCCCAGATGATGGGAGCCACGCCAA GG) and the nested adaptor AP2 primer from the supplier. Synthesis in the 3¢ direction was performed by the same method using the following first primer (CTTGTCTTCACTCCTTGGCTGGCTCCCAT) and the adaptor AP1 primer, followed by a second nested PCR with the second nested primer (CATCTGG GAGGGGACCTTCAACATCGAC). The PCR was run with the Advantage Polymerase (Clontech) and the man- ufacturer’s touchdown-RACE program. The PCR products were ligated into the pUC18 vector and sequenced. To obtain the full coding fragment, stomach cDNA was PCR amplified using the following primers, deduced from the sequence of the 5¢ and 3¢ RACE products: AC CATCCCGGGCCTTGCATGGA (forward) and GCTA CAGGTACCGCCTCTCCAA (reverse). The product was ligated into the pUC18 vector and sequenced. Sequence analysis Multiple alignments were performed with the CLUSTALW program [9]. Genetic distances of the complete deduced peptide sequences were calculated by the ÔNeighbor joiningÕ method from the PHILIP program. Approximate location of transmembrane regions were determined using the TMHMM , TMAP and TOPPRED 2 programs. Determination of the exon/ intron boundaries were obtained by analysis of the rat genomic sequences available in the NCBI database. The programs used are all available from http://www.infobio- gen.fr. Chromosome localization The Abo gene was first assigned to a rat chromosome using a panel of standard rat X mouse cell hybrids that segregate rat chromosomes [10]. The hybrids were typed by PCR with the following primers: 5¢-GGAGCAGCTGGAGT CATG-3¢ and 5¢-GGTCATCCTGTATCCTTCA-3¢ (the 5¢ end of these primers corresponds to the positions 163 and 270, respectively, of [35104745] from the Rattus norvegicus WGS trace database). For regional localization, the panel of rat · hamster radiation cell hybrids [11] was typed in the same manner. The mapping results were obtained from the rat radiation hybrid map server at the Otsuka GEN Research Institute (http://ratmap.ims.u-tokyo.ac.jp/menu/ RH.html) [11]. RT-PCR analysis Total RNAs (1 lg) from various rat tissues listed below were prepared using the SV Total RNA isolation System kit from Promega and reverse transcribed at 42 °Cwiththe M-MLV reverse transcriptase from Promega. Contaminat- ing DNA had been removed by digestion with RNAse-free DNAseI (10 unitsÆlg )1 RNA) for 15 min at room temper- ature. Amplification of the cDNA corresponding to the A enzyme cDNA was performed with the following primers: CAGACGGATGTCCAGAAAGTTG and: GCTACAG GTACCGCCTCTCCAA. Amplification was performed using the Advantage Polymerase (Clontech) with initial denaturation at 94 °C 3 min, followed by 30 cycles of 94 °C 30 s, 64 °C45s,68°C 2 min. The amplification yields a product of 929 bp. The control of cDNA quality was performed by amplification of glyceraldehyde phosphate dehydrogenase (GAPDH). Transfection of CHO cells The complete coding sequence of the rat A gene was inserted into the pDR2 eukaryotic expression vector (Clontech) deleted of the sequences lying between the EcoRV and ClaI sites. Chinese hamster ovary carcinoma cells, CHO cells, are devoid of a1,2fucosyltransferase activity and therefore of ABH antigens. They were first transfected using LipofectAMIN TM with the rat a1,2fuco- syltransferases cDNA FTB (GenBank accession number AF131238) in the pBK-CMV expression vector (Gibco, Paisley, UK) according to the manufacturer’s instructions. Twenty-four hours later, fresh medium was added and 48 h later, selective medium containing 0.6 mgÆmL )1 G418 (Gibco) was added. Transfected cells expressing a1,2-linked Ó FEBS 2002 Rat histo-blood group A enzyme (Eur. J. Biochem. 269) 4041 fucose residues were selected by flow cytometry, using fluorescein isothiocyanate (FITC)-labeled UEA-I, after cloning by limiting dilutions as previously described [12]. For each cell line, a strongly expressing clone was selected and transfected a second time using the same procedure with the rat A enzyme cDNA in the pDR2 vector. Forty- eight hours later, cells were cultured in selective medium containing 0.6 mgÆmL )1 hygromycin. After cloning by limiting dilutions, strongly A antigen expressing transfec- tants were selected. Control transfected cells were prepared by transfection with the empty vectors. These stable transfectants were cultured in RPMI 1640, 10% fetal bovine serum, 2 m ML -glutamine, free nucleotides (10 lgÆmL )1 ), 100 UÆmL )1 penicillin and 100 lgÆmL )1 streptomycin (Gibco) supplemented with 0.25 mgÆmL )1 G418 and 0.2 mgÆmL )1 hygromycin. They were cultured at confluence after dispersal with 0.025% trypsin in 0.02% EDTA. Cells were routinely checked for mycoplasma contamination by Hoescht 33258 (Sigma, St Louis, MO, USA) labeling. Cytofluorimetric analysis Viable