Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"

... models to study HCV. Int. J. Med. Sci. 2006, 3 30Figure 1. Life cycle of HCV. The steps of the viral life cycle are depicted schematically. The topology of HCV structural and nonstructural proteins ... recently, recombinant infectious HCV could be produced in cell culture, rendering all steps of the viral life cycle, including entry and release of viral particles, amenable to systematic analysis. ... family and is the only member of the Hepacivirus genus. HCV infection is a major cause of chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma (HCC) worldwide [1]. Therapeutic options...

Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx

... Hermoso,J.,Pignol,D.,Kerfelec,B.,Crenon,I.,Chapus ,C. &Fontecilla-Camps, J .C. (1996) Lipase activation by nonionicdetergents. The crystal structure of the porcine lipase-colipase-tetraethylene glycol monooctyl ether ... after coexpression of S132T and WWWmutants. Schematic dimeric structures of LPLin head-to-tail conﬁguration after cotransfec-tion of inactive LPL mutants and recovery of catalytic activity (A). ... respect to how surface-loop positionsaﬀect substrate access to the catalytic site. In the closed form,the surface loop covers the catalytic site, which becomesinaccessible to solvent. Large conformational...

Báo cáo Y học: Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the ﬁssion yeast Schizosaccharomyces pombe pdf

... (CCGCTCGAGCCTAACGGTGTGGAATAC, which hybridizes at positions 715–732 inthe tps1+ORF and shows an internal XhoIsite),andthe3¢oligonucleotide TAF-3 (CTACGGCGGCCGCCCGAGCTAGAATTCATCGA, which hybridizes at the 3¢ end of tps1+ORF ... oligonucleotide TAG-3 (CTACGGCGGCCGCCATTTTTATGAATGGAAA, whichhybridizes at the 3¢ end of ntp1+ORF and incorporates aNotI site placed immediately upstream of the TAA stopcodon). The restriction ... separatelyimplicated in synthesis and breakdown of trehalose couldprovide improved control efﬁciency of the respectiveenzymatic activities as has been suggested in the case of the synthesizing Tps1–Tps2 complex...

Báo cáo Y học: Molecular cloning of columbamine O-methyltransferase from cultured Coptis japonica cells pot

... isolation of CoOMT from C. japonica ESTs, the expression of functionally activerecombinant enzyme, and its characterization. Characteri-zation of its specificity showed that Coptis CoOMT couldmethylate ... [20,21].Construction and sequencing of cDNA library of C. japonicaPoly(A)+RNA was isolated, and a cDNA library wasconstructed as described elsewhere [14]. The cDNAFig. 1. Schematic biosynthetic pathway ... OMT(CJEST64), rapid amplification of the 5¢ end of cDNA(5¢RACE) was carried out using a Marathon cDNAAmplification Kit (Clontech). Gene-speci c antisense primer(5¢-CTCCAAACTGAGAACTCTTCCG-3¢)wasdesignedbased...

Báo cáo Y học: Molecular characterization of MRG19 of Saccharomyces cerevisiae Implication in the regulation of galactose and nonfermentable carbon source utilization pdf

... plasmid was named pYCfCTA1::lacZ. A portion of MRG19 was ampliﬁed by PCR usingprimers PJB102 (5¢-GACCGTAGGTACCATGTTGGCTTCAG-3¢) and PJB103 (5¢-CGGGCCCCTC GAGGCCCATCATCTAA-3¢) carrying KpnIandXhoI ... Broach, J.R. & Rowe, L.B. (1978) Regulation of galactose pathway in Saccharomyces cerevisiae: Induction of uridyl transferase mRNA and dependency on GAL4 gene func-tion. Proc. Natl Acad. Sci. ... ColdSpring Harbor. New York.40. Platt, T. (1984) Toxicity of 2-deoxygalactose to Saccharomycescerevisiae cells constitutively synthesising galactose metabolisingenzymes. Mol. Cell Biol. 4, 994–996.41....

