Báo cáo khoa học: " A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells" pot

... protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells. Radiation Oncology 2011 6:15.Submit your next manuscript to BioMed Central and take ... potentialtherapeutic target, DNA double-strand break (DSB) formation and rejoining, apoptosis induction and clonogenic survival was assessed in irradiated mammalian cells upon chemical inhibition of CK2. Methods: ... activity of CK 2 is conferred by intra-molecular interaction of either catalytic isoform CK 2a or CK 2a and may be regulated via the association withadimeroftheregulatoryCK2b subunit (aab2, a a ...

báo cáo khoa học: " A rice calcium-dependent protein kinase is expressed in cortical root cells during the presymbiotic phase of the arbuscular mycorrhizal symbiosis" pps

... epidermal cells are also particularly useful foranalysis of plasma membrane proteins because theenvironmental conditions can be manipulated to causeplasmolysis and par tial separation of th e plasma ... of plantCPKs and CCaMKs. Amino acid sequences from rice (Os), wheat (Ta),maize (Zm) and Medicago (M. truncatula, Mt; M. sativa, Ms) were aligned.Black and gray backgrounds indicate amino acids ... B, Sato S, Asamizu E, Tabata S, Murooka Y, Perry J,Wang TL, Kawaguchi M, Imaizumi-Anraku H, Hayashi M, Parniske M:CYCLOPS, a mediator of symbiotic intracellular accommodation. ProcNatl Acad...

Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx

... CCAATGCGCCTGCCGCAGGACTAGCGGlu168 fi Ala Up: CAGCACTCGTCGCGGTCCATACCGAGDown: CTCGGTATGGACCGCGACGAGTGCTGVal169 fi Ala Up: CACTCGTCGAGGCCCATACCGAGCAGDown: CTGCTCGGTATGGGCCTCGACGAGTGHis170 fi Ala ... CGTCGAGGTCGCTACCGAGCAGGAAGDown: CTTCCTGCTCGGTAGCGACCTCGACGAsn189 fi Ala Up: GGTGATTGGCGTTGCCGCCCGCGACCDown: GGTCGCGGGCGGCAACGCCAATCACCArg191 fi Ala Up: GCGTTAACGCCCGGCACCTCATGACGDown: CGTCATGAGGTGCCGGGCGTTAACGCAsp192 ... CGTCATGAGGTGCCGGGCGTTAACGCAsp192 fi Ala Up: CGTTAACGCCCGCGCCCTCATGACGCDown: GCGTCATGAGGGCGCGGGCGTTAACGLeu193 fi Ala Up: CGCCCGCGACGCCATGACGCTGGACGDown: CGTCCAGCGTCATGGCGTCGCGGGCGLeu196 fi Ala Up: GACCTCATGACGGCGGACGTGGACCGDown:...

Báo cáo khoa học: A novel retinol-binding protein in the retina of the swallowtail butterﬂy, Papilio xuthus docx

... from dark-adapted or light-adapted retinas, and analyzed byHPLC. The molar ratio of all-trans,11-cis and 13-cis 3-hydroxyretinolwas then calculated based on the absorbance and the molar extinctioncoefficient ... of the light- and dark-adapted retinas, and analyzed by HPLC.The molar ratio of all-trans,11-cis and 13-cis 3-hydroxyretinol wasthen calculated based on the absorbance and the molar extinctioncoefficient ... the distal and proximal portions of the retina. Papilio RBP wasextracted from each portion of the dark-adapted or light-adapted retina, and purified by native PAGE. The ligandwas then analyzed...

Báo cáo khoa học: A thermoacidophilic endoglucanase (CelB) fromAlicyclobacillus acidocaldariusdisplays high sequence similarity to arabinofuranosidases belonging to family 51 of glycoside hydrolases ppt

... Bactero-ides ovatus: AAA50391, arabinosidase 1; AAA50393, arabinosidase 2;Biﬁdobacterium longum NCC2705: AAN24035, BL0181; AAN24368,AbfA1; AAN24945, BL1138; AAN24971, AbfA2; AAN25400, AbfA3;Caulobacter ... sterco-rarium: AAC28125, arabinofuranosidase; Cytophaga xylanolytica:AAC38456, arabinofuranosidase I; AAC38457, arabinofuranosidaseII; F. succinogenes S85: AAC45377, EGF; G. stearothermophilusT-6: AAD45520, ... Atu3104; Arabidopsis thaliana:AAD40132, ORF At5g26120/T1N24.13; AAF19575, ORFAt3g10740/T7M13–18; Aspergillus niger: AAC41644, arabinofurano-sidase A; A. niger var. awamorii: IFO4033,BAB21568, ArfA;...

Báo cáo khoa học: A chloroplast RNA binding protein from stromal thylakoid membranes speciﬁcally binds to the 5¢ untranslated region of the psbA mRNA potx

... relative to the AUG): T7-psbB5¢(5¢-GTAATACGACTCACTATAGGGTAAATTAATTTAATTTAAAATC-3¢)andpsbB3¢ (5¢-TACACGATACCAAGGTAAACC-3¢). Each template contained the pro-motor of the T7 RNA polymerase fused to ... theAUG); T7–36ntA5¢ (5¢-GTAATACGACTCACTATAGGGTTTACGGAGAAATTAAAAC-3¢) and 2054; M1-RNA (sequence of the psbA mRNA corresponding topositions )36 to +13 relative to the AUG with an exchangeat positions ... (5¢-GTAATACGACTCACTATAGGGTACCATGCTTTTAATAGAAG-3¢ )and 2054 (5¢-GATCCATGGTCATATGTTAATTTTTTTAAAG-3¢); )36-RNA (wild-type sequence of the psbA mRNAcorresponding to positions )36 to +13 relative to theAUG);...

Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx

... 2 and 7, Raphanus sativus; lanes 3 and 8, Brassica rapa;lanes 4 and 9, B. rapa var. glabra; lanes 5 and 10, B. oleracea var. italica. The amount of protein applied was 4 lg for A. thaliana and ... a pair of primers (forward,5¢-CACCACCACCACCAGATGGGTTACTGGAATTCCAAG-3¢; reverse, 5¢-GTGGTGTTTCATATGTATATCTCCTTCTTAAAGTTAAAC-3¢; italic type shows the His-tagadaptor sites). After conﬁrmation ... Brassica rapa L. var. glabra Regel (Chi-nese cabbage) and Brassica oleracea var. italica (broccoli)]were purchased from a market.Subcellular fractionationTwo-week-old A. thaliana plants were...

Tài liệu Báo cáo khoa học: "A Composite Kernel to Extract Relations between Entities with both Flat and Structured Features" ppt

... Natural Language Data. ACL-2003 Zelenko D., Aone C. and Richardella A. 2003. Kernel Methods for Relation Extraction. Journal of Ma-chine Learning Research. 2003(2):1083-1106 Zhao S.B. and ... viewpoint and integrated various tasks such as POS tagging, NE tagging, syntactic parsing, template extraction and relation extraction using a generative model. Feature-based methods (Kambhatla, ... the same subset of the 2004 data, but the 5 parti-tions may not be the same) for the ACE 2004 data. Both corpora are parsed using Charniak’s parser (Charniak, 2001). We iterate over all pairs...

Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low afﬁnity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

... regions of genes encoding Wntxs. The ﬁrst pairwas X289 (5¢ TgTgCTACTTgCC CTggAA 3¢)andX191.The second pair was X133 (5¢ TCC AgAAAAgATCgCAAgATg 3¢) [35] and X300 (5¢ AgAgC CAAgCTTTTACTATCggTT ... Electrical signals afterampliﬁcation were collected and digitized, at a sampling rate of 25 kHz, with the aid of a computer equipped with ananalogue-to-digital interface board (DT2821, Data Trans-lation, ... are clearly more similar to thosefrom cobras than to those found in kraits, mamba and coralsnake venom [4–19].Comparative analysis of Wntx sequencesFigure 2A shows a comparison of amino acid...

Báo cáo khoa học: "A Corpus for Modeling Morpho-Syntactic Agreement in Arabic: Gender, Number and Rationality" docx

... 55(3):189–213.Mohamed Altantawy, Nizar Habash, Owen Rambow, and Ibrahim Saleh. 2010. Morphological Analysis and Generation of Arabic Nouns: A Morphemic Func-tional Approach. In Proceedings of the seventh ... thank Mona Diab, Owen Rambow,Yuval Marton, Tim Buckwalter, Otakar Smrž, ReemFaraj, and May Ahmar for helpful discussions and feedback. We also would like to especially thankAhmed El Kholy and ... In-ternational Conference on Language Resources and Evaluation (LREC), Valletta, Malta.Mohammed Attia. 2008. Handling Arabic Morpholog-ical and Syntactic Ambiguity within the LFG Frame-work...

Xem thêm