cells (2 · 10 5 per well) were incubated with antibod- ies at the appropriate dilutions in NaCl/P i containing 0.1% gelatin for 1 h at 4 °C. Optimal concentrations of antibodies were chosen after serial dilutions to obtain the strongest positive signal without cell death. The anti-A mAb 3–3 A was obtained from J. Bara (INSERM U482, Villejuif, France). It recognizes all types of A antigens [13] and does not show any detectable cross reactivity with B epitopes as judged from enzyme immunoassay with synthetic oligosac- charides and immunostaining of human tissues of known ABO phenotypes. The anti-B mAb ED3 is a gift from A. Martin (CRTS, Rennes, France). It recognizes all types of B and shows no detectable cross-reactivity with A epitopes or with the Gala1,3Gal epitope [14]. Following the first incubation with monoclonal antibodies, after three washes with the same buffer, a second 30 min incubation was performed with the FITC-labeled anti-(mouse Ig) Ig under the same conditions. After washings in the same buffer, fluorescence analysis was performed on a FACScan (Beckton–Dickinson) using the CELLQUEST program. Detection of enzyme activity Confluent transfected CHO cells were rinsed with ice-cold NaCl/P i , pH 7.2, then recovered by scraping. After washing with ice-cold NaCl/P i , cells were solubilized in 50 m M cacodylate pH 7.0, containing 2% (v/v) Triton X-100 on ice for 30 min Following a centrifugation at 13 000 g for 10 min, the supernatant was collected and used as a crude enzyme preparation. Protein concentration was determined using bicinchoninic acid. The reaction mixture contained: 50 lg protein extracts, 30 m M MnCl 2 ,5m M ATP, 10 m M NaN 3 ,5m M 2¢ fucosyllactose and 20 l M UDP- D -[ 14 C]N-acetylgalactosamine (55 mCiÆmmol )1 ,ICN, Costa Mesa, CA, USA) or 20 l M UDP- D -[ 14 C]galactose (278 mCiÆmmol )1 , NEN, Chemical Center, Dreieichen- dain, Germany) in a final volume of 50 lLandwas incubated at 37 °C for 16 h. After incubation, the reaction mixture was quenched with 750 lL distilled water and applied to an AG1-X8 column, chloride form, 100–200 mesh (Bio-Rad, Hercules, CA, USA). The radiolabeled product was then eluted with 1 mL water and counted in 5 mL scintillation liquid (Ready Safe TM , Beckman, Palo Alto, CA, USA). Background levels of radioactivity were obtained from controls without exogenous acceptor. Values obtained for the controls were then subtracted from those obtained for the assays. Immunohistological analysis Tissues from 2- to 3-month old rats were collected and immediately frozen or paraffin embedded. Sections (5 lm) werepreparedandwashedinNaCl/P i . Endogenous peroxidase was inhibited using methanol/H 2 O 2 0.3% for 20 min. Sections were then washed in NaCl/P i for 5 min and covered with NaCl/P i /BSA 1% for 20 min at room temperature in a moist chamber. After washing in NaCl/P i , sections were covered with either the primary antibodies diluted in NaCl/P i /BSA 1% and left at 4 °Covernight. Sections were then rinsed thrice with NaCl/P i and incubated with biotinylated anti-(mouse IgG) Ig (Vector Laboratories, Burlingame, CA, USA) diluted at 1/100 for 60 min at room temperature. After washing in NaCl/P i , the sections were covered with peroxidase-conjugated avidin (Vector Labo- ratories) diluted at 1 : 1000 for 45 min, washed with NaCl/ P i and reactions were revealed with 3-amino-9-ethylcarbazol (AEC). Counterstaining was performed with Mayer’s hemalun. RESULTS Sequence analysis A coding sequence homologous to the human ABO coding sequences was isolated (GenBank accession AF264018). It possesses an open reading frame of 1047 bp, 77% identical with the human A gene coding region. Comparisons of this sequence with genomic sequences available in the rat genome data bank allowed determination of the exon/ intron boundaries as they conform to the GT-AG consensus rule (Fig. 1). The gene organization appears similar to that of the human ABO gene with seven exons [15]. The same analysis was performed on the mouse A/B gene orthologous to the human ABO gene [16]. This gene lacks exon 4. At the amino-acid level, the rat sequence shows 70, 71 and 77% identity with the human, pig and mouse sequences, respec- tively (Fig. 2A, Table 1). Like all glycosyltransferases the Fig. 1. Comparison of the rat Abo gene exonic structure with those of the human and mouse orthologs. Organization of the human and mouse genes has been previously reported. Exons are represented by boxes numbered in bold. Nucleotide numbers limiting the exons are noted in superscript. For the mouse gene, a search in the mouse genomic data bank confirmed the absence of one exon, corresponding to exon 4 of the other two species, as the genomic sequence separating mouse exons 3 and 4 revealed no potential exonic sequence with homology to the human and rat exon 4. 