Eur J Biochem 271, 1566–1579 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04068.x HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment Characterization of gp41 mutants ´ ´ Tino Krell1, Frederic Greco1, Olivier Engel1, Jean Dubayle1, Joseline Dubayle1, Audrey Kennel1, Benoit Charloteaux2, Robert Brasseur2, Michel Chevalier1, Regis Sodoyer1 and Raphaelle El Habib1 ă Aventis Pasteur, Marcy lEtoile, France; 2Centre de Biophysique Mole´culaire Nume´rique, Faculte´ Universitaire des Sciences Agronomiques de Gembloux, Belgium HIV gp41(24–157) unfolds cooperatively over the pH range of 1.0–4.0 with Tm values of > 100 °C At pH 2.8, protein unfolding was 80% reversible and the DHvH/DHcal ratio of 3.7 is indicative of gp41 being trimeric No evidence for a monomer–trimer equilibrium in the concentration range of 0.3–36 lM was obtained by DSC and tryptophan fluorescence Glycosylation of gp41 was found to have only a marginal impact on the thermal stability Reduction of the disulfide bond or mutation of both cysteine residues had only a marginal impact on protein stability There was no cooperative unfolding event in the DSC thermogram of gp160 in NaCl/Pi, pH 7.4, over a temperature range of 8–129 °C When the pH was lowered to 5.5–3.4, a single unfolding event at around 120 °C was noted, and three unfolding events at 93.3, 106.4 and 111.8 °C were observed at pH 2.8 Differences between gp41 and gp160, and hyperthermostable proteins from thermophile organisms are discussed A series of gp41 mutants containing single, double, triple or quadruple point mutations were analysed by DSC and CD The impact of mutations on the protein structure, in the context of generating a gp41 based vaccine antigen that resembles a fusion intermediate state, is discussed A gp41 mutant, in which three hydrophobic amino acids in the gp41 loop were replaced with charged residues, showed an increased solubility at neutral pH HIV entry is mediated by the viral envelope proteins gp41 and gp120 Both proteins are derived from the gp160 precursor following proteolytic cleavage [1] After cleavage, both proteins remain associated [2] and are trimeric in their prefusogenic state [3] gp41 anchors the protein complex to the viral membrane [4], whereas gp120 binds to the human cell-surface receptor CD4 and other receptors on the target cell This interaction leads to a dissociation of gp120 from gp41 [5], which induces a conformational change in gp41 [2], resulting in the fusion of viral and cellular membranes Both envelope proteins are vaccine candidates against HIV However, the results of the world’s first phase III efficacy trial using gp120 were relatively modest [6] and efforts are now being made to explore the vaccine potential of gp41 The sequence of gp41 contains four functional regions, as follows: the N-terminal fusion peptide (which is thought to insert into the host cell membrane) is followed by an ectodomain, a transmembrane region and a cytoplasmic domain The ectodomain of gp41 is thought to adopt at least two different tertiary structures [7]: a prefusogenic state, and a lower energy fusion-active (fusogenic) state The decrease in free energy during the transition into the latter state is thought to account for the energy necessary for the fusion of viral and cellular membranes There is now evidence that the recombinantly produced gp41 ectodomain adopts spontaneously this fusogenic state, and 3D structural information on gp41 is entirely on this lower energy state [8–11] The fusogenic state of the gp41 ectodomain is a trimeric coiledcoil protein in which the three helices C pack in an antiparallel manner against the central trimer of parallel helices N It has been shown that gp41 produced in Escherichia coli forms insoluble aggregates at neutral pH [12], and aggregation is proposed to occur at the loop region connecting helices N and C [13] This is consistent with the fact that recombinant constructs of gp41, which have this loop replaced with a small flexible linker (gp41 models), are soluble at neutral pH Therefore, a large proportion of biochemical and biophysical studies on gp41 have been carried out using either a gp41 model [14–16] or a stoichiometric mixture of peptides corresponding to the N- and C-terminal helices, which assemble to heterohexamers in a native-like manner [17,18] However, recombinant gp41 was shown to be soluble at a pH of < 3.5, and several studies have been carried out at acidic pH [19,20] The NMR structure of gp41, at pH 3.0 [9], and its X-ray structure, using crystals grown at pH 4.25 [21], are identical to structures of gp41 fragments determined at pH values of 4.6–8.0 [8,11,16,22] This demonstrates that the structure of gp41 is not altered by acidic pH Correspondence to T Krell, Aventis Pasteur, 1541 avenue Marcel ´ Merieux, 69280 Marcy l’Etoile, France Fax: + 33 37 37 31 80, Tel.: + 33 37 37 90 12, E-mail: tino.krell@aventis.com Abbreviations: SIV, simian immunodeficiency virus; TCEP, Tris(2-carboxyethyl)phosphine (Received January 2004, revised March 2004, accepted March 2004) Keywords: gp160; gp41; HIV; hyperthermostability; sitedirected mutagenesis Ó FEBS 2004 Based on the evidence that the structure of gp41 is not altered by acidic pH, and the functional importance of the loop region [23] with its conserved cysteine residues [24], we have carried out our analyses at acidic pH using recombinant gp41(24–157) containing the cysteine residues The potent HIV entry inhibitor 5-helix [25], a recombinant gp41 trimer lacking a helix C, has been shown to bind tightly to individual C peptides It has been proposed that the mechanism of action of 5-helix is based on the binding to a fusion intermediate of gp41, which is characterized by an accessible and exposed helix C [26] These data can be regarded as evidence that a protein is capable of blocking fusion intermediates of gp41, which consequently leads to the inhibition of virus entry Our vaccine approach is based on the generation of gp41 mutants, which resemble the fusion intermediate state It is generally accepted that this intermediate state is trimeric and that helices N and C not interact Here we explore ways to stabilize the interaction between helices N, to favour a trimeric state and, on the other hand, to destabilize the interaction between helices N and C in order to prevent helix contact The study of recombinant gp41, either as separate glycosylated or nonglycosylated protein, or as part of gp160, by biophysical techniques, forms the first part of this article In the second part, site-directed mutagenesis data of gp41 are presented with the aim of assessing the influence of amino acid replacements on protein stability and solubility Materials and methods Materials Gp41(24–157) Recombinant ectodomain of gp41 corresponding to amino acids 537–669 of the envelope protein of the LAI isolate (p03375) with a C-terminal extension of amino acids GGGGSHHHHHH For details of protein expression and purification see below Gp41(34–170) Glycosylated recombinant ectodomain of gp41 purchased from Tebu-bio (Le Perray en Yvelines Cedex, France) corresponding to amino acids 546–682 of the envelope protein of the HxB2 isolate (p04578) The protein has been expressed in Pichia pastoris The gp41 domains of isolates BH10 and HxB2 share 99% sequence identity Gp160 Fusion of amino acids 30–500 of the envelope protein of the isolate MN (comprising gp120) with amino acids 501–744 (comprising a large part of gp41) of the LAI isolate The amino acid sequence of the gp120–gp41 cleavage site KAKRRVVQREKR (502–513 in the LAI sequence) has been altered to KAQNHVVQNEHQ This change prevents cleavage of gp160 into gp120 and gp41 This protein has been expressed in vaccinia virus grown on BHK21 cells and was purified by affinity chromatography on immobilized antibodies Further details on the construction and biochemical characterization of this protein are found in Kieny et al [27] This protein has been used for several HIV vaccine trials [28,29] TCEP/HCl [Tris(2-carboxyethyl)phosphine hydrochloride] was purchased from Pierce Studies on HIV envelope proteins (Eur J Biochem 271) 1567 Cloning procedures A 0.6 kb DNA fragment, containing the sequence encoding the ectodomain of gp41 of HIV isolate LAI (amino acids 537–669), was obtained by PCR amplification using, as template, a plasmid containing the gp120 sequence of MN and the gp41 sequence of the LAI isolate Restriction sites for BspHI and XhoI (shown in italics) were, respectively, included in the forward and reverse primers, as follows: forward primer: 5¢-CTCTTTCATGACGCTGACGGTA CAGGCC-3¢; reverse primer: 5¢-CCGCTCGAGCTAATG GTGATGGTGATGGTGTGACCCTCCCCCTCCACT TGCCCATTTATCTAA-3¢ The start codon in the forward primer (in bold) is a naturally occurring methionine residue A stop codon (in bold) and the DNA sequence encoding the extension GGGGSHHHHHH (underlined) were added to the reverse primer Platinum HF polymerase (Gibco Invitrogen Corp.) was used, according to the manufacturer’s instructions, for PCR amplification The PCR amplified fragment was cloned directly into the vector pM1800 using the restriction sites NcoI and XhoI The expression vector pM1800 is a derivate of pET28c (Novagen), in which the F1 origin of replication has been deleted and replaced with the Cer fragment, allowing for multimer resolution Site-directed mutagenesis: single and multiple point mutations The various point mutations were created using the Quickchange site-directed mutagenesis kit (Stratagene), using the instructions provided by the manufacturer Mutations were carried out directly on the expression vector containing the sequence of native gp41, and multiple mutations were introduced in a sequential manner NC and CN fusion mutants The NC and CN gp41 fusion constructs were generated using three consecutive PCRs In the first PCR (for the NC constructs) the following two partially overlapping DNA fragments were generated: a fragment corresponding to helix N containing a C-terminal extension encoding the first six amino acids of the helix C and a fragment corresponding to helix C containing an N-terminal extension coding for the last six amino acids of helix N In the second reaction, a stoichiometric mix of both partially overlapping fragments (no primers added) was submitted to 10 PCR cycles The third reaction was carried out with the product of the second reaction in the presence of primers containing NcoI or XhoI restriction sites and which are complementary to the 5¢ end of helix N and to the 3¢ end of helix C An equivalent approach was used to generate the CN fusion constructs Expression For protein expression, E coli BL21(DE3) was transformed with the corresponding plasmids Typically, L cultures were grown at 37 °C on LB (Luria–Bertani) broth supplemented with kanamycin (25 lgỈmL)1) Protein expression was induced at an attenuance (D) of 0.6 at 600 nm, by the addition of isopropyl thio-b-D-galactoside (Q-BIOgene, Ó FEBS 2004 1568 T Krell et al (Eur J Biochem 271) Illkirch, France) to a final concentration of mM Bacteria were harvested, h after protein induction, by centrifugation For certain mutants, protein expression was optimized by the replacement of LB medium with Terrific Broth medium, induction with 0.02–0.1 mM isopropyl thio-bD-galactoside and a growth temperature of 30 °C Protein purification The bacterial pellet resulting from a L culture was resuspended at room temperature in 95 mL of 50 mM Tris/HCl containing 100 lM CompleteTM EDTA-free protease inhibitor cocktail (Roche Molecular Biochemicals) and 100 lgỈmL)1 lysozyme (Sigma-Aldrich), pH 8.0, and gently agitated for 30 The bacterial suspension was then placed on ice and cell lysis was achieved by ultrasound treatment (4 · min) using a Branson-Sonifer 450 Afterwards, MgCl2 and Benzonase (Merck) were added to final concentrations of mM and mL)1, respectively The resulting solution was then centrifuged (20 000 g, 30 min, °C) Aliquots of the resulting supernatant and pellet were analysed by SDS/PAGE and recombinant proteins were detected by Western blot analysis using a monoclonal antibody raised against poly-histidine (Novagen) Recombinant protein was found to be almost exclusively present in the pellet The pellet was resuspended in 100 mL of buffer A (50 mM Tris/HCl, M urea, 500 mM NaCl, 10 mM imidazole, pH 8.0) and agitated at °C for 30 After filtration using a 0.45 lm cut-off filter, protein was loaded onto a ml Hi-Trap Chelating column (Amersham Pharmacia Biotech), previously equilibrated in buffer A After washing with 50 mL of buffer A, protein elution was achieved using a buffer comprising 50 mM Tris/HCl, M urea, 500 mM NaCl and 500 mM imidazole, pH 8.0 Protein refolding was achieved by dialysis with 50 mM formate, pH 2.8 Protein was then sterile filtered and stored at )45 °C MALDI-TOF MS Mass spectrometric analyses were carried out on a Biflex III MALDI-TOF mass spectrometer (Bruker Daltonics, Wissembourg, France) Samples of native and mutant gp41 (1–3 mgỈmL)1) in 50 mM formate, pH 2.8, were diluted with 30% acetonitrile (v/v) containing 0.07% trifluoroacetic acid to a final concentration of 0.4 mgỈmL)1 (protein solution) A saturated solution of sinapic acid (SigmaAldrich) in 70% acetonitrile (v/v) containing 0.1% trifluoroacetic acid was prepared and subsequently diluted four-fold with the same solvent (matrix solution) Droplets (1 lL) of a : (v/v) mixture of protein and matrix solution were deposited on the sample slide and allowed to dry at room temperature Positive ion mass spectra were acquired in the linear mode with pulsed ion extraction Mass assignments were based on an external calibration of the instrument DSC DSC experiments were performed on a MicroCal VP-DSC apparatus (MicroCal, Northampton, MA, USA) Prior to analysis, proteins were exhaustively dialyzed against the buffer stated in the legend of each figure, and degassed The dialysis buffer was used for baseline scans and was present as a reference buffer for the protein scans The system was allowed to equilibrate at °C for 15 min, and temperatures from to 129 °C were scanned at a rate of 85 °C/h Thermograms obtained were analysed using the MicroCal version of ORIGIN The standard deviation indicated for each parameter corresponds to the error of curve fitting Details concerning the calculation of thermodynamic parameters and instrumentation have been published previously [30,31] CD Far-UV CD measurements were made at 25 °C in a Jasco J-810 spectropolarimeter (Tokyo, Japan) using cuvettes with a pathlength of 0.1 mm Proteins were exhaustively dialyzed against 50 mM formate, pH 2.8 All proteins were analysed at a concentration of 60 lM and spectra were corrected using the spectra of the dialysis buffer Fluorescence spectroscopy Measurements of the intrinsic tryptophan fluorescence were carried out at 25 °C using a Kontron SFM 25 spectrofluorimeter (Kontron, Zurich, Switzerland) Unless stated otherwise, proteins were present at a concentration of lM in 50 mM formate, pH 2.8 Emission spectra between 300 and 400 nm were collected after excitation at 295 nm Spectra were corrected using the spectra of the buffer Results Protein expression of native and mutant gp41(24–157) Histidine tagged gp41(24–157), and a substantial number of mutants, have been expressed in E coli After centrifugation of the cell lysate, all proteins were present in the pellet, which was solubilized in buffer containing M urea Purification was also carried out in the presence of chaotropic agents and refolding was achieved by a simple dialysis into 50 mM formate, pH 2.8 The DSC analysis of gp41(24–157) did not provide evidence of partially or wrongly folded protein (see below) Typically, a yield of 60 mg of pure protein per litre of cell culture was observed for native gp41(24–157) This yield appeared to be lower for certain gp41 mutants Multiple point mutations to the loop region, e.g as in the triple mutant L91K/I92K/W103D (see below), did not change the protein yield Analysis of gp41(24–157) by CD, DSC and MALDI-TOF MS The far-UV CD spectrum of gp41(24–157) in 50 mM formate, pH 2.8, is shown in Fig The spectrum is literally superimposable to the CD spectrum of glycosylated gp41(21–166) at pH 7.5, as reported by Weissenhorn et al [32] Both spectra show minima at around 208 and 222 nm, a crossover in sign at 202 nm, and a maximum at 193 nm, which are typical characteristics of a protein largely dominated by a-helix From the molecular ellipticity at 222 nm, an a-helix content of 75% has been calculated [33], Ó FEBS 2004 Fig Far UV CD spectra of native gp41(24–157) (––) and of the quadruple mutant W6OA/I124D/I131D/Q142N (- - - -) Proteins were analyzed at a concentration of 60 lM in 50 mM formate, pH 2.8 which is consistent with the a-helix content of  80% determined by Weissenhorn et al for glycosylated gp41(21– 166) at pH 7.5 [32] Figure 2A (upper trace) shows the DSC thermogram of gp41(24–157) after the renaturation process by dialysis into 50 mM formate, pH 2.8 (see the Materials and methods) Two unfolding transitions at 110.4 and 119.5 °C are seen (Table 1), demonstrating that this protein is hyperthermostable at low pH The thermal unfolding was highly cooperative with an DHvH/DHcal ratio of 3.7 for the major unfolding event, which is consistent with a cooperative unfolding of a gp41 trimer Evidence that gp41 is trimeric at pH 2.5–3 has previously been demonstrated using gel filtration [13], analytical