... Arrabal-Polo, Miguel Arrabal-Martin, Sergio Merino-Salas, Fernando López-Carmona Pintado, Salvador Arias-Santiago, Jacinto Orgaz-Molina, Maria Sierra Giron-Prieto, Santiago Melón, Mar a De O a, ... Human Papillomavirus 187 Miguel Ángel Arrabal-Polo, Mar a Sierra Girón-Prieto, Jacinto Orgaz-Molina, Sergio Merino-Salas, Fernando Lopez-Carmona Pintado, Miguel Arrabal-Martin and Salvador Arias-Santiago ... Detection Human Papillomavirus 27 Angela Adamski da Silva Reis, Daniela de Melo e Silva, Cláudio Carlos da Silva and Aparecido Divino da Cruz Chapter HPV Diagnosis in Vaccination Era 57 Fátima Galán-Sánchez...
... page intentionally left blank Law, Legitimacy and the Rationing of Healthcare A Contextual and Comparative Perspective Keith Syrett argues for a reappraisal of the role played by public law adjudication ... active, rational exercise in making 37 38 39 40 41 42 43 Klein, Day and Redmayne, Managing Scarcity at Tragakes and Vienonen, Key Issues in Rationing at Klein, Day and Redmayne, Managing Scarcity at ... Are Created Equal’ at 213 Tragakes and Vienonen, Key Issues in Rationing at 2; see also Klein, Day and Redmayne, Managing Scarcity at Why ‘Ration’ Healthcare Resources? 27 alternative way of...
... those designations appear in this book, and the publisher was aware of a trademark claim, the designations have been printed in initial caps or all caps Cataloging-in-Publication Data is on file ... Keller, Ali Keshavarzi, Brucek Khailany, Jaeha Kim, Volkan Kursun, Simon Knowles, Ram Krishnamurthy, Austin Lee, Ana Sonia Leon, Shih-Lien Lu, Sanu Mathew, Aleksandar Milenkovic, Sam Naffziger, Braden ... in an indeterminate output level and dissipates static power It is usually an unwanted condition aa g2 1 g1 1 b b b b b OFF OFF OFF ON a (a) aaaa g2 b 1 g1 1 b ON OFF OFF OFF aa g1 b aa a...
... content analyses, interpreted the qualitative data, and drafted and revised the manuscript KH, SM and JH conducted the qualitative research and Page of 10 (page number not for citation purposes) Health ... meta-analysis Int J Impot Res 2004, 16(4):369-381 Rowland DL, Strassberg DS, de Gouveia Brazao CA, Slob AK: Ejaculatory latency and control in men with premature ejaculation: an analysis across ... were content analyzed and summarized to determine the participants' understanding and comprehension of each item and response scale Results A total of 172 males with PE and 67 female partners of...
... MHC and interferon-gamma Cell 1988, 52:773-782 30 Kitaura J, Song J, Tsai M, Asai K, Maeda-Yamamoto M, Mocsai A, Kawakami Y, Liu FT, Lowell CA, Barisas BG, Galli SJ, Kawakami T: Evidence that ... with albendazole and some studies have suggested a beneficial effect for glucocorticoids during the allergic and inflammatory stages of the disease Giardia lamblia is a protozoan parasite that ... conceived and managed the study, drafted the manuscript, managed references, generated figures and tables, and has given final approval of the version to be published All authors have read and approved...
... paper with a short discussion of the limits and potentials of our approach DATA AND MODEL The data were extracted from the data set analysed by Heringstad, Klemetsdal and Ruane [9] and included ... parameters equal to 0.001 was chosen For all other parameters, normal priors with mean zero and variance 1000 were assumed Bayesian analysis of mastitis resistance 533 SIRE RANKING A first way to rank ... of all sire effects and hence reveals known and unknown dependencies One advantage of the MCMC based Bayesian approach is that these probabilities, which cannot be expressed analytically, can easily...
... pragmatics and conversation analysis This is the first study of a speech act conducted on the basis of pragmatics and CA in English and Vietnamese The combination of pragmatics and CA takes advantage ... analyzed as part and parcel As Cameron (2002: 53) puts it: Any given instance of language use is analysed as part of a whole social situation; more generally, ways of using and understanding language ... essential and valuable in the teaching and learning of English by Vietnamese learners and Vietnamese by native speakers of English 1.1.2 Society, culture and language Social acts or ‘speech acts’ (Austin,...
... pp.927-938 935 (a) Best, mean and median objective valuses for Case I (b) Standard deviations for Case I (c) Best, mean and median objective values for Case II (d) Standard deviations for Case II Figure ... William Palm Professor of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is...
... based on data from a model mill depicting a typical Scandinavian pulp mill As an addition, Papers IV, VI and VIII are based on data from existing European pulp and paper mills and cover a broader ... papers are based on data for a typical Scandinavian kraft pulp mill of today Methodology and model Paper VII Methodology and model Paper IX Research theme Paper VIII The paper is based on data ... Ruohonen and Ahtila 2009) and for a few real TMP and ground wood (GW) mills (Noởl 1995; Noởl and Boisvert 1998; Schaareman, Verstraeten et al 2000; Lafourcade, Labidi et al 2003; Ruohonen and Ahtila...
... the search for the infectious agent causing tobacco mosaic plants and gives their leaves a mosaic coloration ADOLF MEYER • A German scientist demonstrated that the disease was contagious and proposed ... Using a microscope, he examined the sap and was unable to identify a microbe D IVANOWSKY • 1890: A Russian scientist proposed that tobacco mosaic disease was caused by a bacterium that was either ... contain a gene that codes for RNA replicase • RNA replicase is an enzyme that uses viral RNA as a template to produce complementary RNA • RNA ->DNA ->RNA: Some RNA viruses encode reverse transcriptase,...
... Africa Sub-Saharan Africa Eastern Africa Middle Africa Northern Africa Southern Africa Western Africa Latin America and Caribbean Caribbean Central America South America Northern America Asia ... Central Arkansas Louisiana* Oklahoma Texas West Mountain Arizona Colorado Idaho Montana Nevada New Mexico Utah Wyoming Pacific Alaska California San Francisco-Oakland San Jose-Monterey Los Angeles ... Chapter Preventive Strategies in Epithelial Ovarian Cancer 15 Gina M Mantia-Smaldone and Nathalie Scholler Chapter Screening for Ovarian Cancer in Women 43 Duangmani Thanapprapasr and Sarikapan...
... Public MA OM MA Agape MA MA MA MA 46 Siegeauto Franceauto Gastryx MA MA MA 27 - 41 - Table - Dimensions and Features of the Management Accountant’s Activity Activity of Management Accountants Zones ... with management accountants and operational managers in one case study The absence of any variations between the discourses of operational managers and those of management accountants naturally ... our understanding of how relationships between operational managers and management accountants in particular are managed, including the bargaining and repeated attempts to convince and seduce...
... CATGGAGATGCAACCTATAATAGTAGCAATAGTAGCATT AGTAGTAGCAATAATAATAGCAATAGCTGTGTGGTCCATAGTAATCATAGAATAGG and NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; ... GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; for the R5 vpu TM region, R5TM-F, CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG AGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGTGGACCATAGTATATATAGAATAGG and R5-TM-R, AATT CCTATTCTATATATACTATGGTCCACACGACTATTGCTATGATTAGTGCTA ... GGATCCATGTTAAATTTAGATTATAAATTAGGAGTA GG and Vpu-R5-R, GAATTCATTACAAATCATTAACATCCAAAAGCC The amplified fragments designated as NL vpu and R5 vpu respectively, were cloned in plasmid pGEMT-Easy (Promega, Madison,...
... Mabuchi A, Kotani A, Kawakami A, Yamamoto S, Uchida A, Nakamura K, Notoya K, Nakamura Y, Ikegawa S: An aspartic acid repeat polymorphism in asporin inhibits chondrogenesis and increases susceptibility ... to osteoarthritis Nat Genet 2005, 37:138-144 Mabuchi A, Ikeda T, Fukuda A, Koshizuka Y, Hiraoka H, Miyoshi K, Haga N, Kawaguchi H, Kawakami A, Yamamoto S, Takatori Y, Nakamura K, Ikegawa S: Identification ... 46:456-462 10 Mototani H, Mabuchi A, Saito S, Fujioka M, Iida A, Takatori Y, Kotani A, Kubo T, Nakamura K, Sekine A, Murakami Y, Tsunoda T, Notoya K, Nakamura Y, Ikegawa S: A functional single nucleotide...
... individual managed equally well on the training and validation cases and actually had a lower fitness on the validation data than on the training set which indicates that there was no overtraining ... than a random guess, the average distance between the predicted cleavage site and the real cleavage site was calculated A GP Method for the Identification of Signal Peptides Table 2: Performance ... as to extracellular and membrane cellular location,” in Evolutionary Programming VII: Proceedings of the 7th Annual Conference on Evolutionary Programming, V W Porto, N Saravanan, D Waagen, and...
... Hayry and Tuija Takala ¨ Human genetic databanks are, on a local and limited scale, a reality in all countries where healthcare systems are reasonably advanced Tissue samples, which can be genetically ... on human genetic databases PIIA TAMMPUU Part III 11 73 Legal issues 89 Regulating human genetic databases in Europe JANE KAYE 12 Consent and population genetic databases: a comparative analysis ... population databases and to distinguish in legislation between different kinds of databases and database research National legislation about human population databases is partly based on misleading...