4042 A. Cailleau-Thomas et al. (Eur. J. Biochem. 269) Ó FEBS 2002 rat enzyme presents a short N-terminal intracytoplasmic domain, a transmembrane domain followed by a stem region and a catalytic domain, the latter domain presenting the highest identity among the four sequences. Of note, the presence of a conserved potential N-glycosylation site at the beginning of the catalytic domain. Previous studies of the human ABO transferases underscored the major importance of the amino-acid at position 268 with a glycine determining A activity whereas an alanine determines B activity. A glycine is present at the homologous position in the rat sequence (position 263), suggesting a potential A enzyme activity. At present, the ABO gene family is known to comprise four members, the ABO gene itself, the a3galactosyltrans- ferase (pseudo B) gene [17], the aN-acetylgalactosaminyl- transferase or Forssman synthetase gene [18] and the a-galactosyltransferase iGb3 synthetase gene [19]. Phylo- genetic analysis of this gene family revealed a clear distinction between the four genes, with the new rat sequence falling within the ABO cluster (Fig. 2B). Chromosome localization of the rat Abo gene The gene was first assigned to rat chromosome 3, using a panel of 16 standard rat X mouse cell hybrid clones segregating rat chromosomes. No discordant clone was obtained for chromosome 3, while at least two discordant clones were counted for each other chromosome (data not shown). Chromosome placement by radiation hybrid map- ping confirmed this result, with a precise localization between D3Rat54 (at 58cR, lod score ¼ 5.67) and D3Rat50 (at 62cR, lod score ¼ 5.12). This position corre- sponds to the centromeric region of the chromosome (bands 3q11–q12). This rat chromosome region is known to be homologous to the human region 9q34 [20,21], where the human ABO gene resides [22]. Determination of the enzyme activity In order to study the functional characteristics of the rat A-like gene, the cDNA was transfected in CHO cells already stably transfected with an a2fucosyltransferase cDNA, namely the rat FTB [23]. The presence of this fucosyltrans- ferase in CHO cells allows expression of H histo-blood group structures which are compulsory precursors of the A and B antigens. Stable doubly transfected cells were isolated and tested by flow cytometry for their expression of A or B antigens (Fig. 3). A positive control cell line (MT-450) known to constitutively express both antigens indicated that the antibodies readily detected their respective epitopes when present [24]. The doubly transfected CHO cells were strongly labeled by the anti-A reagent, but not significantly Fig. 2. Comparison of the amino acid sequences of the A or cis A/B transferases in four species (A) and phylogenetic analysis of the ABO gene family (B). (A) Identical residues are marked by arrows. The transmembrane regions are highlighted in grey, the conserved N-gly- cosylation site is boxed and the amino-acids corresponding to positions 266 and 268 of the human sequence are labeled in white on black boxes. The numbering corresponds to that of a consensus sequence. (B) Genetic distances were calculated from CLUSTALW multiple align- ments using the Ôneighbour joiningÕ method from the sequences listed in Table 1. The scale bar represents the number of substitutions per site for a unit branch length. Table 1. Identification of the ABO gene family sequences used for the phylogenetic analysis. Enzyme Species GenBank/EBI A transferase Human J05175 A transferase Rat AF264018 A transferase Pig AF050177 A(cis A/B) transferase Mouse AB041039 A-like a Human M65082 Gal transferase Platyrrhini S71333 Gal transferase Marmoset A56480 Gal transferase Cow J04989 Gal transferase Pig L36152 Gal transferase Mouse M85153 Gal transferase Rat AF520589 IGb3 synthetase Human AL513327 IGb3 synthetase Rat AF246543 Forssman synthetase a Human AF163572 Forssman synthetase Dog CFU66140 a Pseudogenes. Ó FEBS 2002 Rat histo-blood group A enzyme (Eur. J. Biochem. 269) 4043 by the anti-B reagent, suggesting that the new rat gene encodes an enzyme with the catalytic activity of the A histo- blood group transferase. To confirm this result, the enzyme activity was directly assayed on cell extracts of CHO transfectants (Fig. 4). No transfer of galactose or N-acetylgalactosamine could be detected on extracts from the control FTB transfected cells using 2¢ fucosyllactose as acceptor. However, cell extracts from the double transfec- tants showed a high N-acetylgalactosaminyltransferase activity and a weak galactosyltransferase activity. These results indicate that the new rat enzyme is indeed an A histo- blood group transferase with a small B transferase activity. Tissue expression of the mRNA and of the A and B antigens in the rat An RT-PCR analysis was performed to determine the tissue expression of the rat Abo gene. Primers were chosen to encompass different exons so as to confirm amplifica- tion of cDNA and lack of contamination by genomic DNA. A band at the expected size was detected in various tissues as indicated in Table 2. A strong signal was obtained in the oesophagus, the stomach, the colon, the Fig. 3. Cytofluorimetric analysis of cell surface A and B antigens of stably transfected CHO cells. CHO cells previously transfected with the rat FTB cDNA encoding an a1,2fucosyl- transferase were cotransfected with the rat A enzyme cDNA. Stable transfectants were iso- lated and one of these clones was used for analysis. The MT-450 cell line, a mammary carcinoma cell line from the w/Fu rat strain, was used as positive control. The A and B antigens were detected using the 3–3 A and ED3 Mabs, respectively. The Logs of fluo- rescence intensities are plotted against cell numbers. Negative controls were performed in absence of primary antibody. Fig. 4. Enzymatic assays of CHO transfectant cell extracts. The same stable transfectants of CHO cells used for the cytofluorimetric analysis of the A or B antigens expression (Fig. 3) were used to assay the enzyme activity. Cell extracts were prepared as described in the Materials and methods section. Activities were determined using 2¢ fucosyllactose as acceptor substrate and either UDP-[ 14 C]galactose or UDP-[ 14 C]N-acetylgalactosamine as donor substrates. The product of the reaction was separated on AG1-X8 anion exchange columns. The background was determined in absence of acceptor substrate and its value was deduced from the values obtained in the presence of the acceptor. Values of the specific activities are given in pmolÆh )1 Æmg protein )1 of either [ 14 C]galactose or [ 14 C]N-acetylgalac- tosamine transferred. Table 2. Tissue distribution of the Abo mRNA and of the A and B antigens in the BDIX rat. Transcripts were detected by RT-PCR from total RNA extracts of various rat tissues using specific primers. An indication of the intensity of the detected band is given, with +++ corresponding to the strongest signal and – to no detectable signal. The A and B antigens were detected by immunohistochemistry on frozen tissue sections using well characterized specific monoclonal antibodies. In tissues positive for both A and B antigens, the cellular distribution of the two antigens is not always identical (see text for details). The labeling by the anti-A antibody was the same on paraffin embedded sections, but no B antigen was detected on such sections. ND ¼ not done. Tissue mRNA A antigen B antigen Tongue ND +++ – Oesophagus ++ ++ – Stomach ++ ++ ++ Small intestine – – – Caecum ND +++ +++ Large intestine +++ +++ ++ Pancreas + +++ ++ Parotid gland ND +++ – Submaxillary gland +– ++ ++ Liver – – – Trachea ND – – Lung – – – Kidney ++ – ++ Urinary bladder ++ – – Ovary – – – Uterus ++ +++ – Testis – – – Seminal vesicle ND +++ – Thyroid gland ND +++ – Parathyroid gland ND +++ – Brain – – – Muscle +– – – Skin – – – Spleen +– – – Thymus ++ ++ – Lymph node – – – 4044 A. Cailleau-Thomas et al. (Eur. J. Biochem. 269) Ó FEBS 2002 kidney, the urinary bladder, the uterus and the thymus. A weaker signal was obtained from the pancreas and very weak, barely detectable, signals were visible from a salivary gland, muscle and spleen. The presence of this mRNA was compared with that of the A and B histo- blood group antigens in the various rat tissues. The A antigen appeared to have a wider distribution than the B antigen as shown in Table 2 and Fig. 5. There was a general agreement between the presence of the A antigen and that of the Abo gene mRNA. Indeed, the A antigen was expressed in the oesophagus, the stomach, the large intestine (Fig. 5a), the pancreas, the uterus (Fig. 5g), the seminal vesicle (Fig. 5h) and the thymus (Fig. 5e), while it was essentially absent from the small intestine like the mRNA, although a few glands were positive (Fig. 5c). However, a strong antigen expression was noted in the submaxillary gland whereas the mRNA was barely detected. Conversely the mRNA was readily detected in the kidney and the urinary bladder whereas the antigen was not. The B antigen was detected in fewer tissues than the A antigen. It could not be found in the tongue, the oesophagus, the parotid gland, the uterus, the seminal vesicle, the thyroid and parathyroid glands and the thymus where the A antigen was present. Inversely, the B antigen but not the A antigen could be detected in the kidney. In this organ its distribution was limited to some tubules of the medulla (Fig. 5f). In those tissues where both the A and B antigens were present, their cellular distribution differed. For example, in the stomach, the A antigen was mainly present on cells of the neck area and on the parietal cells of the gastric glands whereas the B antigen was present on the pits epithelial cells and the chief cells of the glands. In the large intestine and the caecum, the A antigen was strongly expressed throughout the mucosa whereas presence of the B antigen was restricted to the surface epithelium (Fig. 5a,b). In the submaxillary gland, the A antigen was expressed in the secretory cells and the B antigen in the duct cells. The A and B antigens were only coexpressed in the pancreas acinar cells (Fig. 5d) and in some sebaceous glands of the skin. DISCUSSION A rat cDNA homologous to the human ABO gene has been cloned. It encodes a protein with a strong A transferase and a small B transferase activity in vitro. The human A enzyme also is known to possess a small B transferase activity [25]. Yet, this activity is not comparable with that of cis A/B human alleles or of the mouse enzyme which are char- acterized by their ability to transfer galactose and N-acetylgalactosamine about equally well [16]. That the rat enzyme described here is truly an A enzyme is confirmed by the fact that upon transfection into CHO cells, A antigen was readily detected whereas B antigen was not. In addition, there were BDIX rat tissues strongly expressing A antigen and no detectable B antigen. The ABO gene structure is conserved between rat, pig and man while one exon (exon 4) has been lost in the mouse. As the mouse cDNA encodes an active enzyme, it is clear that this exon is not required for enzyme activity. This is not surprising as it corresponds to a part of the stem region of the enzyme. Nevertheless, it could affect the type of structures used by the mouse enzyme as acceptor substrates, i.e. glycolipids vs. glycoproteins or the type of precursor. Previous detailed studies aimed at defining the amino-acid residues that determine the A or B specificity of the human enzymes have been performed by site-directed mutagenesis. From this work, it could be concluded that residues at positions 266 and 268 were critical and that the residue at position 235 was influencial [3]. At the position correspond- ing to amino-acid 235 of the human sequence, the rat and pig A enzymes have a glycine residue like the human A and mouse cis A/B enzymes. Of the three positions, 268 is considered the most important and, as noted above, a glycine at this position characterizes the A activity. The rat sequence reported herein has a glycine at the position equivalent to human 268 in accordance with its A enzymatic activity. Similar to the pig enzyme [26], but at variance with the human A enzymes, it has an alanine at position 266. In man, as well as in anthropoid apes, a leucine is present at this position, confirming that it is indeed less important than the amino-acid at position 268 in determining the A or B specificity of the enzyme. Phylogenetic analysis including sequences of the four known members of the ABO gene family confirmed that Fig. 5. Immunohistochemical analysis of the A and B antigens expres- sion in BDIX rat tissues. Frozen BDIX rat tissues sections were incu- bated with an anti-A (a, c, e, g, h) or an anti-B (b, d, f) Mab and their binding was detected as described in the Ômaterials and methodsÕ section. In the large intestine, the A antigen is detected throughout the mucosa (a) whereas the B antigen is restricted to the surface epithelium (b). In the small intestine, the A and B antigens are absent except for a few glands displaying A antigen (c). In the pancreas, both antigens are present on the acinar cells as illustrated for the B antigen (d). In the thymus some medullary epithelial cells express the A epitopes (e). In the kidney medulla, some tubules are B positive (f). The A antigen is present in the uterine epithelium (g) and the seminal vesicle (h). Ó FEBS 2002 Rat histo-blood group A enzyme (Eur. J. Biochem. 