Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx

11 382 0
  • Loading ...
    Loading ...
    Loading ...

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 07/03/2014, 03:20

A novel inhibitor of indole-3-glycerol phosphate synthasewith activity against multidrug-resistantMycobacterium tuberculosisHongbo Shen1,*, Feifei Wang1,*, Ying Zhang2, Qiang Huang1, Shengfeng Xu1, Hairong Hu1,Jun Yue3and Honghai Wang11 State Key Laboratory of Genetic Engineering, School of Life Sciences, Fudan University, Shanghai, China2 Department of Molecular Microbiology and Immunology, Bloomberg School of Public Health, Johns Hopkins University,Baltimore, MD, USA3 Department of Clinical Laboratory, Shanghai Pulmonary Hospital, ChinaTuberculosis (TB) is the leading cause of infectiousmorbidity and mortality worldwide, with nine millionnew cases and two million deaths per year (http://www.tballiance.org). Approximately two billion peopleare latently infected with Mycobacterium tuberculosis,comprising a critical reservoir for disease reactivationKeywordsdrug resistance; indole-3-glycerol phosphatesynthase; inhibitor; MycobacteriumtuberculosisCorrespondenceH. Wang, State Key Laboratory of GeneticEngineering, School of Life Sciences, FudanUniversity, Shanghai 200433, ChinaFax: +86 21 65648376Tel: +86 21 65643777E-mail: hhwang@fudan.edu.cnJ. Yue, Department of Clinical Laboratory,Shanghai Pulmonary Hospital, Shanghai200433, ChinaFax: +86 21 65648376Tel: +86 21 65643777E-mail: yuejunnan@yahoo.com.cn*These authors contributed equally to thiswork(Received 19 June 2008, revised 19 October2008, accepted 28 October 2008)doi:10.1111/j.1742-4658.2008.06763.xTuberculosis (TB) continues to be a major cause of morbidity and mortal-ity worldwide. The increasing emergence and spread of drug-resistant TBposes a significant threat to disease control and calls for the urgent devel-opment of new drugs. The tryptophan biosynthetic pathway plays animportant role in the survival of Mycobacterium tuberculosis. Thus, indole-3-glycerol phosphate synthase (IGPS), as an essential enzyme in this path-way, might be a potential target for anti-TB drug design. In this study, wededuced the structure of IGPS of M. tuberculosis H37Rv by using homol-ogy modeling. On the basis of this deduced IGPS structure, screening wasperformed in a search for novel inhibitors, using the Maybridge databasecontaining the structures of 60 000 compounds. ATB107 was identified asa potential binding molecule; it was tested, and shown to have antimyco-bacterial activity in vitro not only against the laboratory strain M. tubercu-losis H37Rv, but also against clinical isolates of multidrug-resistant TBstrains. Most MDR-TB strains tested were susceptible to 1 lg ÆmL)1ATB107. ATB107 had little toxicity against THP-1 macrophage cells,which are human monocytic leukemia cells. ATB107, which bound tightlyto IGPS in vitro, was found to be a potent competitive inhibitor of the sub-strate 1-(o-carboxyphenylamino)-1-deoxyribulose-5¢-phosphate, as shownby an increased Kmvalue in the presence of ATB107. The results of site-directed mutagenesis studies indicate that ATB107 might inhibit IGPSactivity by reducing the binding affinity for substrate of residues Glu168and Asn189. These results suggest that ATB107 is a novel potent inhibitorof IGPS, and that IGPS might be a potential target for the developmentof new anti-TB drugs. Further evaluation of ATB107 in animal studies iswarranted.AbbreviationsCdRP, 1-(o-carboxyphenylamino)-1-deoxyribulose-5¢-phosphate; CFU, colony-forming unit; DOPE, discrete optimized potential energy; IGPS,indole-3-glycerol phosphate synthase; MDR-TB, multidrug-resistant tuberculosis; MIC, minimum inhibitory concentration; mIGPS, indole-3-glycerol phosphate synthase of Mycobacterium tuberculosis ; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide; SPR, surfaceplasmon resonance; TB, tuberculosis.144 FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS[1]. The alarming increase in drug-resistant TB, espe-cially multidrug-resistant TB (MDR-TB, resistant to atleast isoniazid and rifampin), poses a significant threatto effective TB control [2]. Therefore, there is anurgent need to develop novel drugs for the treatmentof TB, especially MDR-TB (http://www.who.int/gtb).It was reported that auxotrophs of M. tuberculosisthat are knocked out in the leucine, proline and tryp-tophan biosynthetic pathways show attenuation intheir ability to infect mice [3,4]. This indicates thatthese amino acids might be unavailable for uptake bythe bacterium in vivo [5]. The attenuation of virulenceis especially marked in the tryptophan auxotrophictrpD knockout strain, which is essentially avirulent,even in immunodeficient mice [4]. This suggests thatthe tryptophan biosynthetic pathway might playan important role in the survival of M. tuberculosisin vitro and in vivo. Additionally, tryptophan is notsynthesized by mammals, making enzymes from thisbiosynthetic pathway viable targets for new anti-TBdrugs [5]. Indole-3-glycerol phosphate synthase (IGPS)catalyzes the fourth step in this biosynthetic pathway,the indole ring-closure reaction, in which the substrate1-(o-carboxyphenylamino)-1-deoxyribulose-5¢-phospha-te (CdRP) is converted to the product indole 3-glycerolphosphate (IGP) [6]. The trpC gene, encoding IGPS,was demonstrated to be essential for the growth ofM. tuberculosis in vitro by inactivation by transposonmutagenesis [7]. In addition, there is no homolog ofIGPS in humans [8]. Thus, IGPS of M. tuberculosis(mIGPS) could be a good drug target for the design ofnew anti-TB agents.Virtual high-throughput in silico screening is animportant tool in drug discovery [9]. It aims toidentify chemical ligands that bind strongly to keyregions of important enzymes. Consequently, identi-fied ligands may provide excellent inhibition ofenzyme activities. Several drugs discovered using thisapproach have been tested clinically [10–12]. In thisstudy, we have identified a high-affinity inhibitor,ATB107, of mIGPS, using the virtual screeningapproach. The inhibitor was found to be a competi-tive inhibitor of mIGPS, as it reduced the bindingaffinity for substrate to residues required for enzymeactivity and effectively inhibited the growth of notonly the virulent M. tuberculosis H37Rv labora-tory strain but also of drug-resistant clinical isolatesin vitro. The inhibitory effect of ATB107 could not bereversed by the addition of tryptophan, as it mightaffect not only the biosynthesis of tryptophan but alsoother essential pathways.Results and DiscussionHomology modeling of mIGPS structureIGPS is a key enzyme in the tryptophan biosyntheticpathway, which is widely present in bacteria [13].There has been significant interest in its structure [14].More than 20 crystal structures of bacterial IGPS havebeen determined (http://www.rcsb.org) [15]. Six possi-ble templates (Protein Data Bank codes: 1A53, 1H5Y,1I4N, 1JCM, 1PII and 1VC4) for homology modelingwere identified through a homology search. The struc-ture of 1VC4 was selected as the template, because ofthe highest sequence identity of 45.6%. Furthermore,sequence alignment analysis (Fig. 1) revealed a highersequence similarity of 55.43% between the 1VC4 andmIGPS sequences. Using homology modeling, fivemodels, M1, M2, M3, M4 and M5, for mIGPS wereobtained, and their modeller objective function [16]values were 1633.37, 1745.01, 1681.45, 1650.79 and1611.09, respectively. The last value is the lowest one,which means that M5 is the ‘best’ model. Furthermore,the discrete optimized potential energy (DOPE) score[17] profile of M5 (Fig. 2A) is very similar to that ofthe template (Fig. 2B), which also indicates that M5 isa reasonable model. Figure 2C shows that the mIGPSstructure (M5) has one typical (b ⁄ a)8-barrel structure,which is the most common enzyme fold in nature [18].Fig. 1. Amino acid sequence alignment ofIGPS from M. tuberculosis H37Rv and thatfrom Thermus thermophilus reveals highsequence similarity (55.43%). The second-ary structures of T. thermophilus IGPS areshown under the sequences. The a-helicesare shown as red helices, and the b-sheetsas blue arrows. The sequence alignmentwas performed usingBIOEDIT software [39].H. Shen et al. Inhibitor of indole-3-glycerol phosphate synthaseFEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS 145Virtual selection of mIGPS inhibitorsTo obtain a more reasonable structure, we performednanosecond timescale molecular dynamics simulationsfor the structure of M5. The plots of potential