prevention of hepatitis c virus
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
Ngày tải lên :
02/11/2012, 09:56
...
Hepatitis C virus all need to be elucidated.
Conflict of interest
The authors have declared that no conflict of interest
exists.
References
1. WHO. Global surveillance and control of hepatitis C. ... world. Incidence rates across the world fluctuate and are
difficult to calculate given the asymptomatic, often latent nature of the disease prior to clinical presentation. Prevalence
rates across ... A, Braconier JH,
Esteban JI, Hadziyannis SJ, Manns MP, Saracco G, Thomas HC,
Trepo C. Epidemiology of hepatitis C virus infection in seven
European Union countries: a critical analysis of the...
- 6
- 486
- 0
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"
Ngày tải lên :
02/11/2012, 09:56
... cirrhosis, hepatocellular carcinoma, HCV, HCC
1. Introduction
Chronic hepatitis C is the most common cause of
chronic liver disease and cirrhosis, and the most common
indication for liver transplantation ...
immunodeficient patients. The anti-HCV assay detects
greater than 90% of HCV infections after the initial 3
months.
4. Chronic Hepatitis C
Chronic hepatitis C is marked by the persistence of
HCV ... development of
complications, among different racial and ethnic groups
with HCV infection. For unclear reasons, African
Americans appear to have a higher rate of chronic HCV
infection than Caucasians...
- 6
- 530
- 0
Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"
Ngày tải lên :
02/11/2012, 10:00
... Rice CM. Efficient initiation of HCV
RNA replication in cell culture. Science 2000; 290: 1972-4.
10. Bartosch B, Dubuisson J and Cosset FL. Infectious hepatitis C virus
pseudo-particles containing ... Comparison of different replicon systems. A selection of different bicistronic and monocistronic replicon constructs
including subgenomic and full-length HCV sequences is depicted schematically. ... research focus includes molecular
biology and immunology of viral hepatitis B and C as well
as basic and clinical aspects of gastrointestinal
malignancies, especially hepatocellular and colorectal...
- 6
- 497
- 1
Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"
Ngày tải lên :
02/11/2012, 11:12
... genotype C in China [34]. Accumulated data suggest the importance of genotype,
subgroup and recombination that may influence the biological characteristics of virus and clinical outcome of HBV infection. ... adolescent vaccinatin programmes in Italy. Vaccine 2000;18:S31-S34.
77. Chang MH, Chen CJ,cLai MS. Universal hepatitis B vaccination in Taiwan and the incidence of hepatocellular carcinoma in children. ... efficacy of newborn vaccination was 85.42%. In countries such as Italy and the United States, the incidence
of acute hepatitis B has declined dramatically during the past decade after vaccination...
- 8
- 643
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
Ngày tải lên :
20/02/2014, 01:20
... Pasteur, Paris,
France). The primers used were VB1: 5¢-AAACATATGA
GCATGAGCTACCACCTGGACC-3¢ and VB3: 5¢-CTCG
AGCTTCACAAGAAACTTCTGC-3¢. The PCR fragment
was cleaved by the restriction enzymes Nde1 ... molecular clone
pCV-J4L6S [21] kindly provided by J. Bukh (NIH, Beth-
esda, MD, USA). The primers used were NS5Bj4s2:
5¢-GATATCATGTCAATGTCCTATACGTGGAC-3¢ and
NS5Bj4r 5¢-AAACTCGAGGCGGGGTCGGGCACGAGA
CAGG-3¢. ... relevance of sequences
and ⁄ or structures implicated in this step of viral RNA
replication in the infected cells.
Experimental procedures
Recombinant HCV RdRp
The recombinant HCV NS5B-D21 of H77...
- 15
- 597
- 0
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf
Ngày tải lên :
16/03/2014, 05:20
... infection
technical difficulties of primary cell culture
HCV-LP Infection, morphogenesis cell attachment
vaccination
morphogenesis
no secretion of particles
independence of CD81 for entry
HCVpp ... particles pro-
duced in insect cells using a recombinant baculovirus
containing the cDNA of HCV structural proteins of
genotype 1b or 1a [48]. HCV-like particles were
observed by electron microscopy ... are chronically infected worldwide [1]. HCV infec-
tion causes major health problems because it is a
principle cause of chronic liver diseases, including cir-
rhosis and hepatocellular carcinoma....
- 14
- 532
- 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
Ngày tải lên :
18/06/2014, 18:20
...
indicated by a dot.
A
63
TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA
TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA
GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ...
GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG
GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG
CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ...
CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT
CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT
283
B
Background1 TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCG...
- 12
- 354
- 0
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx
Ngày tải lên :
10/08/2014, 23:21
... al . Journal of Medical Case Reports 2011, 5:246
http://www.jmedicalcasereports.com/content/5/1/246
Page 3 of 4
CAS E REP O R T Open Access
Sustained eradication of hepatitis C virus by
low-dose ... transplant recipients [2]. Besides
accelerated deterioration of liver function in chronic
HCV infection, HCV-related glomerulopathy [3] and
HCV-associated fibrosing cholestatic hepatitis [4] ... the end of the article
Chang et al . Journal of Medical Case Reports 2011, 5:246
http://www.jmedicalcasereports.com/content/5/1/246
JOURNAL OF MEDICAL
CASE REPORTS
© 2011 Chang et al; licensee...