269) 4045 these four genes can be clearly separated across various species. In addition, despite the small number of sequences available for two of the genes, genetic distances among species for each gene were quite similar, suggesting that they evolved at about equal rates. From this, one can speculate that the four members of the ABO gene family are submitted to the same kind of selective pressure. We generally observed a good concordance between the presence of the mRNA and of the A antigen in tissues. Nevertheless, there were some discrepancies in tissues such as the kidney and the urinary bladder where the mRNA was easily detected but which did not express A or B epitopes. The presence of a glycosyltransferase mRNA and the corresponding glycan structure may not always correlate as the mRNA may not necessarily be translated or the appropriate precursor glycans may not be available. In the present case, H antigen, the precursor of the A or B antigens is not synthesized in the rat urinary bladder epithelium (data not shown). Some H antigen should be present in the kidney as B antigen was detected. This is in accordance with the fact that the rat FTA a1,2fucosyltransferase mRNA can be detected in the BDIX rat kidney [23]. One would thus expect to find some A antigen in the rat kidney. However, the A enzyme mRNA may not be expressed in the same cells as the FTA mRNA. Further studies by in situ hybridization are required to clarify this point. In humans, A or B antigens are present on glycolipids as well as on glycoproteins and based on various types of precursors [27]. In rats, the A and B antigens have been characterized on glycolipids [28–30]. A polymorphism of the expression of the A-active glycolipids has been found among various strains of inbred rats [31]. The A antigen is also present on glycoproteins as it can be detected by Western blotting on various bands from the transfected cells (data not shown) or other A positive cell types from BDIX rats [32,33] and as it has been characterized on glycopeptides from Sprague–Dawley rats. At variance, the B antigen could not be found on such glycopeptides [34]. In addition, the A antigen is still strongly detected on paraffin embedded rat tissue sections [35]. Paraffin embedding-deparaffination is known to remove glyco- lipids, therefore the remaining antigenic activity should correspond to glycoproteins, while frozen sections contain both glycoproteins and glycolipids. In the present study, the B reactivity was only detected on frozen sections and not on paraffin embedded sections, suggesting that it is restrited to glycolipids. The tissues that express most ABH antigens in humans are quite similar to those that express A antigen in the rat although there are some notable differences. Unlike humans, rats do not present these antigens on erythrocytes, the vascular endothelium or the epidermis. There are also some regional differences. Most strains of rats, like the BDIX strain used in this study, do not express the A antigen in the small intestine although they express H antigen. Inversely, A and H antigens are present in the large intestine down to the rectum whereas they are absent from the human rectal and distal colonic epithelia [36]. Another major difference between humans andratsintermsoftissueexpressionoftheAandB antigens is that in man A and B epitopes are expressed in the same cell types whereas in the rat they are not. It had been observed earlier that B, but not A, antigen is developmentally expressed on rat cochlear hairy cells and on olfactory cells [37,38]. In the present study, we noticed that with the exception of the pancreas and the skin, in rat organs, the A and B antigens never codistributed at the cellular level. It is unlikely that mAb ED3, the anti-B that we used, detected the related pseudo-B or Gala1,3Gal epitope as the antibody did not react with the synthetic disaccharide (data not shown) and as this potentially cross-reactive epitope is expressed on the rat vascular endothelium to which mAb ED3 did not bind. Neverthe- less, the possibility that mAb ED3 detects another B-like structure cannot be completely eliminated. BDIX is a rat strain that has been generated in the 1940s and is inbred. Therefore, in these animals, the B antigen cannot be synthesized by the enzyme product of an allele at the Abo locus. It is to be expected that another gene encodes a galactosyltransferase with B histo-blood group activity. The enzyme activity of the rat pseudo B a3galactosyl- transferase has not been reported as yet. One possibility is that, unlike in other species, this enzyme could have the ability to transfer a galactose residue in a1,3 linkage to a1,2fucosylated precursor glycolipids. It could also be that one of the two other known members of the family, namely the iGb3 synthetase and the Forssman synthetase, could have a dual specificity. Alternatively, there could exist another gene in the rat genome encoding a B-like blood group transferase that would act exclusively on glycolipids. These possibilities remain to be tested. Availability of the rat A gene sequence will allow the search of genetic polymorphisms at the Abo locus in this species. Comparisons of the tissue expression across species, as well as of the sequences and genetic polymorphisms of various mammals should help understanding the biological significance of ABO antigens during evolution. The results presented here should be useful in such future analyses. ACKNOWLEDGEMENTS The authors are grateful to Drs J. Bara and A. Martin for their generous gift of antibodies, to Dr M. Cle ´ ment for help with the pictures, to Mrs P. Fichet and S. Minaut for great animal care and to Pascale Van Vooren for excellent technical assistance. They thank Dr J F. Bouhours for helpul discussions. The work was supported by grants from the Association for International Cancer Research (AICR), the Association pour la Recherche sur le Cancer (ARC) and the Fund for Scientific Medical Research (FRSM, Belgium). C. S. is a Research Director of the National Fund for Scientific Research (FNRS, Belgium). REFERENCES 1. Watkins, W.M. (1999) A half century of blood-group antigen research. Some personal recollections. Trends Glycosci. Glycotech. 11, 391–411. 2. Oriol, R., Mollicone, R., Couillin, P., Dalix, A.M. & Candelier, J.J. (1992) Genetic regulation of the expression of ABH and Lewis antigens in tissues. APMIS. 100 (Suppl. 27), 28–38. 3. Yamamoto, F. (2000) Molecular genetics of ABO. Vox Sang. 78, 91–103. 4. Yamamoto, F. & McNeill, P.D. (1996) Amino acid residue at codon 268 determines both activity and nucleotide-sugar donor substrate specificity of human histo-blood group A and B trans- ferases. J. Biol. Chem. 271, 10515–10520. 5. Glass, R.I., Holmgren, J., Haley, C.E., Khan, M.R., Svennerholm, A.M.,Stoll,B.J.,BelayetHossain,K.M.,Black,R.E.,Yunus,M. 4046 A. Cailleau-Thomas et al. (Eur. J. Biochem. 269) Ó FEBS 2002 & Barua, D. (1985) Predisposition for cholera of individuals with O blood group. Possible evolutionary significance. Am.J.Epi- demiol. 121, 791–796. 6. Marionneau, S., Cailleau-Thomas, A., Rocher, J., Le Moullac- Vaidye, B., Ruvoe ¨ n-clouet, N., Cle ´ ment, M. & Le Pendu, J. (2001) ABH and Lewis histo-blood group antigens, a model for the meaning of oligosaccharide diversity in the face of a changing world. Biochimie 83, 565–573. 7. Preece, A.F., Strahan, K.M., Devitt, J., Yamamoto, F.F. & Gustavson, K. (2002) Expression of ABO or related antigenic carbohydrates on viral envelopes leads to neutralization in the presence of serum containing specific natural antibodies and complement. Blood 99, 2477–2482. 8. Yamamoto, F., Marken, J., Tsuji, T., White, T., Clausen, H. & Hakomori, S.I. (1990) Cloning and characterization of DNA complementary to human UDP-GalNAc: Fuca1–2Gala1–3Gal- NAc transferase (histo-blood group A transferase) mRNA. J. Biol. Chem. 265, 1146–1151. 9. Thompson, J.D., Higgins, D.G. & Gibson, T.J. (1994) ClustalW: improving the sensitivity of progressive multiple sequence align- ment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. 10. Szpirer,J.Levan,G.Tho ¨ rn, M. & Szpirer, C. (1984) Gene map- ping in the rat by mouse-rat cell hybridization: synteny of the albumin and alpha-foetoprotein genes and assignment to chro- mosome 14. Cytogenet. Cell Genet. 38, 142–149. 11. Watanabe, T.K. Bihoreau, M.T. McCarthy, L.C. Kiguwa, S.L. Hishigaki, H. Tsuji, A. Browne, J. Yamasaki, Y. Mizoguchi- Miyakita, A. Oga, K. Ono, T. Okuno, S. Kanemoto, N. Takah- ashi, E. Tomita, K. Hayashi, H. Adachi, M. Webber, C. Davis, M. Kiel,S.Knights,C.Smith,A.Critcher,R.Miller,J.Thangarajah, T. Day, P.J.R. Hudson, J.R. Irie, Y. Takagi, T. Nakamura, Y. Goodfellow, P.N. Lathrop, G.M. Tanigami, A. & James, M.R. (1999) A radiation hybrid map of the rat genome containing 5,255 markers. Nat. Genet. 22, 27–36. 12. Goupille, C. Marionneau, S. Bureau, V. Hallouin, F. Meichenin, M. Rocher, J. & Le Pendu, J. (2000) a1,2fucosyltransferase increases resistance to apoptosis of rat colon carcinoma cells. Glycobiol. 10, 375–382. 13. Bara, J. Gautier, R. Le Pendu, J. & Oriol, R. (1988) Immuno- chemical characterization of mucins. Polypeptide (M1) and poly- saccharide (A and Le b )antigens.Biochem. J. 254, 185–193. 14. Le Pendu, J. Le Cabellec, M. & Bara, J. (1997) Immunohisto- logical analysis of antibodies against ABH and other glycocon- jugates in normal human pyloric and duodenal mucosae. Transfus Clin. Biol. 1, 41–46. 15. Yamamoto, F. McNeill, P.D. & Hakomori, S.I. (1995) Genomic organization of the human histo-blood group ABO genes. Glycobiol. 5, 51–58. 16. Yamamoto, M. Lin, X H. Kominato, Y. Hata, Y. Noda, R. Saitou, N. & Yamamoto, F. (2001) Murine equivalent of the human histo-blood group ABO gene is a cis-AB gene that encodes a glycosyltransferase with both A and B transferase activity. J. Biol. Chem. 276, 13701–13708. 17. Joziasse, D.H. Shaper, J.H. Van den Eijnden, D.H. Van Tunen, A.J. & Shaper, N.L. (1989) Bovine alpha1–3galactosyltransferase: isolation and characterization of a cDNA clone. Identification of homologous sequences in human genomic DNA. J. Biol. Chem. 264, 14290–14297. 