ultracentrifugation [19] and NMR [9] A major peak corresponding to the monomer, and two smaller peaks corresponding to covalently linked dimeric and trimeric forms of gp41(24–157), are seen in the MALDI-TOF spectrum (Fig 2B) of the same sample It is generally accepted that MALDI-TOF analysis results in the disruption of all noncovalent interactions and that the observed multimers correspond to covalently linked multimers gp41(24–157) contains two cysteine residues which are involved in an intrasubunit disulfide bond in the native protein [34] The reaction of this protein sample with Ellman’s reagent [35] showed that the two cysteine residues are engaged in disulfide bonds (data not shown) This is consistent with the monomer, observed by MS, having an intrasubunit disulfide bond, whereas the dimer and trimer peaks indicate the presence of intersubunit disulfide bonds Fig Analysis of native gp41(24–157) by DSC and MALDI-TOF MS (A) DSC thermograms of gp41(24–157) before and after reduction with tris(2-carboxyethyl)phosphine (TCEP) Derived thermodynamic parameters are shown in Table (B) MALDI-TOF mass spectra of gp41(24–157) before and after reduction with TCEP In panels (A) and (B), the same samples were used for analysis The sequence-derived mass of gp41(24–157) is 16801.5 l Spectra indicate that the N-terminal methionine residue has been processed (C) Study of the reversibility of the thermal unfolding of gp41(24–157) Shown are segments of two consecutive DSC up-scans from to 129 °C Reversibility was defined as: % reversibility ¼ (DHcal2/DHcal1) · 100%, with DHcal2 being the change of enthalpy from the second up-scan and DHcal1 the change of enthalpy from the first up-scan of the same protein sample Reversibility data are given in Table For clarity reasons, DSC thermograms and mass spectra are moved arbitrarily on the y-axis Proteins were analyzed in 50 mM formate, pH 2.8 Studies on HIV envelope proteins (Eur J Biochem 271) 1569 Ó FEBS 2004 1570 T Krell et al (Eur J Biochem 271) Table Thermodynamic parameters derived from the DSC analysis of gp41(24–157), gp41(34–170) and gp160 (Figs and 5) ND, not determined Sample gp41(24–157) nonreduceda gp41(24–157) reduced (36 lM)b gp41(24–157) reduced (1 lM)b gp41(34–170), glycosylatedc gp160c Tm (°C) DHcal (kcalỈmol)1) DHvH (kcalỈmol)1) DHvH/DHcal Reversibility (%) 110.4 119.5 109.1 109.1 112.6 93.3 106.4 111.8 61 21 94 91 38 71 32 41 228 165 308 303 201 134 218 191 3.7 7.8 3.3 3.3 5.3 1.9 6.8 4.6 80 85 85 ND 25 95 100 ± ± ± ± ± ± ± ± 0.4 0.5 0.4 1.0 0.5 0.6 1.5 1.5 ± ± ± ± ± ± ± ± 4 a Non-reduced protein corresponds to gp41(24–157) after the dialysis step into 50 mM formate at pH 2.8 (Materials and methods) Reduction was carried out by overnight dialysis of the protein into 50 mM sodium formate, 150 lM Tris(2-carboxyethyl)phosphine (TCEP) at °C c See the Materials and methods for a description of the protein b which have been described previously for glycosylated gp41(21–166) [32] To verify the hypothesis of the presence of intersubunit disulfide bonds, a gp41(24–157) sample was analysed after reduction with TCEP, a reagent known to reduce disulfides selectively over a pH range of 1.5–8.5 [36] After reduction, only a single unfolding transition was observed by DSC, which was characterized by a downshift in Tm of 1.3 °C, with respect to the major peak before reduction (Fig 2A, Table 1) This event was equally very cooperative (DHvH/DHcal ¼ 3.3), demonstrating that reduction does not alter the trimeric state of gp41 The peaks corresponding to covalent dimers and trimers in the mass spectrum of this sample were significantly decreased as compared to the sample analysed before reduction (Fig 2B) These minor peaks can probably be attributed to the formation of covalent multimers during ionization in the instrument, a well-known phenomena of this technique, because multimer peaks of similar size are observed in the spectrum of the cysteine-free double mutant, C87S/C93S (data not shown) This implies that the single transition seen in DSC after reduction corresponds to the unfolding of noncovalently associated trimers with reduced disulfide bonds, whereas the major unfolding event before reduction represents the unfolding of noncovalently associated trimers with intrasubunit disulfide bonds The effect of disulfide reduction on the thermal stability of gp41 trimers is thus relatively modest (downshift in Tm of 1.3 °C) The absence of the second unfolding transition after reduction demonstrates that this event represents the unfolding of gp41 trimers characterized by one or several intersubunit disulfide bonds In summary, gp41(24–157) is, after renaturation, mainly present in its native conformation, defined by noncovalently associated trimers with intrasubunit disulfide bonds Based on this result, all subsequent analyses were carried out using protein taken after renaturation (nonreduced) The parameters of the major unfolding transition were used for data analysis Furthermore, thermal unfolding of gp41(24–157) is highly reversible, as calculated from two consecutive scans of the protein (Fig 2C) protein unfolding, samples were analysed by DSC, CD and fluorescence spectroscopy over a pH range of 0.5–5.0 Protein was dialyzed into 50 mM formate and adjusted to the pH indicated by the addition of concentrated HCl or NaOH The DSC scans of gp41(24–157) at different pH values are shown in Fig 3A A plot of Tm and DHvH/DHcal, as a function of pH, is shown in Fig 3B Cooperative unfolding events at temperatures of > 100 °C are seen in the pH range of 1.0–4.0 The variation of Tm as a function of pH is of a slight valley shape, with the minimum at pH 2.25 (102 °C) The DHvH/DHcal ratio at pH 1.0–2.5 was  and increased to 3–4 at pH 2.8–3.5 This sudden increase was accompanied by an increase in Tm (Fig 3B) To evaluate whether the increase in DHvH/DHcal from  to  represents an association of monomers to trimers, or whether this increase corresponds to an increase in cooperativity of the unfolding of gp41 trimers, 14 samples of gp41 at different pH values (1.0–4.0) were analysed by fluorescence spectroscopy A gp41 monomer contains eight tryptophan residues Three are involved in a buried tryptophan cluster [11], characterized by the tight packing of W60 of helix N between W117 and W120 located at helix C of a neighbouring monomer Trimer dissociation into monomers disrupts this cluster, leading to an exposure of the three buried tryptophan residues to the solvent, giving rise to a shift in the maximum of the emission spectrum, as shown for the gp41 model [14] The maximum of the fluorescence emission spectrum of gp41 at pH 2.8 was 349 nm (data not shown) This maximum of fluorescence emission for the analysis of gp41 at pH between 1.0 and 4.0 (data not shown) was unchanged (349 ± nm), suggesting no disruption of the tryptophan cluster and no trimer dissociation at this pH range Samples of gp41 (all at 60 lM) at this pH range have also been analysed by CD Over the range of pH 1.0–4.0, spectra are closely superimposable and no shift in the minima or maxima is observed (data not shown) Differences in molecular ellipticity are in the range of the error associated with determination of the protein concentration pH dependence of the thermal unfolding of gp41(24–157) Monomer–trimer equilibrium gp41(24–157) has been shown to be hyperthermostable in 50 mM formate, pH 2.8 To study the pH dependence of A monomer–trimer equilibrium has been described for the cysteine double mutant of simian immunodeficiency virus Ó FEBS 2004 Studies on HIV envelope proteins (Eur J Biochem 271) 1571 Fig Study of gp41(24–157), at different concentrations, by DSC Superimposition of DSC scans of gp41(24–157) at 36 lM (ỈỈỈỈ) and at lM (––) Derived thermodynamic parameters are listed in Table Proteins were analyzed in 50 mM formate, pH 2.8 Proteins were incubated for h prior to analysis The thermodynamic parameters of unfolding of the monomer are expected to be different from those of the trimer Trimer dissociation is bound to alter the ratio of DHvH/ DHcal, indicative of the content of the cooperatively unfolding unit All DSC scans of serial dilutions of gp41(24–157) were very similar, providing no evidence for trimer dissociation Figure shows a superimposition of the scans obtained with 36 and lM of protein Derived thermodynamic parameters for these thermograms are given in Table The same samples were analysed by fluorescence spectroscopy, and the disruption of the tryptophan cluster (see above) as a result of trimer dissociation is expected to change the maximum of the fluorescence emission spectrum However, the emission spectra of all samples in the concentration range between 36 and 0.3 lM were very similar (data not shown) and the maxima of all tryptophan fluorescence emission spectra were 349 ± nm, indicating no trimer dissociation Analysis of glycosylated gp41 and gp160 Fig Study of the pH dependence of the thermal denaturation of gp41(24–157) (A) DSC thermograms of gp41(24–157) in the pH range of 0.5–5.0 Protein was analyzed in 50 mM formate and adjusted to the pH indicated by the addition of concentrated HCl or NaOH For clarity reasons, traces have been moved arbitrarily on the y-axis (B) Plot of Tm (ỈỈỈỈ) and DHvH/DHcal (––) as a function of pH Values have been taken from the data presented in (A) (SIV) gp41 and the data obtained have been extrapolated to HIV gp41 [19,37,38] Serial dilutions of gp41(24–157), at concentrations between 36 lM and 0.3 lM, have been prepared in 50 mM formate, pH 2.8, incubated for h to achieve equilibration, and then analysed by DSC (down to lM) and intrinsic tryptophan fluorescence spectroscopy To evaluate the influence of glycosylation on the thermal stability, experiments were carried out with glycosylated gp41 Furthermore, experiments were also carried out with glycosylated gp160 (see the Materials and methods for a detailed description of both proteins) to study the thermodynamics of protein unfolding of the entire surface protein Interestingly, the DSC scan of gp160 at 0.3 mgỈmL)1 in NaCl/Pi, pH 7.4, showed no cooperative unfolding event (data not shown) A rescan of this sample showed no significant difference from the first scan However, a cooperative unfolding event at 121.2, 120.6 and 118.3 °C was seen when the pH was lowered to 5.5, 4.0 and 3.4, respectively (Fig 5) The DSC scan of gp160 at pH 2.8 (using the same conditions as for gp41, see above) showed three unfolding transitions at 93.3, 106.4 and 111.8 °C 1572 T Krell et al (Eur J Biochem 271) Ó FEBS 2004 sequence of gp160, were very similar to the corresponding parameters of the third transition seen for gp160 The Tm values of the major unfolding events of glycosylated gp41 (112.6 °C) and nonglycosylated gp41 (110.4 °C) were very similar (Table 1, Figs and 5) Differences in DH values of the major events can rather be attributed to the presence of two minor transitions in the scan of the glycosylated gp41 (which might be attributed to misfolded protein) than to differences between the proteins The unfolding of glycosylated gp41 was less reversible than that of the nonglycosylated form (Table 1, Figs 2C and 5B) However, in interpreting these data it has to be taken into account that, although the sequences of both proteins are almost identical, the molecular boundaries of glycosylated gp41(34–170) and nonglycosylated gp41(24–157) differ slightly Analysis of gp41(24–157) with a single point mutation Our vaccine approach is based on the generation of gp41 mutants that resemble a fusion intermediate of the protein It is generally accepted that this fusion intermediate state is trimeric and that helices N and C not interact Ways have been explored to destabilize the interaction between helices N and C by site-directed mutagenesis Alternatively, mutations were carried out to stabilize the interaction between the three helices N in order to favour the trimeric state of gp41 An initial series of mutations involved amino acids in positions a and d, which are critical for helix interaction Replacement of T58 with I resulted in an increase in Tm of 2.2 °C (Fig 6A, Table 2) This mutation results in the generation of an additional hydrophobic cluster between helices N I124 is located at position a in helix C and interacts, at the same time, with two hydrophobic amino acids located at two neighbouring helices N Replacement of I124 with S and D significantly destabilizes the protein (Fig 6, Table 2) Interestingly, replacement of I124 with D rendered the unfolding irreversible Analysis of gp41(24–157) with several point mutations Fig DSC analysis of gp160 and gp41(34–170) See the Materials and methods for further information (A) Both proteins are glycosylated Proteins were analyzed at pH 2.8, 3.4 and 4.0 in 50 mM formate and adjusted to the pH indicated by the addition of concentrated NaOH Protein, at pH 5.5, was analysed in 50 mM Mes DSC scans of gp160 and gp41(34–170) were performed at different pH values gp41(34– 170) shares 99% sequence identity with the corresponding sequence in gp160 (B) Shown are segments of two consecutive up-scans of gp41(34–170) from to 129 °C, at pH 2.8 Scans have been moved arbitrarily on the y-axis Derived data are given in Table (Fig 5, Table 1) Most interestingly, the thermodynamic parameters of glycosylated gp41 (Fig 5A, Table 1), which shares 99% sequence identity with the corresponding Amino acids Q64 and Q66 are on positions c and e, respectively Their substitution with A resulted in a decrease in Tm of  °C (Fig 6B, Table 2), and no changes in the CD spectrum were noted There is now evidence that the loop region of gp41 interacts with gp120 [39] This loop contains a highly conserved di-cysteine motif [40], which forms an intrasubunit disulfide bond It has recently been suggested that the loop region of the mutant lacking the disulfide bond may be less stable and more dynamic than that of the wild type [40] Here, we show that the replacement of both cysteines with serine has a modest impact on the thermal stability (Fig 6B, Table 2) of the protein, showing a downshift of 2.3 °C in Tm compared to the wild type These data are consistent with the DSC analysis of native gp41 after reduction with TCEP, which resulted in a decrease in Tm of 1.3 °C (Table 1) The exposed surface area of the C-terminal half of helix C is highly charged, whereas helix N is mainly neutral Several of these charged residues of helix C have been mutated to alanine Both double mutants E143A/K144A and K144A/ E148A showed a decrease in Tm of  °C (Fig 6B, Table 2) Ó FEBS 2004 Studies on HIV envelope proteins (Eur J Biochem 271) 1573 The DSC scan of a triple mutant, in which three glutamine residues (at positions 40, 41 and 51, all located on the N-terminal half of the N-terminal helix) were replaced with alanine, showed a major unfolding event at 119.1 °C (Fig 7A, Table 2), which is significantly higher than that found for the native protein (110.4 °C) This unfolding transition was preceded by a broad transition centred at  97 °C Another triple mutant was aimed at combining mutations which stabilize the interaction between the three N-terminal helices (Q51I/T58I) with a mutation that destabilizes the interaction between helices N and C (I124D) The stabilizing effect of the T58I exchange has been described above, and the Q51 is located in a similar position in the heptad repeat as T58, indicating that its replacement with Ile has a similar effect as the T58 replacement I124 is located on the interface between helices N and C, and its replacement with glutamate dramatically altered the thermodynamics of protein unfolding (see above) In contrast to I124D, mutant Q51I/T58I/I124D unfolds in a single transition, characterized by a moderate downshift in Tm by  °C, as compared to the native protein (Fig 7A, Table 2) All four amino acids replaced in the quadruple mutant W6OA/I124D/I131D/Q142N are located in the interface between helices N and C W60 is located on helix N and is part of the tryptophan cluster comprising W117 and W120 of helix C The other three amino acids mutated (I124, I131 and Q142) form part of helix C These four mutations have dramatically changed the thermodynamics of protein unfolding Protein unfolding starts at  60 °C (Fig 7B) and the peak can be deconvoluted into three transitions centred on 72, 76 and 81 °C At  95 °C, the protein starts to aggregate The CD spectrum of this quadruple mutant was significantly different from that of the native protein (Fig 1) The percentage of a-helix calculated for that mutant was 56% [33], significantly lower than for the native protein (75%) In another mutant, three solvent-accessible hydrophobic amino acids (L91, I92, W103) in the loop region were replaced with charged residues (K, K, D, respectively) in order to render this protein soluble at neutral pH This mutant was soluble to 80 lgỈmL)1 in 10 mM Na2HPO4/ NaH2PO4, 0.05% Tween-20, pH 7.5, a considerable improvement on the native protein which is retained qualitatively on 0.22 lm filters after dialysis into this buffer The DSC scan of this triple mutant, at pH 2.8, shows a single event at 108 °C, indicative of only small alterations to protein stability as a result of these three, nonconservative replacements (Fig 7A, Table 2) When the DSC analysis is repeated at pH 7.5, a single unfolding event, with a Tm of 110.8 °C, is seen (Fig 7A) Analysis of gp41 constructs of directly fused helices Fig DSC analysis of gp41(24–157) mutants containing single (A) or double (B) point mutations Thermodynamic parameters derived are listed in Table Proteins were analysed in 50 mM formate, pH 2.8, and traces were moved arbitrarily on the y-axis We created mutants in which helices N and C (or vice versa) were joined directly in order to generate constraints that might prevent the adoption of this fusogenic state and favour an alternative arrangement This alternative arrangement might be characterized by the exposure of epitopes which are hidden in the helix bundle arrangement Details on these mutants are found in Table Ó FEBS 2004 1574 T Krell et al (Eur J Biochem 271) Table Thermodynamic parameters for the major unfolding event for the DSC analysis of gp41(24–157) mutants containing one to four point mutations (Figs and 7) The second column shows the location of point mutations in the structure in the six-helix bundle of gp41; letters N, C, and L correspond to helix N, helix C and loop, respectively; lower case letters indicate the position of the mutation in the heptad repeat ND, not determined Sample Position of the mutation in the structure Tm (°C) DHcal (kcalỈmol)1) DHvH (kcalỈmol)1) DHvH/DHcal Reversibility (%) Native T58I I124S I124Da – N-d C-a C-a Q64E/Q66E C87S/C93S E143A/K144A K144A/E148A Q40A/Q41A/Q51A Q51I/T58I/I124D L91K/I92K/W103D W6OA/I124D/I131D/Q142N N-c/N-e L/L C-f/C-g C-g/C-d N-g/N-a/N-d N-d/N-d/C-a L/L/L N-f/C-a/C-a/C-e 110.4 112.6 97.8 92.8 96.0 105.3 105.5 108.1 106.6 105.6 119.1 106.2 108.0 71.7 61 40 36 36 33 69 90 56 61 55 77 91 13 228 215 159 36 159 127 172 300 263 216 164 243 293 125 3.7 5.3 4.4 4.1 4.4 3.8 2.5 3.3 4.7 3.5 3.0 3.1 3.2 9.8 85 ND 86 0 66 33 ND ND 55 52 59 ND a ± ± ± ± ± ± ± ± ± ± ± ± ± ± 0.4 0.7 1.1 2.9 3.8 1.6 2.0 0.5 1.2 1.3 0.4 0.8 0.4 2.5 ± ± ± ± ± ± ± ± ± ± ± ± ± ± 15 8 Parameters of the three transitions Fig Analysis of gp41(24–157) mutants by DSC (A) DSC scans of gp41(24–157) mutants containing three point mutations The upper three scans were carried out with protein in in 50 mM formate, pH 2.8, the lower trace with protein in 10 mM Na2HPO4/NaH2PO4, 0.05% Tween-20, pH 7.5 (B) DSC scan of a mutant containing four point mutations; note the difference in scale of the y-axis Derived thermodynamic parameters are shown in Table (C) DSC scans of recombinant constructs of gp41(24–157) in which helices N and C have been joined directly A definition of these molecules and the thermodynamic parameters derived are given in Table The CD spectra of these five mutants show the characteristics of a highly a-helical protein (data not shown) All five constructs are very thermostable and their unfolding is at least partially reversible (Fig 7C, Table 3) The size of the cooperatively unfolding unit was between 1.7 and 2.8, indicating some sort of monomer association Interestingly, the two NC mutants (fusion of helix N to helix C), which are closer to the native form, are less thermostable than the CN constructs (fusion of helix C to helix N) CN3 is characterized by an upshift in Tm of  °C, accompanied by an increase in the enthalpy change as compared to the wild-type protein (Table 3) Mutants CN1, CN2 and CN3 differ only in two or, respectively, three additional amino acids on the C-terminal extension Ó FEBS 2004 Studies on HIV envelope proteins (Eur J Biochem 271) 1575 Table Parameters derived from the DSC analysis of the helix–fusion constructs of gp41(24–157) (see Fig 7C) Molecules are defined in the second column of the table All molecules contain the C-terminal tag, GGGGSHHHHHH Sample Position of the mutation in the structure Tm (°C) DHcal (kcalỈmol)1) DHvH (kcalỈmol)1) DHvH/DHcal Reversibility (%) NC1 NC2 CN1 CN2 CN3 A30-D78_N113-K154 A30-K77_W117-K154 W117-K154_A30-K77 W117-A156_A30-K77 W117-W159_A30-K77 91.0 86.5 101.9 106.8 112.5 103 84 59 81 140 176 234 140 206 241 1.7 2.8 2.4 2.5 1.7 65 71 37 39 18 of helix C, whereas the fragment corresponding to helix N is unchanged Discussion Proteins are the result of evolution and their features reflect an optimal adaptation to a multitude of environmental, mechanistic and other factors Some organisms have evolved in a way which enables them to live in a hyperthermophilic environment characterized by temperatures of > 80 °C Elevated growth temperature has thus been a driving force for the evolution of their proteins towards hyperthermostability Early studies aimed at understanding thermostability were based on sequence comparisons, but the increasing availability of 3D structures has made it possible to identify structural determinants of protein hyperthermostability by comparing 3D structures of hyperthermophilic organisms with their mesophilic counterparts [41,42] At least 15 physical and chemical factors giving rise to thermostability have been identified [43] However, a major role in achieving thermostability has been attributed to an increase in salt bridges and H-bonds, better hydrophobic internal packing, enhanced secondary structure propensity, helix dipole stabilization and burying of a hydrophobic accessible surface area [41] gp41 is a special case in terms of thermal stability The protein has evolved to be hyperthermostable, but, in contrast to the studies described above, elevated growth temperatures can be excluded as a factor driving protein evolution This hence raises the question of whether the characteristics of thermostable proteins, which have evolved as an adaptation to high temperature, are different from a protein that has evolved to be hyperthermostable as a consequence of the adaptation to a factor other than elevated temperature The availability of an increasing number of complete genome sequences has allowed comparison of the amino acid composition of entire genomes of mesophiles and hyperthermophiles [44,45] It emerged that proteins of hyperthermophilic organisms have a higher percentage of charged residues (K,R,D,E) and a lower number of polar noncharged residues (Q,N,S,T) than mesophiles The difference between charged and polar noncharged residues (termed CvP bias) was found to be the only criterion that distinguishes mesophiles (CvP: )1 to 5%) from hyperthermophiles (CvP: 10–15%) on a global basis [45] The authors conclude that the evolutionary adaptation of proteins to elevated temperatures (in hyperthermophile species) is dominated by the replacement of polar ± ± ± ± ± 3.1 1.0 1.3 0.5 0.6 ± ± ± ± ± noncharged residues with charged ones This implies that the formation of ion bonds is the dominating mechanism leading to hyperthermostability as a result of adaptation to elevated temperatures This statistical approach is supported by experimental data Lowering the pH results in the perturbation of electrostatic interaction, including ion pairs, which is complete at pH 2.0 [46] For a large number of proteins from hyperthermophiles, monitoring thermostability as function of pH shows a dramatic decrease as the pH approaches 2.0 [46–49], consistent with protein destabilization by perturbation of ionic interaction This was not the case for gp41 The native protein was shown to be hyperthermostable over the pH range of 1–4 (Fig 3) and a similar thermostability has been observed at pH 7.5 for the soluble triple mutant L91K/I92K/W103D (Fig 7), indicating that protonation has little effect on the thermal stability of the protein Interestingly, the CvP bias for gp41 was, at )13%, the opposite from proteins in hyperthermophile organisms (CvP ¼ 10–15%) A dense internal hydrophobic packing is thus more likely to determine thermostability, which is supported by the fact that gp41 contains 29% aliphatic amino acids, above the average found in mesophilic and thermophilic species [45] It can be concluded that the evolution of gp41 towards hyperthermostability was not dominated by an increase in ionic or electrostatic interaction, shown to be the major feature of proteins from thermophilic species It can thus be hypothesized that structural features giving rise to thermostability are different for proteins which have evolved in adaptation to elevated temperatures and hyperthermostable proteins found in mesophile organisms It appears that the formation of trimeric coiled-coil structures is a common principle of viral membrane fusion [34] It has been demonstrated that the influenza virus fusion protein, HA2 [50,51], and the paramyxovirus fusion protein [52], are equally thermostable It can further be hypothesized that this trimeric coiled-coil fold might be associated with thermostability DSC analysis of the double cysteine to alanine mutant of SIV gp41(27–149) (in 50 mM formate, pH 3.0) has recently been reported [38] The protein was equally hyperthermostable with a Tm of 110.7 °C, and the cooperatively unfolding unit was shown to contain a trimer (DHvH/ DHcal ¼ 2.91) Here we report very similar data (Tm ¼ 110.7 °C, DHvH/DHcal ¼ 3.53) for the analysis of HIV gp41(24–157) using the same buffer conditions Based on the observations of Wingfield et al [20], that SIV gp41 can be expressed and refolded with substantially higher yields than HIV gp41, the authors [37,38] have used the SIV 1576 T Krell et al (Eur J Biochem 271) protein for their studies We cannot confirm difficulties in producing recombinant HIV gp41, and a very satisfactory yield of 60 mg of pure protein per litre of bacterial culture was reproducibly obtained Peisajovich et al [38] have extrapolated their data obtained with SIV gp41 to HIV gp41 The authors raised concerns that the extrapolation of SIV data on the full-length gp41 ectodomain might not be fully justified because previous thermal denaturation studies of gp41 N36(L6)C34 model proteins showed large differences between the HIV and SIV [53,54] The authors suggested that the SIV ectodomain is expected to be less stable than its HIV counterpart Here we show that the thermal stability of the double cysteine mutant of SIV [38] and HIV gp41 (Fig 2, Table 1) is very similar, indicating that the above concerns, regarding the extrapolation of SIV data on HIV, are not founded Based on analytical ultracentrifugation studies, a monomer–trimer equilibrium has been previously described for the double cysteine to alanine mutant of SIV gp41(27–149) [19] The authors conclude that monomer and trimers are equally present at a monomer concentration of  lM [19] and it was proposed that the equilibrium observed in vitro might well reflect the monomer–trimer equilibrium in vivo This finding is of fundamental importance and also of practical relevance for vaccine development First, peptides corresponding to helices N and C, such as T20 [55], have an anti-HIV activity and block membrane fusion There are currently two theories to explain their in vivo effects Caffrey et al [19] propose that they interfere with the monomer– trimer equilibrium by binding to the monomer, which prevents assembly to functional trimers In contrast, Weissenhorn et al [8] state that the trimeric structure of gp41 is too stable to be disrupted by peptide binding and propose that peptides exert their activity by interfering with gp41 during the conformational change to the fusion active conformation Second, the equilibrium described implies that gp41, at concentrations typically used in a vaccine dose, is largely monomeric, which is not assumed to correspond to the in vivo oligomerization state We have addressed the question of the monomer–trimer equilibrium of HIV gp41(24–157) with two alternative techniques – DSC and tryptophan fluorescence – using buffer conditions that are very similar to those reported by Caffrey et al [19] Serial dilutions of gp41(24–157), in the concentration range of 0.3–36 lM (monomer) have been made and incubated to equilibration at 25 °C for h prior to analysis Trimer dissociation will break the three tryptophan clusters (W60, W117, W120) [11], which will shift the fluorescence emission maximum, as demonstrated for the gp41 model [14] In this concentration range, no significant changes in the thermodynamics of protein unfolding (down to lM) and fluorescence emission maxima (down to 0.3 lM) were noted as a consequence of protein dilution (Fig 4, Table 1) We are thus unable to provide evidence for the existence of an equilibrium in this concentration range Further work is thus necessary to elucidate whether the monomer–trimer equilibrium for HIV gp41 is established at a lower concentration In contrast to the numerous reports on the thermal stability of gp41 model proteins, there are very little data available on the thermal stability of the gp120 part of the envelope protein Dimeric and trimeric forms of gp140, Ó FEBS 2004 which are resistant to heat and SDS, have been reported by Staropoli et al [56] It has been shown that recombinantly produced gp41 folds spontaneously into the fusogenic conformation To elucidate whether the gp41 ectodomain, as part of gp160, folds in vitro equally into this lower energy state, and to study the thermal stability of the gp120 subunit, gp160 has been analyzed by DSC Under the conditions used for the analysis of gp41 (pH 2.8), the thermal denaturation of gp160 is characterized by three transitions centred at  93.3, 106.4 and 111.8 °C (Fig 5, Table 1) Interestingly, the thermodynamic parameters of the third transition are very similar to the corresponding parameters of glycosylated gp41 Although there is a possibility that this similarity might be a coincidence, it appears more likely that gp41, as part of gp160, is present in a similar conformation as compared to individual gp41 The two remaining transitions, at 93.3 and 106.4 °C, are thus caused by the unfolding of gp120, which is equally a very thermostable protein at low pH gp160 has a CvP bias of )11%, which is far removed from the average of proteins from thermophiles (10–15%) but, again, similar to gp41 ()13%) Conclusions drawn above on the structural determinants of thermal stability of gp41 are also valid for gp160 Our vaccine approach is based on the induction of an immune response against a protein that resembles the fusion intermediate of gp41 It was thus attempted to generate recombinant gp41 mutants that resemble this intermediate state Ways were explored to stabilize the interaction between helices N, to favour the trimeric state, and to destabilize the rest of the molecule A number of site-directed mutagenesis studies are available on gp41 models in which the loop is replaced with a short linker [14,15,54,57,58] Initial experiments were carried out to evaluate how the impact of a mutation seen on the model proteins compares to the impact of the same mutation on gp41(24–157) T58 is a polar residue located on helix N at position d of the heptad repeat and thus of importance in stabilizing the trimeric form of the gp41 In the model protein it has been shown that replacement of T58 with I causes a major up-shift in the Tm (of  20 °C) [14,54] in SIV gp41 The same mutation was introduced into gp41(24–157) and its stabilizing effect has been confirmed (Fig 6, Table 2) However, the Tm shift of 2.2 °C demonstrates that its contribution to protein stability is less important than in the gp41 model The three T58 residues of the gp41 trimer interact only through weak hydrophobic contacts Replacement of T58 with I increases the amount of buried polar interactions in the gp41 core, giving rise to a stabilization of the gp41 trimer The introduction of an additional hydrophobic cluster in the centre of the trimer is thus a first mechanism to stabilize the interactions between helices N gp41 is a highly helical protein, and helix stabilization by mutation of residues to alanine is a mechanism known to increase protein stability [41] Lu et al [15] have reported an increase in Tm of °C for the Q40A mutant in the gp41 model We have created a triple mutant: Q40A/Q41A/ Q51A The three amino acids mutated are mainly involved in interactions amongst the three helices N This mutant was substantially stabilized, as shown by an increase of °C in the major unfolding event (Fig 7A, Table 2) Mutagenesis Ó FEBS 2004 of three residues in the N-terminal part of helix N with A is thus a second, alternative way to increase stability, which is probably reflected in the stabilization of the trimeric state of gp41 There appears to be evidence that the loop region of gp41 interacts with gp120 [39] However, it should be noted that another report suggests that the loop is exposed on the surface of primary isolates [59] This loop contains a di-cysteine motif [40], which forms an intrasubunit disulfide bond Both cysteine residues are fully conserved, indicating an important functional role [24] Several biochemical studies have been carried out with the double cysteine to alanine mutant of gp41 [19,20,37,38] since Wingfield et al demonstrated that this double mutant refolds more easily than the native protein [20] The authors conclude that this replacement does not alter the biochemical and biophysical properties of gp41 NMR studies have shown only minimal structural alterations of the loop region in the double cysteine mutant as compared to the wild-type protein [9] However, the impact of this mutation on protein stability has not been assessed and it has recently been suggested that the loop region of the mutant lacking the disulfide bond may be less stable and more dynamic than that of the wildtype protein [40] Here, we show that the replacement of both cysteine residues with serine has only a modest impact on the thermal