- 4
- 282
- 0
Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt
Ngày tải lên :
11/08/2014, 07:21
... sequence
(5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc
ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). The
Rluc:miR-328 binding site reporter constructs, in which
Rluc is coupled ... HCV IRES nt 1-515 segment was amplified by PCR
from pHCV7 7c using forward (5'-gcgcgcggatccgccagccccct-
gatgggggcgacac-3') and reverse (5'-gcgcgcggatccaggttgcgac-
cgctcggaagtcttcc-3') ... (5'-
gagagagaattccggtcgggacgctctggcc-3') and reverse (5'gcgcgcaagcttcttaat-
gctttcgctttcc-3') oligonucleotides, and cloned in the EcoRI/HindIII sites of
pBluescript II KS(+) vector (Invitrogen),...
- 13
- 362
- 0
Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot
Ngày tải lên :
11/08/2014, 10:22
... Santantonio T, Cucchiarini M,
Cerny A, Pape GR: Association of hepatitis C virus- specific
CD8+ T cells with viral clearance in acute hepatitis C. J Infect
Dis 2000, 181:1528-1536.
3. Pham TN, MacParland ... BioMed Central
Page 1 of 3
(page number not for citation purposes)
Journal of Medical Case Reports
Open Access
Case report
Recurrence of hepatitis C virus during leucocytopenia and
spontaneous clearance ... We
describe here the case of a 69 year old man with acute hep-
atitis C virus infection who developed propylthiouracil-
induced leucocytopenia, followed by cytopenia-induced
HCV recurrence. With...
- 3
- 232
- 0
báo cáo khoa học: " The effectiveness of behavioural interventions in the primary prevention of Hepatitis C amongst injecting drug users: a randomised controlled trial and lessons learned" pot
Ngày tải lên :
11/08/2014, 18:20
... hepatitis C. Stratification was
achieved in blocks of six within each variable, such that in
each block of six half of the clients would receive SEC and
half of the clients EPC. This method of stratified ... of
their effectiveness and cost-effectiveness in pragmatic clin-
ical trials.
Conclusion
We were not able to prove the efficacy of EPC in compar-
ison with SEC in the prevention of hepatitis C in IDUs.
Notwithstanding ... Behaviour Scale did not account
for differences on any of the outcome measures.
Discussion
We were not able to demonstrate the efficacy of EPC com-
pared to SEC in the prevention of hepatitis C amongst
injecting...
- 12
- 454
- 0
Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx
Ngày tải lên :
11/08/2014, 21:21
... N:
Predictors of the efficacy of interferon therapy in chronic hepatitis C
virus infection. Tokyo-Chiba Hepatitis Research Group 1997, 113:558-66.
9. Kaufman RJ: The Double-stranded RNA-activated ... High prevalence of hepatitis C virus
infection in the largest province of Pakistan. J Dig Dis 2008, 9:95-103.
4. Brass V, Moradpour D, Blum HE: Molecular virology of hepatitis C virus
(HCV): 2006 ... are carriers for HCV [2].
In 60-80% cases HCV may lead to hepatocellular carci-
noma (HCC) [3]. It comprises of 9600 nucleotides that
predetermines a polypeptide containing 3010-3033
amino acids...
- 5
- 254
- 0
Báo cáo y học: " Characterization of thiobarbituric acid derivatives as inhibitors of hepatitis C virus NS5B polymerase" pot
Ngày tải lên :
11/08/2014, 21:21
... Bailey C, Bosserman M,
Cellucci A, Forte E, Incitti I, Orsatti L, Koch U, De Francesco R, Olsen DB,
Carroll SS, Migliaccio G: Characterization of the inhibition of hepatitis C
virus RNA replication ... Greenwood C, Gutshall LL, Maley D, DelVecchio A, Macarron R,
Hofmann GA, Alnoah Z, Cheng HY, Chan G, Khandekar S, Keenan RM,
Sarisky RT: Identification and biological characterization of heterocyclic
inhibitors ... Bisbocci M, Incitti I, Orsatti L, Harper S, Stansfield I,
Rowley M, De Francesco R, Migliaccio G: Mechanism of action and
antiviral activity of benzimidazole-based allosteric inhibitors of the
hepatitis...
- 4
- 304
- 0
Báo cáo y học: "Patient-to-patient transmission of hepatitis C virus (HCV) during colonoscopy diagnosis" pot
Ngày tải lên :
12/08/2014, 01:21
... amplifi-
cation and direct sequencing of the NS5B region were
5’ -TATGATACYCGCTGYTTYGACTC-3’ (sense), 5’ -
GTACCTRGTCATAGCCTCCGTGAA-3 ’ (antisense),
and for the amplificationoftheE1-E2region,
5’ -CGCATGGCYTGGGAYATGAT-3’ ... step, correct
disinfection of colonoscopes could not be checked due
to a failure of the printer connected to the disinfection
device. In addition, technical staff members in char ge of
colonoscope ... 9
light on mechanisms of HCV transmission because the
source of infection can be traced more accurately [8].
HCV infection associated with medical procedures,
which are still unrecognised or underestimated,...
- 9
- 361
- 0