18. Xu, H. & Storch, T., Yu.M. Elliott, S.P. & Haslam, D.B. (1999) Characterization of the human Forssman synthetase gene. J. Biol. Chem. 274, 29390–29398. 19. Keusch,J.J.Manzella,S.M.Nyame,K.A.Cummings,R.D.& Baenziger, J.U. (2000) Expression cloning of a new member of the ABO blood group glycosyltransferases, iGb 3 synthase, that directs the synthesis of isoglobo-glycosphingolipids. J. Biol. Chem. 275, 25308–25314. 20. Nilsson, S. Helou, K. Walentinsson, A. Szpirer, C. Nerman, O. & Stahl, F. (2001) Rat-mouse and rat-human comparative maps based on gene homology and high-resolution zoo-FISH. Genomics 74, 287–298. 21. RATMAP Rat Genome Database, http://ratmap.Generalgu.se/ 22. Henske, E.P., Ozelius, L., Anderson, M.A. & Kwiatkowski, D.J. (1992) A radiation-reduced hybrid cell line containing 5 Mb/17 cM of human DNA from 9q34. Genomics 13, 841–844. 23. Bureau, V., Marionneau, S., Cailleau-Thomas, A., Le Moullac- Vaydie, B., Liehr, T. & Le Pendu, J. (2001) Comparison of the three rat GDP- L -fucose: b- D -galactoside 2-a- L -fucosyltransferases FTA, FTB and FTC. Eur. J. Biochem. 268, 1006–1019. 24. Sleeman, J.P., Kim, U., Le Pendu, J., Howells, N., Coquerelle, T., Ponta, H. & Herrlich, P. (1999) Inhibition of MT-450 rat mam- mary tumour growth by antibodies recognising subtypes of blood group antigen B. Oncogene 18, 4485–4494. 25. Yates, A.D. & Watkins, W.M. (1982) The biosynthesis of blood group B determinants by the blood group A gene specified a-3- N-acetylgalactosaminyltransferase. Biochem. Biophys. Res. Com- mun. 109, 958–965. 26. Meijerink, E., Neuenschwander, S., Dinter, A., Yerle, M., Stranzinger, G. & Vogeli, P. (2001) Isolation of a porcine UDP- GalNAc transferase cDNA mapping to the region of the blood groupEAAlocusonpigchromosome1.Anim. Genet. 32, 132–138. 27. Clausen, H. & Hakomori, S.I. (1989) ABH and related histo- blood group antigens; immunochemical differences in carrier iso- types and their distribution. Vox Sang. 56, 1–20. 28. Breimer, M.E., Hansson, G.C., Karlsson, K.A. & Leffler, H. (1982) Glycosphingolipids of rat tissues. Different composition of epithelial and nonepithelial cells of small intestine. J. Biol. Chem. 257, 557–568. 29. Hansson, G.C., Bouhours, J.F. & Angstro ¨ m, J. (1987) Char- acterization of neutral blood group B-active glycosphingolipids of rat gastric mucosa. J. Biol. Chem. 262, 13135–13141. 30. Hansson, G.C. (1983) The structure of two blood group A-active glycosphingolipids with 12 sugars and a branched chain present in the epithelial cells of rat small intestine. J. Biol. Chem. 258, 9612–9615. 31. Bouhours, D., Hansson, G.C. & Bouhours, J.F. (1995) Structure and genetic polymorphism of blood group A-active glycoshingo- lipids of the rat large intestine. Biochem. Biophys. Acta 1255, 131–140. 32. Laferte, S., Prokopishyn, N.L., Moyana, T. & Bird, R.P. (1995) Monoclonal antibody recognizing a determinant on type 2 chain blood group A and B oligosaccharides detects oncodevelopmental changes in azoxymethane-induced rat colon tumors and human colon cancer cell lines. J. Cell. Biochem. 57, 101–119. 33. Me ´ noret, A., Otry, C., Labarrie ` re, N., Breimer, M.E., Piller, F., Meflah, K. & Le Pendu, J. (1995) The expression of carbohydrate blood group antigens correlates with heat resistance. J. Cell Sci. 108, 1691–1701. 34. Norrsell, H., Bengtsson, J., Jovall, P.A. & Hansson, G.C. (1992) N-linked glycopeptides with blood group determinants lacking neuraminic acid from the epithelial cells of rat small and large intestine. Eur. J. Biochem. 203, 285–293. 35. Hallouin, F., Goupille, C., Le Cabellec, M., Bara, J. & Le Pendu, J. (1997) Expression of A and H blood-group and of CD44 anti- gens during chemical rat colonic carcinogenesis. Glycoconj. J. 14, 801–808. 36. Ravn, V. & Dabelsteen, E. (2000) Tissue distribution of histo- blood group antigens. APMIS 108, 1–28. 37. Gil-Loyzaga, P., Pujol, R., Mollicone, R., Dalix, A.M. & Oriol, R. (1989) Appearance of B and H blood group antigens in the developing cochlear hair cells. Cell Tissue Res. 257, 17–21. 38. Astic, L., Le Pendu, J., Mollicone, R., Saucher, D. & Oriol, R. (1989) Cellular expression of H and B antigens in the rat olfactory system during development. J. Comp. Neurol. 289, 386–394. Ó FEBS 2002 Rat histo-blood group A enzyme (Eur. J. Biochem. 269) 4047 . Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens Anne Cailleau-Thomas 1 ,Be ´ atrice Le Moullac-Vaidye 1 ,Je ´ zabel. transferase) activity of the enzyme product and allowed detection of a small UDP-Gal:Fuca1,2GalaGal transferase (B transferase) activity. The presence of the mRNA and of the A and B antigens was searched. various BDIX rat tissues. There was a general good concordance between the presence of the mRNA and that of the A antigen. Tissue distributions of the A and B antigens in the homozygous BDIX rat