Tài liệu Báo cáo Y học: Re-oxygenation of hypoxic simian virus 40 (SV40)-infected CV1 cells causes distinct changes of SV40 minichromosome-associated replication proteins doc

... (1994)Phosphorylation of the p34 subunit of human single-stranded-DNA-binding protein in cyclin A-activated G1 extracts iscatalyzed by cdk-cyclin A complex and DNA-dependent proteinkinase. Proc. Natl Acad. ... j,signalintensityofsuper-coiled DNA (sc). H, hypoxic.Fig. 5. Dissociation of minichromosome-bound RPA-34 by excesscompetitor single-stranded DNA. Minichromosomes of hypoxic orre-oxygenated SV40-infected ... origin in hypoxic and inre-oxygenated cells. T antigen-catalysed unwinding of theSV40 origin occurred, however, only after re-oxygenation asindicated by (a) increased sensitivity of re-oxygenatedminichromosomes...

Báo cáo Y học: Functional epitope of common c chain for interleukin-4 binding ppt

... receptors are members of the type I cytokinereceptor superfamily, w hich is charac terized by the presence of at least one cytokine-binding homology r egion (CHR)composed of two ﬁbronectin type ... cytokine receptors, except for hgp130 [51] andgranulocyte colony-stimulating factor receptor [54]. There-fore, c cCHR, the short form of the c cectodomain, may beTable 2. Double mutant cycle ... suited to form crystals of IL-4–IL-4BP c cthan thecomplete c cectodomain for solving the structure of t he low-afﬁnity complex by X-ray diffraction.It appears that binding of c cto IL-4 is...

Báo cáo Y học: Transient activation of the c-Jun N-terminal kinase (JNK) activity by ligation of the tetraspan CD53 antigen in different cell types pptx

... JNK activity, the cells were incubated for 6 hin th e presence of MEM53 antibody. The luciferase activity was cor-rected for the eﬃciency of transfection by determining the ac tivity of plasmid ... tetraspaninsuperfamily: molecular facilitators. FASEB J. 11 , 428–442.2. Horejsi, V. & Vlcek, C. (1991) Novel structurally distinct family of leucocyte surface glyco proteins inclu ding CD 9, CD37, CD53 ... reintroduction of CD9 in the cell func tionsas a b rake [31]. In addition, CD53 deﬁciency has a clinicalphenotype similar to those of inherited defects of celladhesion molecules [32]. Because of the complex...

Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

... G, Casciani CU. Hepatitis C virus infection in Italian kidney graft recipients. Changing risk factors and hepatitis C virus genotypes. Ital J Gastroenterology Hepatology 1997; 29:448-55. 67. Cheung ... Non-A Non-B Hepatitis Research Group. Effect of screening for hepatitis C virus antibody and hepatitis B core antibody on incidence of post-transfusion hepatitis. Lancet 1991;338:1040–1041 46. ... Lack of evidence of sexual transmission of hepatitis C virus in a prospective cohort study of men who have sex with men. American Journal of Public Health. 2005, 95(3):502-5. 55. Niu MT, Coleman...

Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

... hepatitis C, liver fibrosis, cirrhosis, hepatocellular carcinoma, HCV, HCC 1. Introduction Chronic hepatitis C is the most common cause of chronic liver disease and cirrhosis, and the most common ... rate of chronic HCV infection than Caucasians and Hispanic whites. In prospective surveys among inner-city Baltimore (Maryland, U.S.) injection drug users, the prevalence of chronic HCV infection ... HCV infection or from the underlying immune stimulation caused by chronic infection. 8. Summary The chronic nature of hepatitis C infection influences the clinical approach and management of...

Xem thêm

Từ khóa: báo cáo y học báo cáo y học báo cáo y học cổ truyền mẫu báo cáo y học cổ truyền bao cao y hoc colchicin phan ban luan trong bao cao y hoc co truyen prevention of hepatitis c virus recommendations for prevention and control of hepatitis c virus infection progress toward prevention and control of hepatitis c virus infection recommendations for prevention and control of hepatitis c virus prevention and control of hepatitis c virus prevention of hepatitis c virus infection báo cáo khoa học y học báo cáo y tế học đường mẫu báo cáo y tế học đường Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam