A comparative study of PKS in indonesia and PAS in malaysia (1998 2005)
A comparative study of insults in vietnamese and american english
... The Comparative Study of Insults in Vietnamese and American English aimed at providing Vietnamese users of English and American users of Vietnamese with some knowledge about social factors influencing ... being female 3.3 DATA ANALYSIS METHODS First, all the Vietnamese data and the American data were tabulated separately Second, the trends in each group of data for each social factor of age, as ... RESEARCH QUESTIONS What are the influences of social factors on Vietnamese and American perceptions of insults? What are the similarities and differences between Vietnamese and American people in...
- 26
- 1,460
- 1
A comparative study of criticism between american and vietnamese online newspapers
... percentages of direct/indirect criticism between American and Vietnamese online newspapers through the layout and illustrations of articles as well as the language used 4.2 4.2.1 Data analysis and ... 4, a comparison of criticism in American and Vietnamese e -newspapers has been conducted Following is the summary of major similarities and differences in criticism between American and Vietnamese ... Implications 4.3.1 Readers’ problems when reading Vietnamese and American newspapers The above part shows many differences between Vietnamese and American newspapers However, there are two main areas...
- 37
- 756
- 6
Báo cáo khoa học: "A comparative study of Sephadex, glass wool and Percoll separation techniques on sperm quality and IVF results for cryopreserved bovine semen" pptx
... SE (n = 28) Sperm separation techniques on IVF in cryopreserved bovine semen 253 Table Effect of glass wool filtration and Percoll separation of spermatozoa on IVF results Cleavage Spermatozoa ... = 6) Table Effect of control, Sephadex and glass wool filtration of spermatozoa on in-vitro fertilization (IVF) results Cleavage Spermatozoa treatment Control Sephadex Glass wool a,b Frequency ... aim of this study was to find the most effective method by comparing the efficacy of sperm separation methods (Sephadex, glass wool and Percoll) on sperm quality, such as motility, morphology and...
- 7
- 496
- 2
Getting migrant labour policies right for citizens a comparative study of france, canada, singapore and dubai
... France and Canada and Singapore and Dubai are more appropriately compared in pairs because of their similar migrant labour and political realities However, it would add value if a finding in one case ... BIBLIOGRAPHY 95 iii SUMMARY Getting Migrant Labour Policies Right for Citizens: A Comparative Study of France, Canada, Singapore and Dubai Amidst pessimistic economic outlook faced by many developed ... because many mainstream parties tend to have broad agendas Voters’ lack of support for a party may not be because the party has a certain stand on migrant labour Instead it may be because of...
- 115
- 584
- 0
A comparative study of lexical cohesion in english and vietnamese newspaper articles
... To compare the amount of lexical cohesive items in English newspaper articles and Vietnamese ones - To suggest some practical applications of Lexical Cohesion in teaching and in learning English ... adjectives and adverbs, particularly the later, are repeated in a very limited rate Almost all of adjectives and adverbs in newspaper articles have neutral nuances of meaning and they are used ... The practical task in the study is to analyze and compare the usage of lexical cohesion in English Newspaper and in Vietnamese newspaper articles taken from the indicated websites It is carried...
- 73
- 1,661
- 4
Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata pot
... from the liver of yellowtail, and found that the one-sided accumulation of arachidonic acid into PtdIns is attained in the presence of large amounts of docosahexaenoic acid and that several acyltransferase ... clarify the involvement of the PtdIns cycle in the accumulation of arachidonic acid in PtdIns of fish Fig Effects of docosahexaenoic acid (DHA) on the incorporation of [14C]arachidonic acid (*AA) ... systems of the yellowtail enable PtdIns to accumulate arachidonate in the presence of large amounts of docosahexaenoic acid and a limited supply of arachidonic acid As PtdIns plays an important...
- 8
- 619
- 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG ... Heterologous priming-boosting with DNA and modied vaccinia virus Ankara expressing tryparedoxin peroxidase promotes long-term memory against Leishmania major in susceptible BALB c mice Infect Immun 75, ... min) and protein content in the supernatants determined by the Bradford protein assay (Bio-Rad) using BSA as standard L major protein extracts Comparison of L major tryparedoxin peroxidases in...
- 16
- 483
- 0
báo cáo hóa học: " A comparative study on approximate entropy measure and poincaré plot indexes of minimum foot clearance variability in the elderly during walking" pptx
... implications of nonlinear variability indexes that have been utilized to characterize MFC signals of the elderly subjects during walking Poincaré plot geometry and ApEn analysis of MFC gait data of elderly ... complex and nonlinear [5-7], the application of nonlinear technique seems appropriate In this study, we, therefore, investigate the two types of nonlinear variability indexes (Approximate entropy and ... gait impairment Correlation analysis Correlation analysis was designed to quantify the relationship of mean MFC with Poincaré plot indexes and ApEn values, and the relationships among these measures...
- 10
- 471
- 0
báo cáo hóa học:" A Comparative Study of HIV/AIDS: The Knowledge, Attitudes, and Risk Behaviors of Schizophrenic and Diabetic Patients in Regard to HIV/AIDS in Nigeria" doc
... regard to HIV/ AIDS; • To determine the knowledge, attitudes, and risk behaviors of diabetic patients in regard to HIV/AIDS; and • To compare these groups on these parameters and make conclusions as ... and risk behaviors of schizophrenic patients with those of diabetic patients Specific objectives: • To determine the knowledge, attitudes, and risk behaviors of schizophrenic patients in regard ... and risk behaviors, in particular, are rather scanty on HIV/AIDS among psychiatric patients in the country Study Objectives The present study was designed to compare the HIV/AIDS knowledge, attitudes,...
- 6
- 556
- 0
Từ khóa: summary a comparative study on invitations in english and vietnamese in terms of crosscultural perspectiveliberalisation crisis and restructuring a comparative study of bank performance and bank governance in south east asiaa comparative study of british and vietnamese funeral ritualsa case study of the rai lepcha and brahmin chhetri in sikkim and kalimpong west bengal indiaa comparative study of piperidinium and imidazolium based ionic liquids thermal spectroscopica comparative study of bosnian and romanian opiniona comparative study of the usa and four latin american countriesa comparative study of glasgow and isfahanthe chitosan as dietary fiber an in vitro comparative study of interactions with drug and nutrian in vitro comparative study of interactions with drug and nutritional substances2 a comparative study of lexical cohesive devices through some english and vietnamese fablesa comparative study of parameter estimation methodsa comparative study of parameter estimation methods for statistical natural language processinga comparative study of social network modelsa case study of coexistence in bossou republic of guineaNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM