... coupling reactionswith biomacromolecules (proteins, polysaccharides, and nucleic acids) or post derivatization of the graft chains with certain molecules to endow normal polymeric substrateswith ... bacteria and formation of microcolonies through specific (adhesions) and non-specific interactions (hydrogen bonds, van der Waals forces and hydrophobic interactions) with the surface (Characklis, ... Immobilization of biomolecules The immobilization of physiologically active biomolecules on conventional synthetic polymers could render surfaces with an ability to interact specifically with biological...
... assessed on each ejaculate using ejaculation volume (VOL), spermatozoon motility (MO), sperm concentration (CO) and total number of spermatozoon in ejaculate (NT), rate of abnormal spermatozoon (R) and ... spermatozoon in ejaculate (NT) was calculated through the product of CO, MO and VOL RESULTS AND DISCUSSION 3.1 Growth performance The growth performance is influenced by the genetic group effect ... genetic background (P
... increase in the role of the common factor grows strongly from period I to period II In contrast, the weight of the common factor in the first differences of bond spreads declines after the collapse ... variable captures country specific stock market liquidity conditions, which are expected to be correlated with country specific bond market liquidity and hence also with the basis One reason for using ... 2005/155 Gonzalo J andC W.J Granger (1995) Estimation of common long-memory components in cointegrated systems Journal of Business and Economic Statistics 13, 27-25 Gorton, G and A Metrick (2009)...
... a CpG dinucleotide sequence, most often occurring in short stretches of CpG-rich regions known as CpG islands Such regions are about 0.5–2 kb long and can be found in the 5¢-region of approximately ... The phylogeny tree was generated by TREEFAM [69] H1t reside on the short arm of chromosome 6; H1oo is located on chromosome and H 1o on chromosome 22 H1.2 and H1.4 predominate in most cell types ... phosphorylation of linker histones is strongly implicated in cell cycle control and that phosphorylation is a precursor of mitosis It is now widely accepted that patterns of PTMs on the core histones can...
... to consumers This appears to be less of a problem in the case of human consumption as such crops would be cooked before human consumption, with concomitant protein denaturation and inactivation ... inhibitors contains diverse types of organic compounds such as acarbose, isoacarbose, acarviosine-glucose, hibiscus acid and the cyclodextrins (Fig 2A) The two hibiscus acid forms, puri®ed from Roselle ... Tribolium castaneum Tenebrio molitor Callosobruchus maculatus Zabrotes subfasciatus Tenebrio molitor Sitophilus oryzae Tribolium castaneum Callosobruchus maculatus Tenebrio molitor (low) Sitophilus oryzae...
... GAGTCTCCGTGCAAATCCAGCG-3¢; D50580 5¢-TGTTCTTCAGAACAGCCCGCATG-3¢; AB010635 5¢-CAGCGGGAATCATCTTGAAGACC-3¢ and for AY034877 5¢-AGGCCCAGGAACACAGGGATTCC-3¢ The specificity of oligonucleotides for ES10, ES4, ES3 and ... of 95 C for 45 s, 65 C for 45 s and 72 C for and final elongation at 72 C for The 1.8 kb PCR product was cloned into the Zero Blunt TOPO cloning vector (Invitrogen Corp.) and three clones were ... Stone, C. L., Dean, R.A & Bosron, W.F (1994) Purification and characterization of a human liver cocaine carboxylesterase that catalyzes the production of benzoylecgonine and the formation of cocaethylene...
... does the conformation of the M-loop allow the lateral chain of Arg278 to move towards the ligand and to favorably interact with it through hydrogen bonds with the C1 hydroxyl group and the C2 ... protocol consisted of importing the main-chain coordinates of the conserved regions from the template and positioning the replaced sidechains in their most commonly observed conformation [26] ... IDN5390 and epothilone A with both bI and bIII isotypes of tubulin Docking of antimitotic agents to tubulin isoforms A B C Molecular dynamics and thermodynamics calculations The starting complexes,...
... techniques, scanning electron microscopy (SEM) and synchrotron radiation scanning photoelectron microscopy (SPEM), to obtain deeper insight on the morphology, composition and the lateral distribution of ... barrier for the direct interaction between hydrocarbons and Si and formation of SiC, and on the other hand, being exposed to ÔactiveÕ Ccontaining species, it is gradually reduced with production of ... sp3 and sp2 hybridisation, indicating the presence of poorly organised carbon species This C 1s energy position excludes the formation of stoichiometric SiC, which has a component at a much lower...
... values in or below the picomolar range [9–12] Consequently, RI evasion is considered to be crucial for cytotoxic efficacy [13] In fact, OnconaseÔ (Tamir Biotechnology, Inc., Monmouth Junction, NJ, ... close to each other not only in the crystal but also in solution, thereby supporting their interactions As the intracellular concentration of macromolecules is close to the crystallization conditions ... search solution showed two RNase molecules (corresponding to one tandem enzyme molecule) occupying the ˚ asymmetric unit (Matthews coefficient of 1.86 A3 ⁄ Da, corresponding to 33.3% solvent content)...
... sensors (biological, chemical, optical, etc.) Micro- and nanosatellites Micro-robots Facilitates Information technology Continued explosion Photonics: bandwidth, computation Universal connectivity ... effects on the economy, society, and politics of most countries The degree to which science and technology can accomplish such change and achieve its benefits will very much continue to depend on ... simulations combined with proliferating trends for molecular imaging technologies (e.g., atomic-force microscopes, mass spectroscopy, and scanning probe microscopes) may continue to improve our ability...
