0

e3 t3 e4 stm 1 cables below the cable distribution plate in a 2 x 2 mode that is bundle the cables led out from the lower two interfaces on each interface board together and those from the upper two interfaces together see figure 1 1

Báo cáo y học:

Báo cáo y học: "Localization of HIV-1 Vpr to the nuclear envelope: Impact on Vpr functions and virus replication in macrophages" potx

Báo cáo khoa học

... of the pLex10 plasmid [ 12 , 31] and BamHI-XhoI of the pAS1b plasmid [28 ] to obtain vectors for expression of Vpr fused either to the LexA DNA binding domain (LexABD) or to the HA-tag, in yeast and ... as a matrix by sitedirected mutagenesis with specific primers: L23F-F ACACTAGAG CTTTTTGAGGAGCTTAAG, L23F-R CTTAA GCTCCTCAAAAAGCTCTAGTGT, K27M-F CTTTTAGAGG AGCTTATGAGAGAAGCTGTTAG, K27M-R CTAACAGCTTCTCTCATAA ... to LexABD (upper panels) or to the Gal4 DNA binding domain (Gal4BD) (lower panels), in combination with each of the Gal4AD-hybrids indicated on the top was analyzed for histidine auxotrophy and...
  • 15
  • 186
  • 0
Tài liệu Installing the Cable Distribution Plate docx

Tài liệu Installing the Cable Distribution Plate docx

Phần cứng

... OptiX OSN 3500 Installation Manual 6Installing the Cable Distribution Plate cabinet Figure 1. 1 Position for mounting ears Cable distribution plate Installation position Cable distribution plate ... Proprietary Issue 05 (20 06 -11 -20 ) OptiX OSN 3500 Installation Manual 6Installing the Cable Distribution Plate Figure 1. 1 Installing the cable distribution plate End Issue 05 (20 06 -11 -20 ) Huawei Technologies ... Distribution Plate in the Cabinet Describes the steps to install the cable distribution plate 6 .1 Installation Position Figure 1. 1 shows the position of the cable distribution plate in the 22 00mm-high...
  • 5
  • 310
  • 0
Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

Báo cáo khoa học

... conditions A kDa B pI LAHG conditions 25 0 75 50 25 C Dark heterotrophic conditions E 14 15 16 13 19 18 22 21 20 32 25 26 27 28 10 11 12 23 30 D kDa Δsll1330 LAHG conditions 17 24 29 31 Fig Proteome ... induciblea 15 21 s 5, 32 16 29 29 22 17 s s s s s s s s s 19 24 s s 18 s 10 s 11 13 12 20 26 31 14 27 28 25 23 s s s s s s Genes enhanced under LAHG conditions to a 1. 5-fold greater extent than under ... 5¢-GGAAGAAC CGTGCATTACC-3¢, and labeled with [a- 32P]dCTP using a Megaprime labeling kit (Amersham Pharmacia, Piscataway, NJ, USA) Hybridization signals were detected with a BAS2000 bio-imaging analyzer...
  • 12
  • 395
  • 0
Báo cáo khoa học: The Drosophila jumonji gene encodes a JmjC-containing nuclear protein that is required for metamorphosis pot

Báo cáo khoa học: The Drosophila jumonji gene encodes a JmjC-containing nuclear protein that is required for metamorphosis pot

Báo cáo khoa học

... (20 07) 613 9– 615 1 ª 20 07 The Authors Journal compilation ª 20 07 FEBS N Sasai et al catalytically inactive as histone demethylases because of the amino acid changes in the catalytic domain [11 , 12 ] Several ... compilation ª 20 07 FEBS N Sasai et al 10 11 12 13 14 15 16 some core particle at 2. 8 A resolution Nature 389, 2 51 26 0 Jenuwein T & Allis CD (20 01) Translating the histone code Science 29 3, 10 74 10 80 ... 3 12 – 316 Yamane K, Toumazou C, Tsukada Y, ErdjumentBromage H, Tempst P, Wong J & Zhang Y (20 06) Characterization of Drosophila jumonji 17 18 19 20 21 22 23 24 25 26 27 28 29 JHDM 2A, a JmjC-containing...
  • 13
  • 356
  • 0
Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

Báo cáo khoa học

... N-f/C -a/ C -a/ C-e 11 0.4 11 2. 6 97.8 92. 8 96.0 10 5.3 10 5.5 10 8 .1 106.6 10 5.6 11 9 .1 106 .2 10 8.0 71. 7 61 40 36 36 33 69 90 56 61 55 77 91 13 22 8 21 5 15 9 36 15 9 12 7 17 2 300 26 3 21 6 16 4 24 3 29 3 12 5 3.7 5.3 4.4 4 .1 ... located on helix N and is part of the tryptophan cluster comprising W 117 and W 120 of helix C The other three amino acids mutated (I 124 , I1 31 and Q1 42) form part of helix C These four mutations ... gp 41( 24 15 7) after the renaturation process by dialysis into 50 mM formate, pH 2. 8 (see the Materials and methods) Two unfolding transitions at 11 0.4 and 11 9.5 °C are seen (Table 1) , demonstrating that...
  • 14
  • 375
  • 0
báo cáo hóa học:

báo cáo hóa học:" Caveolin-1 enhances resveratrol-mediated cytotoxicity and transport in a hepatocellular carcinoma model" docx

Hóa học - Dầu khí

... CAV1 was constructed by inserting the human CAV1 cDNA into pcDNA3 .1/ NT-GFP-TOPO [27 ] Mutant CAV1 with the deletion of the scaffolding domain (CAVM1, CAV1- 81- 101aa) and mutant CAVM2 (lacking the ... data suggest that the 14 3 15 6 amino acids of the lipid-binding domain of CAV1 play a key role On the contrary, the 81 10 1 amino acids scaffold-domain of CAV1 is irrelevant to CAV1-mediated internalization ... CAVM1 CAVM2 CAVRNAi GFP 20 6.83 ± 1. 9 13 .2 ± 1. 0 9. 62 ± 1. 1 11 .5 ± 1. 4 5.05 ± 1. 4 6.05 ± 1. 8 10 .93 ± 1. 5 17 . 91 ± 2. 5* 13 .5 ± 1. 8 15 .3 ± 1. 6 9.78 ± 1. 1 11 .2 ± 2. 0 31. 2 ± 2 .1 78.7 ± 1. 7* 23 .1 ± 0.9...
  • 13
  • 714
  • 0
Báo cáo y học:

Báo cáo y học: "Demonstration of the histopathological and immunohistochemical effects of a novel hemostatic agent, ankaferd blood stopper, on vascular tissue in a rat aortic bleeding mode" pps

Báo cáo khoa học

... dislocation on the operation day The abdominal aortas of Groups (n = 11 ) and (n = 11 ) were wounded, and hemostasis was provided with ABS-soaked tampons in Group and plain gauze tampons in Group The abdominal ... gauze tampon stopped bleeding in all Group -1 and -3 animals The mean bleeding time in 15 animals with the gauze tampon in Groups and was 4.9 ± 0.6 s, and in 22 animals in the ABS-soaked tampon Groups ... Grade was no apparent reaction product Focal and minimal staining intensity was graded 1, and the most prominent staining reaction Page of covering nearly the whole area of the specimen was classified...
  • 7
  • 454
  • 0
Báo cáo y học:

Báo cáo y học: "Treatment with apolipoprotein A-1 mimetic peptide reduces lupus-like manifestations in a murine lupus model of accelerated atherosclerosis" ppt

Báo cáo khoa học

... Competing interests Mohamad Navab and Alan M Fogelman are principals in Bruin Pharma and Alan M Fogelman is an officer in Bruin Pharma The remaining authors have no competing interests Authors' contributions ... of fat feeding in the apolipoprotein E-knockout mouse: model characterization and effects of pravastatin treatment Circulation 20 05, 11 1 :14 22 -14 30 Zhou XX, Gao PJ, Sun BG: Pravastatin attenuates ... class A amphipathic helical peptide J Lipid Res 20 01, 42 :10 96 -11 04 Navab M, Anantharamaiah GM, Hama S, Garber DW, Chaddha M, Hough G, Lallone R, Fogelman AM: Oral administration of an Apo A- I...
  • 13
  • 360
  • 0
Báo cáo Y học: Differences in the binding capacity of human apolipoprotein E3 and E4 to size-fractionated lipid emulsions pot

Báo cáo Y học: Differences in the binding capacity of human apolipoprotein E3 and E4 to size-fractionated lipid emulsions pot

Báo cáo khoa học

... alone control) were calculated from the optical density in the infranatant averaged over a radial range of 0 .1 cm in the plateau region using data from the final radial scan The average optical ... PL/ApoE Amino acids/PL ApoE (26 3 28 6) ApoE3 ApoE4 21 0 15 17 75 0.44 0. 51 3 .14 · 10 4 10 10 16 30 5.9 16 3 10 1 4 .1 1.83 2. 96 that the observed changes in the c(sf) distributions of fraction in the ... of intact apoE4 was consistent with the sum of the enthalpies for the 22 kDa and 10 kDa derivatives, indicating that both NH2- and COOH-terminal domains bind to the emulsion surface [28 ] At saturation,...
  • 11
  • 600
  • 0
Cambridge.University.Press.The.Works.of.Archimedes.Volume.1.The.Two.Books.On.the.Sphere.and.the.Cylinder.Translation.and.Commentary.May.2004.pdf

Cambridge.University.Press.The.Works.of.Archimedes.Volume.1.The.Two.Books.On.the.Sphere.and.the.Cylinder.Translation.and.Commentary.May.2004.pdf

TOEFL - IELTS - TOEIC

... of the Marciana Library in Venice, Marc Lat 327 , is an authograph by Jacob of Cremona, containing a translation made directly from codex A (and also relying on codex B) Jacob’s translation is ... dead well before Archimedes’ own death in 21 2 BC, he must have been a rare person as far as Archimedes was concerned: a mathematician That he was a mathematician, and that this was so rare, is ... concerning solids: that every pyramid is a third part of a prism having the same base as the pyramid and an equal height,8 and that every cone is a third part of the cylinder having the base the...
  • 387
  • 1,245
  • 3
Bài 1: Trật tự thế giới sau chiến tranh thế giới

Bài 1: Trật tự thế giới sau chiến tranh thế giới

Lịch sử

... HIỆP QUỐC BOUTROS GHALI (19 92 -19 96) KOFI ANNAN (19 97 -20 05) II SỰ THÀNH LẬP LIÊN HP QUỐC Vai trò: - LHQ giữ vai trò quan trọng việc giải tranh chấp xung đột khu vực, thúc đẩy mối quan hệ hữu nghò ... MỚI SAU CHIẾN TRANH Hoàn cảnh lòch sử: -Tháng 2 .19 45, hội nghò quốc tế Mỹ, Anh, Liên X họp Ianta (Liên X ) để th a thuận việc giải vấn đề thiết sau chiến tranh hình thành trật tự giới 2 Nội ... từ 19 45 – 19 47, thường gọi "Trật tự hai cực Ianta" ĐÔNG ÂU MÔNG CỔ II SỰ THÀNH LẬP LIÊN HIỆP QUỐC • Hoàn cảnh đời : Từ 25 /4 đến 26 /6 /19 45, đại biểu 50 nước • họp San Francisco (Mỹ), thông qua...
  • 24
  • 996
  • 4
ĐIỂM THI HỌC KỲ 1 – NGÀNH SINH – THỂ DỤC K16

ĐIỂM THI HỌC KỲ 1 – NGÀNH SINH – THỂ DỤC K16

Tư liệu khác

... 10 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 9 11 0 11 1 11 2 11 3 11 4 11 5 11 6 11 7 11 8 11 9 12 0 12 1 12 2 12 3 12 4 12 5 12 6 12 7 12 8 12 9 13 0 13 1 13 2 13 3 13 4 13 5 13 6 13 7 13 8 13 9 14 0 14 1 14 2 14 3 14 4 14 5 14 6 Trần ... STB-K16 STA-K16 STA-K16 STB-K16 STB-K16 STB-K16 STB-K16 STB-K16 STB-K16 STB-K16 STB-K16 STB-K16 STB-K16 STB-K16 STB-K16 STB-K16 STB-K16 STA-K16 STA-K16 STA-K16 STB-K16 STB-K16 STB-K16 STA-K16 STC-K16 ... STA-K16 STC-K16 STA-K16 STC-K16 STC-K16 STC-K16 STA-K16 STC-K16 STC-K16 STC-K16 STC-K16 STA-K16 STC-K16 STA-K16 STA-K16 STC-K16 STC-K16 STC-K16 STC-K16 STC-K16 STC-K16 STC-K16 STC-K16 6 6 6 8 8...
  • 3
  • 302
  • 0
Giao án lop 2 buoi 1 - Tuan 3(The)

Giao án lop 2 buoi 1 - Tuan 3(The)

Tư liệu khác

... phép tính 18 + = 20 14 + = 20 - Gọi em ch a bảng, lớp đổi chéo 17 + = 20 13 + = 20 cho để kiểm tra 16 + = 20 12 + = 20 15 + = 20 11 + = 20 - Lớp đọc đồng - Yêu cầu đọc phép tính v a lập c) ... Học sinh khác nhận x t bạn - Một em đọc đề - Số học sinh lớp - Có 14 học sinh nữ 16 học sinh nam Thực phép tính 14 + 16 - Một em lên bảng làm Giải : Số học sinh lớp : 14 + 16 = 30 ( học sinh ... đứng vỗ tay hát (1- 2 ) dun g yêu cầu học (1- ) - Giậm chân tạy chỗ, đếm to theo - Trò chơi khởi động (1- 2) nhịp (1- 2) - HS thực - HS thực 1- 2 lần theo gv điều Phần : + Quay phải, quay trái (45lần)...
  • 13
  • 585
  • 1
GMAT OFFICIAL GUIDE th 10 Edition 1 CRITICAL REASONING 1. Which of the following best completes

GMAT OFFICIAL GUIDE th 10 Edition 1 CRITICAL REASONING 1. Which of the following best completes

Kỹ năng đọc tiếng Anh

... or plaintiffs in cases that not involve sex discrimination D the majority of the cases of sex discrimination against women that have reached the judge’s court have been appealed from a lower ... universities B Allowing Mexican nationals to study in Texas border colleges and to pay in- state tuition rates, which are the same as the previous international rate C Reemphasizing the goals and mission ... explain this result by arguing that the selves of hypnotized subjects are dissociated into separate parts, and that the part that is deaf is dissociated from the part that replies Which of the...
  • 25
  • 726
  • 0
Module 1: Overview of the Microsoft .NET Platform

Module 1: Overview of the Microsoft .NET Platform

Hệ điều hành

... supporting data type conversion, method parameter manipulation, mathematics, remote and local program invocation, application environment management, and supervision of managed and unmanaged applications ... classes and interfaces that allow you to create controls and pages that will appear in your Web applications as the user interface on a Web page Module 1: Overview of the Microsoft NET Platform ... of the Microsoft NET Platform 11 ADO.NET: Data and XML Topic Objective To explain the data and XML support in the runtime ADO.NET: Data and XML Lead -in The NET Framework provides a new set of ADO.NET...
  • 22
  • 448
  • 0
The JSP Files (Part 1) - Purple Pigs in a Fruitbasket

The JSP Files (Part 1) - Purple Pigs in a Fruitbasket

Quản trị mạng

... org.apache.tomcat.core.ContextManager.service(ContextManager.java:743) at org.apache.tomcat.service.connector.Ajp12ConnectionHandler.processConnecti (Ajp12ConnectionHandler.java :16 6) at org.apache.tomcat.service.TcpWorkerThread.runIt(PoolTcpEndpoint.java, ... string is: The lion second string is: roars in anger the combination is: The lion roars in anger says you can't add apples and oranges?! In this case, the + operator is used to concatenate two ... org.apache.tomcat.core.Handler.service(Handler.java :28 6) at org.apache.tomcat.core.ServletWrapper.service(ServletWrapper.java:3 72) at org.apache.tomcat.core.ContextManager.internalService(ContextManager.java: 7) at org.apache.tomcat.core.ContextManager.service(ContextManager.java:743)...
  • 16
  • 324
  • 0
PHẦN 1. LỊCH SỬ THẾ GIỚI CẬN ĐẠI

PHẦN 1. LỊCH SỬ THẾ GIỚI CẬN ĐẠI

Lịch sử

... đúng: 1) Nhật Bản chiến tranh với Đài Loan a) 18 72 -18 79 2) Nhật Bản chiến tranh với Trung Quốc b) 19 01 3) Nhật Bản chiến tranh với Nga c) 18 94- 18 95 4) Nhật Bản chiến tranh với Lưu cầu d) 18 74 ... http://vnsharing.net/forum/showthread.php?t =14 9600 • Thiên hoàng Minh Trị (sinh vào ngày (11 /3 /18 52 ngày 30/7 /19 12) ), gọi Minh Trị Đại đế, Minh Trị Thánh đế, vị Thiên Hoàng thứ 12 2 Nhật Bản, trị từ ngày tháng năm 18 67 tới qua đời ... KHU VỰC MĨ LA TINH (Thế kỉ XIX-đầu kỉ XX) BÀI NHẬT BẢN 1. Nhật Bản từ dầu kỉ XIX đến trước năm 18 68 a. Về kinh tế - Nền nông nghiệp d a quan hệ sản xuất lạc hậu trì tô thuế lên đến 50% hoa lợi - Công...
  • 30
  • 1,465
  • 1

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008