a comparative study of social network models
SOCIAL EXCLUSION OF THE ELDERLY A COMPARATIVE STUDY OF EU MEMBER STATES doc
... justifiable to add up the national means for the various aspects of social exclusion (material deprivation, access to social rights and social participation). This results in a mean general index ... material deprivation and a lack of social rights are partly determined by traditional traits of social class, such as education and income. In most countries, within the elderly group age (and ... subgroups. In each of the datasets mentioned above, much attention has been paid to the comparability of data among countries. Nevertheless, an international comparison of survey data is always more...
- 90
- 580
- 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2
... STRUCTURE AND SOME MAJOR LINGUISTIC FEATURES OF THE INTERNATIONAL DECLARATION ON HUMAN RIGHTS3.1 Definition of an International Declaration 103.2 Purposes and typical legal characteristics of the ... Declaration and its realization 133.3.2.2 Remarks 14 a, Use of Grammar 14 a1 . Modality 14 a2 . Use of Active / Passive voices 14 a3 . Sentence order 15 a4 . Length of sentences 15 a5 . Kinds of sentences ... Convention and its realization 234.3.2.2 Remarks 26 a, Use of Grammar 26 a1 . Modality 26 a2 . Use of Active/ Passive voices 27 a3 . Sentence order 27 a4 . Length of sentences 27 a5 . Kinds of sentences...
- 6
- 634
- 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3
... indirectly'; 'to and from'; 'at the time of ratification or at any time thereafter'; 'any Contracting State or any national of a Contracting State'. They are effective ... clause) is a group of words that has a subject and a verb. As it is a part of a sentence but grammatically independent, it could stand alone as a main clause. The writer try to take full advantage ... use and language learning, and is therefore of great importance to language teachers. Traditionally, language teaching has concentrated on pronunciation, grammar, and vocabulary, and while...
- 41
- 839
- 3
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4
... pornographic performances and materials. Article 35States Parties shall take all appropriate national, bilateral and multilateral measures to prevent the abduction of, the sale of or traffic ... from all forms of sexual exploitation and sexual abuse. For these purposes, States Parties shall in particular take all appropriate national, bilateral and multilateral measures to prevent: (a) ... (d) Make educational and vocational information and guidance available and accessible to all children; (e) Take measures to encourage regular attendance at schools and the reduction of drop-out...
- 28
- 611
- 0
A comparative study of criticism between american and vietnamese online newspapers
... Vietnamnet)19 1 Chapter 1: INTRODUCTION1.1 RationaleLanguage and culture are interdependent and interactional. Culture affects the way language is used and language may reflect many factors of ... to view Americans as unemotional and cold. Meanwhile, it is believed that Americans are much more direct than Asians, particularly Vietnamese. As a result, Vietnamese who appreciate and consider ... that this paper will have some contributions to the study of cross-cultural communication between America and Vietnam.1.2 Aims of the study The aims of this paper are: + To study cultural aspects...
- 37
- 756
- 6
A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot
... Mycobacteria.Statistical analysisAs no single gold standard was available forcomparison of the performance of the individualtests, an analysis of results was done using a variety of standards. Efficiency of ... Journal of TuberculosisKAVITA MODI – PAREKH ET ALweeks. Characterization of Mycobacteria was doneat the Corporation laboratory by primary differentialtests for atypical Mycobacteria.Statistical ... 2005Aug; 9(8): 877-83.KAVITA MODI – PAREKH ET ALCHANCHAL SINGH MEMORIAL AWARD - 2006The Tuberculosis Association of India awards every year a cashprize of Rs. 1000/- to a medical graduate...
- 8
- 524
- 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx
... 2007.c2007 Association for Computational Linguistics A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing Jianfeng Gao*, Galen Andrew*, Mark Johnson*&, ... Introduction Parameter estimation is fundamental to many sta-tistical approaches to NLP. Because of the high-dimensional nature of natural language, it is often easy to generate an extremely large ... is a version of Boosting with Lasso (L1) regularization. We first investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model (LM) adaptation task....
- 8
- 504
- 0
Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata pot
... Mechanisms of accumulation of arachidonate in phosphatidylinositolin yellowtail A comparative study of acylation systems of phospholipids in rat and the fishspeciesSeriola quinqueradiataTamotsu ... quinqueradiataTamotsu Tanaka, Dai Iwawaki, Masahiro Sakamoto, Yoshimichi Takai, Jun-ichi Morishige,Kaoru Murakami and Kiyoshi SatouchiDepartment of Applied Biological Science, Fukuyama University, JapanIt ... the large amounts of docosahexaenoic acid in yellowtailLipids from yellowtail have a preponderance of docosa-hexaenoic acid over arachidonic acid. In fact, docosahexa-enoic acid and arachidonic...