... Samplea Product Meat origin Diameter (cm) Slice appearance CH1 CH2 CH3 CH4 CH5 CH6 CH7 CH8 Chopped Chopped Chopped Chopped Chopped Chopped Chopped Chopped Pork Turkey Beef Iberian pork Pork Pork Iberian ... strength and energy to fracture) and relating these results to those of TPA parameters, folding test score and physico-chemical characteristics, in order to provide a complete characterization of these ... breakage of the product, producing adverse reactions in consumers These problems could occur in different meat products such as cooked meat sausages when they are sliced and vacuum packaged However,...
... retinoic acid) was obtained from Sigma Chemical Co., St Louis, MO, and vitamin E (dl- Page of 10 alpha tocopherol) and tocol were obtained from Hoffmann-La Roche Inc., Nutley, NJ Tocol is a tocopherol ... in foil to reduce the effect of oxidation and light on retinol Blood was transported to the laboratories of the Kumasi Center for Collaborative Research (KCCR) in Tropical Medicine at KNUST within ... tissue concentrations low enough to cause adverse health outcomes Univariate comparisons among strata for continuous variables such as micronutrients, aflatoxin, total protein, viral load and CD4 cell...
... called COL2-3/4Clongmono (also known as C2 C) and specific for type II collagen [14], and collagenase cleavage epitopes called COL2-3/4Cshort or C1 , 2C, which detect cleavages of both type II and ... C1 , 2C Col2CTX/Cr ratio C2 C C2 C, collagenase cleavage of triple-helical type II collagen; Col2CTx, crosslinked peptides from the C- telopeptide domain of type II collagen; COMP, cartilage oligomeric ... focal defects without overall thinning Therefore, to create a consistent and logical scale for evaluation of cartilage morphologic change, we collapsed the WORMS cartilage score to a 0-to-4 scale...
... distribution of each biomarker as the predictor We classified each participant according to maximum score of any BML (ordinal scale to 3) and two binary outcomes: maximum score of BML > and maximum score ... necessary for the progression of OA [3] In OA, bone has characteristic morphologic abnormalities, including altered joint congruency, bone marrow lesions (BMLs) [4], subchondral sclerosis, intraosseous ... Brandt K, Christy W, Cooke TD, Greenwald R, Hochberg M: Development of criteria for the classification and reporting of osteoarthritis Classification of osteoarthritis of the knee Diagnostic and...
... concentrations of oxy-tetracycline (table 6) No difference was observed in comparison to the confrols (F = 0.037, F4,1ooo, = 2.38) Oxy-tetracycline is known to be 15 ,( effective against Bacteria, Rickettsias, ... and dose (concentration of anitibiotic) (F = 0.43, F ! ! = 2.38) woo were Other antibiotics (Penicillin, Streptomycin, Kanamycin) No significant difference was found between the proportions of ... searched for using phase contract microscopy of tissue and haemolymph, and smears of flies after fixation in methanol and staining with p 100 solution of Giemsa for 12 hours The presence of viruses...
... GTTGTAGAGACACAGCCACCTTC ET3-R ET4 PT5-L CGGCAGTTTTCCGGTGAC ET4-L GTTGTAGAGACACAGCCACCTTC ET4-R TTCGTCGCCGGAGTTTGG S-1300 TTCCGACCAATCCACTCAAC PT5-R ET3 ATGTTCGCTGGCATACCTAG PT1-R PT5 PT1-L Product(bp) ... of three major storage products (oil, starch, and protein) through carbohydrate metabolism On the basis of these storage products, crops are designated as oleaginous, farinose, or proteinacious ... reduction, and lowered fertility in tomato [17, 18] Overexpression transformations showed lower sucrose concentration in leaves and increased growth rates of pea cotyledon [19, 20] Early stages of...
... is consistent with previous results, where higher expression levels of CCS52A coincided with higher levels of endocycle in Medicago nodules [27] Cell expansion and endocycle are also controlled ... approach allows a more focused detection of relevant genes with a possibly important biological significance than solely a low statistical significance level In Step 1, only 39 genes associated with ... functional category METABOLISM contained most of the genes for both traits For grain yield, it was followed by PROTEIN WITH BINDING FUNCTION OR COFACTOR REQUIREMENT and for grain dry matter content...
... (options were: primary school, middle school, some secondary school, completed secondary school, some college or vocational training, completed college or university, completed graduate degree or ... Heart Foundation, Cancer Research UK, Department of Health, Diabetes UK, Economic and Social Research Council, Medical Research Council, Research and Development Office for the Northern Ireland ... Aphroditi Stathi4 and Janice L Thompson1 Centre for Exercise, Nutrition and Health Sciences, School for Policy Studies University of Bristol, Bristol, UK School of Sport and Health, University of...
... row-vector indicating which haplotypes and how many copies are carried by the son; and b is a column indicating the random effects of the haplotypes; is a random polygenic effect of son i, and ... K, Crooks S: Documentation for CRI-MAP, version 2.4 Washington University School of Medicine St Louis; 1990 Page 11 of 12 (page number not for citation purposes) Genetics Selection Evolution ... not for citation purposes) Genetics Selection Evolution 2009, 41:24 http://www.gsejournal.org/content/41/1/24 Table 1: Level of significance of haplotype effects within locus/ haplotype block...
... Design of the study The study consists of three parts: Introduction, development and conclusion The first part is the introduction, which provides information about rationale, purposes, scope and ... defined as ―an activity that requires learners to arrive at an outcome from given information through some processes of thought, and which allows teachers to control and regulate that process‖ (Prabhu, ... reduce nervousness With the provision of topical information, students tended to focus on the details because they had been exposed to the global background of the topics Finally, with vocabulary...