0

a novel model for global customer

Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

Báo cáo khoa học

... systemlearns this as a non-transliteration but it is wronglyannotated as a transliteration in the gold standard.Arabic nouns have an article “al” attached to themwhich is translated in English as ... usesHidden Markov Models (Nabende, 2010; Darwish,2010; Jiampojamarn et al., 2010), Finite State Au-tomata (Noeman and Madkour, 2010) and Bayesianlearning (Kahki et al., 2011) to learn transliterationpairs ... InternationalLanguage Resources and Evaluation (LREC’10), Val-letta, Malta.Sittichai Jiampojamarn, Kenneth Dwyer, Shane Bergsma,Aditya Bhargava, Qing Dou, Mi-Young Kim, andGrzegorz Kondrak....
  • 9
  • 521
  • 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

Báo cáo khoa học

... thickness;Phenomenex, Aschaffenburg, Germany). The temperatureprogram used was as follows: 50 °C held isocratically for 5 min, followed by a ramp of 25 °CÆmin)1to a final A novel route for geranial formation A. ... ofcarotenoids.AbbreviationsCCD, carotenoid cleavage dioxygenase; GST, glutathione S-transferase; NIST, National Institute of Standards and Technology; OsCCD1,Oryza sativa carotenoid cleavage ... (1999) Co-oxidation of b-carotenecatalyzed by soybean and recombinant pea lipoxygen-ases. J Agric Food Chem 47, 4899–4906. A. Ilg et al. A novel route for geranial formationFEBS Journal 276 (2009)...
  • 12
  • 497
  • 0
Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt

Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt

Báo cáo khoa học

... availablestructural data of canonical mammalian class IIIa andmycobacterial class IIIc catalytic domains [5,7,9,25]nor do they parallel the findings on the noncanonicalclass IIIc AC Rv1900c [14]. Another novel ... non-conservative manner, glutamine-asparagine instead oflysine-aspartate. All mammalian membrane-boundACs possess a strictly conserved and spaced hexad ofcatalytic residues. Emerging from mostly bacterial ... the canonical transition-state stabilizing aspara-gine does not contact the substrate and mutagenesisshows that it appears not to be involved in catalysis.Furthermore the asparagine-aspartate...
  • 8
  • 401
  • 0
Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

Báo cáo khoa học

... day 30 displayed an airwayinflammation 18 h after treatment, in the same magni-tude as in animals challenged with a third HDM aero-sol on day 30 (data not shown). The animals werekilled after ... using a PhosphorImager with theimage quant software (both from Molecular Dynamics,Sunnyvale, CA, USA). As standards for SDS ⁄ PAGEautoradiography,75Se-labelled recombinant rat TrxR1 [41]and ... dust mite Dermatophagoides farinaeaugments proinflammatory mediator productions andaccessory function of alveolar macrophages: implica-tions for allergic sensitization and inflammation.J Immunol...
  • 12
  • 518
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Probabilistic Model for Fine-Grained Expert Search" pptx

Báo cáo khoa học

... query expansion (Macdonald and Ounis, 2007), hierarchical lan-guage model (Petkova and Croft, 2006), and for- mal model generation (Balog et al., 2006; Fang et al., 2006). However, all of them ... behind the quadruple is that a query may be matched with phrases in various forms (denoted as topic here) and an expert candidate may appear with various name masks (denoted as person here), ... Alias, new email (NAE) 7% / 0.4600 Ritiwari rti-wari@hotmail.com Table 1. Various masks and their ambiguity 1) Every occurrence of a candidate’s email address is normalized to the appropriate...
  • 9
  • 399
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Bayesian Model for Discovering Typological Implications" ppt

Báo cáo khoa học

... of all possible language/featurepairs are known. A sample of five languages and sixfeatures from the database are shown in Table 1.Importantly, the density of samples is not random. For certain ... Furthermore,some features are known for many languages. Thisis due to the fact that certain features take less effortto identify than others. Identifying, for instance, if a language has a particular set ... them are Indo-European and theother half are Austronesian. We will use a nearlyidentical model to the FLAT model, but instead ofhaving a single m variable, we have three: one for IE, one for Austronesian...
  • 8
  • 471
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Grammar Approximation by Representative Sublanguage: A New Model for Language Learning" potx

Báo cáo khoa học

... generalization stepsFigure 2: Example of a simple grammar lattice. All grammars generate , and only generates ( is a common lexicon for all the grammars)3 A Grammar Lattice as a Search Space for ... USArambow@cs.columbia.eduAbstractWe propose a new language learning model that learns a syntactic-semantic grammarfrom a small number of natural languagestrings annotated with their semantics, ... 832–839,Prague, Czech Republic, June 2007.c2007 Association for Computational LinguisticsGrammar Approximation by Representative Sublanguage: A New Model for Language LearningSmaranda MuresanInstitute...
  • 8
  • 402
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Sequencing Model for Situation Entity Classification" pdf

Báo cáo khoa học

... verbHASMODAL T if clause contains modal verbFREQADV T if clause contains frequency adverbMODALADV T if clause contains modal adverbVOLADV T if clause contains volitional adverbFIRSTVB lexical ... for a rule-based model. Ourmodels handle the defeasibility of these correlationsprobabilistically, as is standard for machine learning for natural language processing.8992 Discourse modes and ... a derivedsituation type. For example, a modal adverb cantrigger aspectual coercion:(6) Mickey probably paints houses. (P)Serious challenges for SE classification arise fromthe aspectual ambiguity...
  • 8
  • 458
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Morphographemic Model for Error Correction Nonconcatenative Strings" pot

Báo cáo khoa học

... takattab tukuttib 6 takaatab tukuutib 7 nkatab nkutib 8 ktatab ktutib 9 ktabab 10 staktab stuktib 11 ktaabab 12 ktawtab 13 ktawwab 14 ktanbab 15 ktanbay Q1 dahraj duhrij Q2 tadahraj ... Forms kadi~ kud~, *kidaa~ kaafil kuffal, *kufalaa~, *kuffaal kaffil kufalaaP sahm *Pashaam, suhuum, Pashum Patterns marked with * are morphologically plausi- ble, but do not occur lexically ... error is that conso- nant substitution may not take place before append- ing a suffix. For example/samaaP/'heaven' + {iyy) 'relative adjective' surfaces as (samaawiyy), where...
  • 7
  • 451
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Statistical Model for Lost Language Decipherment" pptx

Báo cáo khoa học

... thisresearch has similar goals, it typically builds oninformation or resources unavailable for ancienttexts, such as comparable corpora, a seed lexi-con, and cognate information (Fung and McKe-own, ... 2010.c2010 Association for Computational Linguistics A Statistical Model for Lost Language DeciphermentBenjamin Snyder and Regina BarzilayCSAILMassachusetts Institute of Technology{bsnyder,regina}@csail.mit.eduKevin ... technique for imposing structural sparsity constraints oncharacter-level mappings. We assume that an ac-curate alphabetic mapping between related lan-guages will be sparse in the following way: eachletter...
  • 10
  • 429
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Discriminative Model for Joint Morphological Disambiguation and Dependency Parsing" ppt

Báo cáo khoa học

... annotations.890UNIGRAMCASE−UNIGRAMCASE−CASE−LINKCASE−LINKCASE−LINKCASE−LINKCASE 6,genCASE 3,genCASE 3,nom 3,accCASEUNIGRAMCASE−UNIGRAMCASE−UNIGRAMCASE−CASE 2, CASELINKCASE 6,accCASE−BIGRAMCASE−BIGRAMTREEWORD−LINKWORDLINKCASE ... neighboring variables are4Variables for link labels can be integrated in a straightfor-ward manner, if desired.true and it evaluates to a non-negative real num-ber; otherwise, it evaluates to 1 and ... pipeline parser. For adjectives, the ex-ample shown in Table 1 and Figure 1 is a typical sce-nario, where an accusative adjective was tagged asnominative, and was then misanalyzed by the parseras...
  • 10
  • 411
  • 0
Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc

Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc

Sức khỏe giới tính

... (P.B. and P.B.) have used Ruta 6 and Ca3(PO4)2combination therapy to treat 15 patients diagnosed withadvanced intracranial malignant brain cancer at the PBHResearch Foundation, Kolkata, ... intracranial brain cancers.The 15 patients (9 male, 6 female) with intracranial braincancers who were treated with Ruta 6 + Ca3(PO4)2at thePBH Research Foundation, Kolkata, India, had ... therodent model. J Agr Food Chem 47: 1078-1082, 1999.16. Afanas'ev IB, Ostrakhovitch EA, Mikhal'chick EV,Ibragimova GA and Korkina LG: Enhancement of antioxidantand anti-inflammatory activities...
  • 8
  • 670
  • 0
The Privatization of Italian Savings Banks – A Role Model for Germany?* doc

The Privatization of Italian Savings Banks – A Role Model for Germany?* doc

Ngân hàng - Tín dụng

... industriale), which was a public holdingcompany containing the three largest private banks (Banca Commerciale Italiana, CreditoItaliano, and Banca di Roma) and a large number of public banks (Körnert ... special status easily.Apart from legal considerations, the main arguments brought forward against the privati-zation of the savings banks are threefold. First, only the savings banks can guarantee ... Modena)Credito Italiano GroupUniCredito SpAPrivatizationCredito ItalianoCredito RomagnoloBanking Group(Emilia Romagna,Bologna), laterRolo Banca 1473Banca CRT(Cassa diRisparmio di Turino)Cariverona(Cassa...
  • 19
  • 469
  • 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Báo cáo khoa học

... short chain; Aco1,aconitase 1; Agt), alanine-glyoxylateaminotransferase knockout; Aldh2, aldehydedehydrogenase 2; Car3, carbonic anhydr-ase 3; Cat, catalase; Dao1,D-amino acidoxidase 1; ... Coomassie blueR-250 for preparative gels [11] or silver nitrate for analyti-cal gels [12].Image capture and analysisGels were scanned using a UMAX scanner (AmershamBiosciences, Barcelona, ... Wang X, Santana A, Roy-Chowdhury N, Torres A, Shapiro LJ &Roy-Chowdhury J (2006) Alanine-glyoxylate amino-transferase-deficient mice, a model for primaryhyperoxaluria that responds to adenoviral...
  • 9
  • 481
  • 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Báo cáo khoa học

... ATTAAGGAGCTTCGGGAGATG Exon 7 380P558 CTCTTATACCCAATGCTGCTG Exon 10CYP1 1A First pairP561 GCCTTTGAGTCCATCACTAAC Exon 4 628P562 CCAGTGTCTTGGCAGGAATC Exon 8Nested pairP563 ATGTGGCTGCATGGGACGTG ... controlplacenta, whole human skin, normal epidermal and immor-talized keratinocytes, dermal fibroblasts, squamous cellcarcinoma and five human melanomas. Thus, these dataclarify in detail the cutaneous ... 390P564 TCTGCAGGGTCACGGAGATG Exon 7Mouse genesFDX1 P581 AAATTGGCGACTCTCTGCTAG Exon 2 295P582 CTTGCTCATGTCAACAGACTG Exon 4FDXR P583 CTTGGAGTCATCCCCAACAC Exon 10 281P584 TGGCCTCGAGAGACTTCCTC Exon...
  • 11
  • 475
  • 0

Xem thêm