- 8
- 619
- 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain. D. Xiong, Q. Liu and ... Ward, and W J. Zhu. 2002. BLEU: a method for automatic evaluation of machine translation. In Proceeding of ACL-2002, pp. 311-318. A. I. Rosti, N. F. Ayan, B. Xiang, S. Matsoukas, R. Schwartz...
- 8
- 546
- 1
Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf
... i.e. a disconnected MDP. This can beavoided by making sure that each action is avail-able at some state and that each state has at leastone available action. We should now define thenecessary ... is a variation of SARSA(λ) that usesthe least squares method to find the optimal pol-icy. Incremental Actor Critic (IAC) (Bhatnagaret al., 2007) and Natural Actor Critic (NAC) (Pe-ters et al., ... years ADShave seen a lot of progress and have attracted theresearch community’s and industry’s interest.There is a number of available ADS, apply-ing state of the art techniques for adaptation...
- 10
- 498
- 0
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx
... 400, 217–223.16 Padmanabhan PK, Mukherjee A & Madhubala R(2006) Characterization of the gene encoding glyoxa-lase II from Leishmania donovani: a potential target foranti-parasite drug. Biochem ... monitored at 340 nm for the formation of NADH.Western blot analyses of trypanosomatid cellextractsPolyclonal antisera against L. major GLO1 were raised inadult male Wistar rats. An initial injection ... methylglyoxal detoxification in the African trypanosome isvia the methylglyoxal reductase pathway to l-lactate.AbbreviationsGLO1, glyoxalase I; GLO2, glyoxalase II; TcGLO1, Trypanosoma cruzi glyoxalase...
- 11
- 639
- 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... TATATCATATGTCTATCTACGACTTCAAGGTCR-TDPX1 ATATAGGATCCTCACGATTGAGTGCTTGGF-TryX ATATATCATATGTCCGGTGTCGCAAAGR-TryX ATATAGGATCCTTACTCGTCTCTCCACGGF-TryP1 ATATATCATATGTCCTGCGGTAACGCCR-TryP1 ATATAGGATCCTTACTGCTTGCTGAAGTATCF-TDPX1 ... GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACCF-TDPX1 Cys83Ala AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAGR-TDPX1 Cys83Ala CTCAGCCTTGAAACGCGTGGCGGCGAAACTTTTCACCTComparison of L. major tryparedoxin peroxidases J. Koănig and A. ... Cys35Ala CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCGR-TDPX1 Cys35Ala CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTGF-TDPX1 Cys64Ala GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTCR-TDPX1 Cys64Ala GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACCF-TDPX1...
- 16
- 483
- 0
Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt
... Corporation2-4 Hikaridai Seika-cho, Soraku-gun Kyoto 619-0237 Japanwuxianchao@gmail.com,sudoh.katsuhito@lab.ntt.co.jp,kevinduh@is.naist.jp,{tsukada.hajime,nagata.masaaki}@lab.ntt.co.jpAbstractThis ... Comparative Study of Target Dependency Structuresfor Statistical Machine TranslationXianchao Wu∗, Katsuhito Sudoh, Kevin Duh†, Hajime Tsukada, Masaaki NagataNTT Communication Science Laboratories, ... Ward, and Wei-Jing Zhu. 2002. Bleu: a method for automatic evalu-ation of machine translation. In Proceedings of ACL,pages 311–318.Adam Pauls and Dan Klein. 2011. Faster and smallern-gram...
- 5
- 410
- 0
party systems in post-soviet countries. a comparative study of political institutionalization in the baltic states, russia and ukraine. 2007
... Sotsial-Demokratychna Partiya Ukrainy (Ob”ednana) (Social Democratic Party of Ukraine - United)UNA Ukrains’ka Natsional’na Asambleya (Ukrainian NationalAssembly)UNSO Ukrains’ka Natsional’na Samooborona ... What follows below is an attempt to present a set of comparable measures which allow conducting a multinational analysis basedon the available data. The author does recognize that a lack of ... Partija (LithuanianDemocratic Labor Party) LKDP Lietuvos Krikscioniu Democratu Partija (LithuanianChristian Democratic Party) LSDP Lietuvos Socialdemokratu Partija (Lithuanian Social Democratic...
- 279
- 751
- 0
- a comparative study of parameter estimation methods
- a comparative study of parameter estimation methods for statistical natural language processing
- the concept of islamic international criminal law a comparative study
- a comparative study on generalization of semantic roles in framenet
- summary a comparative study on invitations in english and vietnamese in terms of crosscultural perspective
- a comparative study of british and vietnamese funeral rituals
- a comparative analysis of different types of models in software development life cycle
- b a thesis a comparative study on making requests in vietnamese and english in terms of politeness
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25