stability (Fig 6B, Table 2) of the protein, showing a downshift of 2.3 °C in Tm as compared to the wild type These data are consistent with the DSC analysis of native gp41 following reduction with TCEP, which resulted in a decrease, in Tm, of 1.3 °C (Table 1) The ectodomain of gp41 aggregates at neutral pH and it has been proposed that aggregation occurs at the hydrophobic loop [13] We have generated a triple mutant (L91K/I92K/W103D) in which three surface-exposed hydrophobic residues of the loop are replaced with charged residues These three nonconservative replacements had only a moderate impact on the thermal stability at pH 2.8 (downshift in Tm of  °C, Table 2), confirming that the six-helix bundle arrangement is the major determinant for protein stability This mutant is soluble at pH 7.5, at a concentration of 80 lgỈmL)1 Thermal stability of this protein at pH 2.8 and 7.5 are comparable (Fig 7A, Table 2) This approach represents an alternative to gp41 model proteins (loop replaced with linker), aimed at studying gp41 at a neutral pH It furthermore confirms that surface-exposed hydrophobic residues in the loop are the reason for aggregation at neutral pH However, the mutation of an additional amino acid in the loop appears to be necessary to further increase protein solubility Amino acid residues located on the N–C interface are obvious targets for mutations aimed at destabilizing the protein The side chain of I124 interacts through L54 and V59 with two neighbouring helices N at the same time Replacement of this residue with S and D has a strong destabilizing effect on the molecule and, in both cases, the DSC scans can be deconvoluted into several different transitions, which might point to several coexisting forms of the protein (Fig 6, Table 2) It has been shown recently that an I124A mutant perturbs either gp160 cleavage or gp120– gp41 association, leading to an abrogation of the ability of the envelope protein to mediate cell fusion [57] Studies on HIV envelope proteins (Eur J Biochem 271) 1577 The entry inhibitor 5-helix binds strongly to individual C-peptides [25] However, a 5-helix variant, in which the C-peptide-binding site is disrupted by mutation of four interface residues, has lost its activity It appears that the mutation of four amino acids in the interface between helix N and C is sufficient to prevent helix contact An analogous quadruple mutant of gp41(24–157) has been prepared in which one mutation on helix N (W60A) is combined with three mutations on the helix C (I124D/I131D/Q142N) This mutant was strongly destabilized (Fig 7, Table 2), and CD spectroscopy (Fig 1) provides evidence for major structural changes This mutant was the only gp41 variant with a substantially lower a-helix content (Fig 1) However, further experiments are necessary to elucidate whether this mutant is present in the six-helix bundle arrangement or in an alternative conformation All 3D structures of gp41, containing the loop [9], with the loop replaced by a linker [11], as the GCN4 fusion protein [8] or as a stoichiometric mix of helices N and C [10], show the same arrangement, corresponding to the lowenergy, postfusogenic form of the protein gp41 mutants, characterized by a direct fusion of helices N and C, or vice versa, have been generated in order to introduce constrains to favour a structural arrangement different to the postfusogenic conformation It is hypothesized that proteins in this alternative conformation expose epitopes that are hidden in the postfusogenic form Helix fusion proteins express well in E coli and fold into thermostable structurally defined proteins The ratio DHvH/DHcal (Table 2) indicates that the cooperatively unfolding unit contains more than a monomer More experiments are needed to obtain further insight into molecular arrangement of these proteins Mutants NC2, CN2 and CN3 unfold in a single unfolding transition, which might confirm the hypothesis that these mutants are structurally homogeneous samples and permit the use of X-ray crystallography or NMR to determine their 3D structure The immunogenic potential of the mutants described in this article has been evaluated and will be reported elsewhere Acknowledgements We thank the National Funds for Scientific Research of Belgium (FNRS), where B C is a research fellow and R B a research director We thank Claude Meric for helpful discussions References Hallenberger, S., Moulard, M., Sordel, M., Klenk, H.D & Garten, W (1997) The role of eukaryotic subtilisin-like endoproteases for the activation of human immunodeficiency virus glycoproteins in natural host cells J Virol 71, 1036–1045 Veronese, F.D., DeVico, A.L., Copland, T.D., Oroszlan, S., Gallo, R.C & Sarngadharan, M.G (1985) Characterization of gp41 as the transmembrane protein coded by the HTLV-III/LAV envelope gene Science 229, 1402–1405 Zhang, C.W., Christi, Y., Hussey, R.E & Steinherz, E.L (2001) Expression, purification, and characterization of recombinant HIV gp140 The gp41 ectodomain of HIV or simian immunodeficiency virus is sufficient to maintain the retroviral envelope glycoprotein as a trimer J Biol Chem 276, 39577– 39585 1578 T Krell et al (Eur J Biochem 271) Bosch, M.L., Earl, P.L., Fargnoli, K.K., Picciafuoco, S., Giombini, F., Wong-Staal, F & Franchini, G (1989) Identification of the fusion peptide of primate immunodeficiency viruses Science 244, 694–697 Moore, J.P., McKeating, J.A., Weiss, R.A & Sattentau, Q.J (1990) Dissociation of gp120 from HIV-1 virions induced by soluble CD4 Science 250, 1139–1142 Francis, D.P., Heyward, W.L., Popovic, V., Orozco-Cronin, P., Orelind, K., Gee, C., Hirsch, A., Ippolito, T., Luck, A., Longhi, M., Gulati, V., Winslow, N., Gurwith, M., Sinangil, F & Berman, P.W (2003) Candidate HIV/AIDS vaccines: lessons learned from the World’s first phase III efficacy trials AIDS 17, 147–156 Skehel, J.J & Wiley, D.C (1998) Coiled coils in both intracellular vesicle and viral membrane fusion Cell 95, 871–874 Weissenhorn, W., Dessen, A., Harrison, S.C., Skehel, J.J & Wiley, D.C (1997) Atomic structure of the ectodomain from HIV-1 gp41 Nature 387, 426–430 Caffrey, M., Cai, M., Kaufman, J., Stahl, S.J., Wingfield, P.T., Covell, D.G., Gronenborn, A.M & Clore, G.M (1998) Threedimensional solution structure of the 44kDa ectodomain of SIV gp41 EMBO J 17, 4572–4584 10 Chan, D.C., Fass, D., Berger, J.M & Kim, P.S (1997) Core structure of gp41 from the HIV envelope glycoprotein Cell 89, 263–273 11 Tan, K., Liu, J.-H., Wang, J.-H., Shen, S & Lu, M (1997) Atomic structure of a thermostable subdomain of HIV-1 gp41 Proc Natl Acad Sci USA 94, 12303–12308 12 Lu, M., Blacklow, S & Kim, P.S (1995) A trimeric structural domain of the HIV-1 transmembrane glycoprotein Nat Struct Biol 2, 1075–1082 13 Caffrey, M., Braddock, D.T., Louis, J.M., Abu-Asab, M.A., Kingma, D., Liotta, L., Tsokos, M., Tresser, N., Pannell, L.K., Watts, N., Steven, A.C., Simon, M.N., Stahl, S.J., Wingfield, P.T & Clore, G.M (2000) Biophysical characterization of gp41 aggregates suggests a model for the molecular mechanism of HIVassociated neurological damage and dementia J Biol Chem 275, 19877–19882 14 Jelesarov, I & Lu, M (2001) Thermodynamics of trimer-ofhairpins formation by the SIV gp41 envelope protein J Mol Biol 307, 637–656 15 Lu, M., Stoller, M.O., Wang, S., Liu, J., Fagan, M.B & Nunberg, J.H (2001) Structural and functional analysis of interhelical interactions in the human immunodeficiency virus type gp41 envelope glycoprotein by alanine scanning mutagenesis J Virol 75, 11146–11156 16 Shu, W., Liu, J., Ji, H., Radugen, L., Jiang, S & Lu, M (2000) Helical interactions in the HIV-1 gp41 core reveal structural basis for the inhibitory activity of gp41 peptides Biochemistry 39, 1634–1642 17 Rabenstein, M.D & Shin, Y.-K (1996) HIV-1 gp41 tertiary structure studied by EPR spectroscopy Biochemistry 35, 13922– 13928 18 Blacklow, S.C., Lu, M & Kim, P.S (1995) A trimeric subdomain of the simian immunodeficiency virus envelope glycoprotein Biochemistry 34, 14955–14962 19 Caffrey, M., Kaufman, J., Stahl, S., Wingfield, P., Gronenborn, A.M & Clore, G.M (1999) Monomer-trimer equilibrium of the ectodomain of SIV gp41: insight into the mechanism of peptide inhibition of HIV infection Protein Sci 8, 1904–1907 20 Wingfield, P.T., Stahl, S.J., Kaufman, J., Zlotnick, A., Hyde, C.C., Gronenborn, A.M & Clore, G.M (1997) The extracellular domain of immunodeficiency virus gp41 protein: expression in Escherichia coli, purification, and crystallization Protein Sci 6, 1653–1660 21 Yang, Z.N., Mueser, T.C., Kaufman, J., Stahl, S.J., Wingfield, P.T & Hyde, C.C (1997) The crystal structure of the SIV gp41 ˚ ectodomain at 1.47 A resolution J Struct Biol 126, 131–144 Ó FEBS 2004 22 Shu, W., Ji, H & Lu, M (2000) Interactions between HIV-1 gp41 core and detergents and their implications for membrane fusion J Biol Chem 275, 1839–1845 23 Maerz, A.L., Drummer, H.E., Wilson, K.A & Poumbourrios, P (2001) Functional analysis of the disulfide-bonded loop/chain reversal region of human immunodeficiency virus type gp41 reveals a critical role in gp120–gp41 association J Virol 75, 6635– 6644 24 Schulz, T.F., Jameson, B.A., Lopalco, L., Siccardi, A.G., Weiss, R.A & Moore, J.P (1992) Conserved structural features in the interaction between retroviral surface and transmembrane glycoproteins? AIDS Res Hum Retroviruses 8, 1571–1580 25 Root, M.J., Kay, M.S & Kim, P.S (2001) Protein design of an HIV-1 entry inhibitor Science 291, 884–888 26 Koshiba, T & Chan, D.C (2003) The prefusogenic intermediate of HIV-1 gp41 contains exposed C-peptide regions J Biol Chem 278, 7573–7579 ` 27 Kieny, M.P., Lathe, R., Riviere, Y., Dott, K., Schmitt, D., Girard, M., Montagnier, L & Lecocq, J.P (1988) Improved antigenicity of the HIV env protein by cleavage site removal Protein Eng 2, 219–225 28 Jin, X., Ramanathan, M Jr, Barsoum, S., Deschenes, G.R., Ba, L., Binley, J., Schiller, D., Bauer, D.E., Chen, D.C., Hurley, A., Gebuhrer, L., El Habib, R., Caudrelier, P., Klein, M., Zhang, L., Ho, D.D & Markowitz, M (2002) Safety and immunogenicity of ALVAC vCP1452 and recombinant gp160 in newly human immunodeficiency virus type 1-infected patients treated with prolonged highly active antiretroviral therapy J Virol 76, 2206–2216 29 Bures, R., Gaitan, A., Zhu, T., Graziosi, C., McGrath, K.M., Tartaglia, J., Caudrelier, P., El Habib, R., Klein, M., Lazzarin, A., Stablein, D.M., Deers, M., Corey, L., Greenberg, M.L., Schwartz, D.H & Montefiori, D.C (2000) Immunization with recombinant canarypox vectors expressing membrane-anchored glycoprotein 120 followed by glycoprotein 160 boosting fails to generate antibodies that neutralize R5 primary isolates of human immunodeficiency virus type AIDS Res Hum Retroviruses 16, 2019–2035 30 Cooper, A (1999) Thermodynamics of protein folding and stability In Proteins: a Comprehensive Treatise, Vol (Allen, G., ed), pp 217–270 Jai Press Inc, Greenwich, Connecticut 31 Plotnikov, V.V., Brandts, J.M., Lin, L.-N & Brandts, J.F (1997) A new ultrasensitive scanning calorimeter Anal Biochem 250, 237–244 32 Weissenhorn, W., Wharton, S.A., Calder, L., Earl, P.L., Moss, B., Alipradis, E., Skehel, J.J & Wiley, D.C (1996) The ectodomain of HIV-1 env subunit gp41 forms a soluble, alpha-helical, rod-like oligomer in the absence of gp120 and the N-terminal fusion peptide EMBO J 7, 1507–1514 33 Taylor, J.W & Kaiser, E.T (1987) Structure–function analysis of proteins through the design, synthesis, and study of peptide models Methods Enzymol 154, 473–498 34 Colman, P.M & Lawrence, K.C (2003) The structural biology of type I viral membrane fusion Nat Rev Mol Cell Biol 4, 309–319 35 Habeeb, A.F.S.A (1972) Reaction of protein sulfhydryl groups with Ellmans’s reagent Methods Enzymol 25, 457–464 36 Kirley, T.L (1989) Reduction and fluorescent labeling of cyst(e)ine-containing proteins for subsequent structural analyses Anal Biochem 180, 231–236 37 Peisajovich, S.G & Shai, Y (2001) SIV gp41 binds to membranes both in the monomeric and trimeric states: consequences for the neuropathology and inhibition of HIV infection J Mol Biol 311, 249–254 38 Peisajovich, S.G., Blank, L., Epand, R.F., Epand, R.M & Shai, Y (2003) On the interaction between gp41 and membranes: the Ó FEBS 2004 39 40 41 42 43 44 45 46 47 48 49 50 immunodominant loop stabilizes gp41 helical hairpin conformation J Mol Biol 326, 1489–1501 Binley, J.M., Sanders, R.W., Clas, B., Schuelke, N., Master, A., Guo, Y., Kajumo, F., Anselma, D.J., Maddon, P.J., Olson, W.C & Moore, J.P (2000) A recombinant human immunodeficiency virus type envelope glycoprotein complex stabilized by an intermolecular disulfide bond between the gp120 and gp41 subunits is an antigenic mimic of the trimeric virion-associated structure J Virol 74, 627–643 Caffrey, M (2001) Model for the structure of the HIV gp41 ectodomain: insight into the intermolecular interactions of the gp41 loop Biochem Biophys Acta 1536, 116–122 Vogt, G & Argos, P (1997) Protein thermal stability: hydrogen bonds or internal packing? Fold Des 2, S40–S46 Hennig, M., Darimont, B., Sterner, R., Kirschner, K & Jansonius, J.N (1995) 2.0 A structure of indole-3-glycerol phosphate synthase from the hyperthermophile Sulfolobus solfataricus: possible determinants of protein stability Structure 3, 1295–1306 Querol, E., Perez-Pons, J.A & Mozo-Villarias, A (1996) Analysis of protein conformational characteristics related to thermostability Protein Eng 9, 265–271 Suhre, K & Claverie, J.-M (2003) Genomic correlates of hyperthermostability, an update J Biol Chem 278, 17198–17202 Cambillau, C & Claverie, J.-M (2000) Structural and genomic correlates of hyperthermostability J Biol Chem 275, 32383– 32386 Cavagnero, S., Zhou, Z.H., Adams, M.W & Chan, S.I (1995) Response of rubredoxin from Pyrococcus furiosus to environmental changes: implications for the origin of hyperthermostability Biochemistry 34, 9865–9873 Knapp, S., Karshikoff, A., Berndt, K.D., Christova, P., Atanasov, B & Ladenstein, R (1996) Thermal unfolding of the DNAbinding protein Sso7d from the hyperthermophile Sulfolobus solfataricus J Mol Biol 264, 1132–1144 Ogasahara, K., Khechinashvili, N.N., Nakamura, M., Yoshimoto, T & Yutani, K (2001) Thermal stability of pyrrolidone carboxyl peptidases from the hyperthermophilic Archaeon, Pyrococcus furiosus Eur J Biochem 268, 3233–3242 McCrary, B.S., Bedell, J., Edmondson, S.P & Shriver, J.W (1998) Linkage of protonation and anion binding to the folding of Sac7d J Mol Biol 276, 203–224 Ruigrok, R.W.H., Martin, S.R., Wharton, S.A., Skehel, J.J., Bayley, P.M & Wiley, D.C (1986) Conformational changes in the Studies on HIV envelope proteins (Eur J Biochem 271) 1579 51 52 53 54 55 56 57 58 59 hemagglutinin of influenza virus which accompany heat-induced fusion of virus with liposomes Virology 155, 484–497 Chen, J., Wharton, S.A., Weissenhorn, W., Calder, L.J., Hughson, F.M., Skehel, J.J & Wiley, D.C (1995) A soluble domain of the membrane-anchoring chain of influenza virus hemagglutinin (HA2) folds in Escherichia coli into the low-pH-induced conformation Proc Natl Acad Sci USA 92, 12205–12209 Dutch, R.E., Leser, G.P & Lamb, R.A (1999) Paramyxovirus fusion protein: characterization of the core trimer, a rod-shaped complex with helices in anti-parallel orientation Virology 254, 147–159 Liu, J., Shu, W., Fagan, M.B., Nunberg, J.H & Lu, M (2001) Structural and functional analysis of the HIV gp41 core containing an Ile573 to Thr substitution: implications for membrane fusion Biochemistry 40, 2797–2807 Ji, H., Bracken, C & Lu, M (2000) Buried polar interactions and conformational stability in the simian immunodeficiency virus (SIV) gp41 core Biochemistry 39, 676–685 Kilby, J.M., Hopkins, S., Venetta, T.M., DiMassimo, B., Cloud, G.A., Lee, J.Y., Alldredge, Y., Hunter, E., Lambert, D., Bolognesi, D., Mathews, T., Johnson, M.R., Nowak, M.A., Shaw, G.M & Saag, M.S (1998) Potent suppression of HIV-1 replication in humans by T-20, a peptide inhibitor of gp41-mediated virus entry Nat Med 4, 1302–1307 Staropoli, I., Chanel, C., Girard, M & Altmeyer, R (2000) Processing, stability, and receptor binding properties of oligomeric envelope glycoprotein from a primary HIV-1 isolate J Biol Chem 275, 35137–35145 Wang, S., York, J., Shu, W., Stoller, M.O., Nunberg, J.H & Lu, M (2002) Interhelical interactions in the gp41 core: implications for activation of HIV-1 membrane fusion Biochemistry 41, 7283– 7292 Ji, H., Shu, W., Burling, F.T., Jiang, S & Lu, M (1999) Inhibition of human immunodeficiency virus type infectivity by the gp41 core: role of a conserved hydrophobic cavity in membrane fusion J Virol 73, 8578–8586 Nyambi, P.N., Mbah, H.A., Burda, S., Williams, C., Gorny, M.K., Nadas, A & Zolla-Pazner, S (2000) Conserved and exposed epitopes on intact, native, primary human immunodeficiency virus type virions of group M J Virol 74, 7096– 7107  ... several point mutations Fig DSC analysis of gp160 and gp41( 34–170) See the Materials and methods for further information (A) Both proteins are glycosylated Proteins were analyzed at pH 2.8, 3.4 and. .. DSC analysis of gp41( 24–157) mutants containing single (A) or double (B) point mutations Thermodynamic parameters derived are listed in Table Proteins were analysed in 50 mM formate, pH 2.8, and. .. part, site-directed mutagenesis data of gp41 are presented with the aim of assessing the in? ??uence of amino acid replacements on protein stability and solubility Materials and methods Materials