energyfluctuation (Fig. 3A) and protein backbone rmsd(Fig. 3B) from simulations show that the structure wasequilibrated after 1 ns of simulation. Thus, we selectedthe last 9 ns simulation results to obtain an averagestructure using the g_rmsf program of gromacs.The equilibrated structure of mIGPS was used in thevirtual selection of inhibitors, using the autodockapproach. The docking dummy center was arranged inthe middle of the barrel composed of C-termini ofb-sheets. The radius of the docking region was 22.5 A˚,and it was beyond the width of the cavity in mIGPS,which was about 15–18 A˚. This ensured that theligands could reach the mIGPS catalytic cavity duringthe docking process. Figure 4A shows that the ligandswith low docking energy values mostly bound in theregion surrounded by the ba-loops. One hundredligands with the lowest docking energy values wereselected from the 60 000 ligands, and 50 of them werepurchased and used in further evaluation of theirantimycobacterial activities.Antimycobacterial activities of the selectedligands in vitroWe first evaluated the antibacterial activity of 50ligands against M. tuberculosis H37Ra, which is aABCFig. 2. Structure of IGPS. The DOPE score profile of M5 (A) ishighly similar to that of the template (B), which confirms that M5 isa reasonable model. The structure (C) of IGPS from M. tuberculosisH37Rv (M5) has one typical (b ⁄ a)8-barrel structure.Fig. 3. Plots of the potential energy fluctuation (A) and proteinbackbone rmsd (B) in mIGPS molecular dynamics simulations. Theresults showed that the structure was equilibrated after 1 ns ofsimulation. Thus, the last 9 ns simulation results were selected toobtain an average structure of mIGPS using theG_RMSF program ofGROMACS.Inhibitor of indole-3-glycerol phosphate synthase H. Shen et al.146 FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBShighly attenuated M. tuberculosis strain [19]. The mini-mum inhibitory concentration (MIC) of ATB107(Fig. 4B) is 0.1 lgÆmL)1for M. tuberculosis H37Raand also vaccine strain BCG (Table 1). ATB107 is anitrogen heterocyclic ligand fused with polycyclic rings.Its molecular formula is C21H28N8, its chemical nameis 1-azabicyclo[2.2.2]octan-3-one[4-(phenylamino)-6-(1-piperidinyl)-1,3,5-triazin-2-yl]hydrazone, and its molec-ular mass is 392.5 Da. There are four hydrogen bonddonors, eight acceptors, and six rotatable bonds, andits xlogP (partition coefficient in octanol ⁄ water) is 4.46(http://www.maybridge.com). This suggests that theligand obeys Lipinski’s ‘rule of five’ [20].ATB107 also had high activity against M. tuberculosisH37Rv, with an MIC of 0.1 lgÆmL)1(Table 1). Usingthe BACTEC culture system, we observed inhibition ofbacterial growth when clinical isolates of M. tuberculo-sis were exposed to two concentrations of ATB107. All50 fully susceptible clinical isolates tested were suscep-tible to ATB107 at 1 lgÆmL)1; of these, 41(82%) weresusceptible to ATB107 at 0.1 lgÆmL)1(Table 2). Usingthe same approach, we evaluated the activity ofATB107 against 80 clinical MDR-TB isolates. Theresults showed that 67 (83.8%) MDR-TB isolates weresusceptible to ATB107 at 1 lgÆmL)1, and 25 (31.3%)isolates were susceptible to ATB107 at 0.1 lgÆmL)1(Table 2).Interaction of ATB107 with mIGPSWe performed a surface plasmon resonance (SPR)analysis to identify the interaction of ATB107 withmIGPS. Kinetic analysis of the binding interactionbetween ATB107 and mIGPS (Fig. 5) showed that thebinding ability of ATB107 was well correlated with itsconcentrations. The equilibrium dissociation contantFig. 4. Ligands with low docking energy values binding to theregion surrounded by the ba-loops of mIGPS (A). The deep yellowball is the dummy center of the docking region. The colored mole-cules are the ligands. The most effective ligand, ATB107 (B), is anitrogen heterocyclic ligand fused with polycyclic rings.Table 1. MICs of ATB107 for different M. tuberculosis strains.Bacteria (105CFUÆmL)1) were inoculated in Middlebrook 7H9 brothwith OADC. ATB107 was added to obtain concentrations rangingfrom 0.01 to 200 lgÆmL)1. After 3 weeks of incubation, the cul-tures were diluted and plated on agar plates for CFU determination.The MIC was defined as the lowest concentration that inhibited99% of growth. The tests were repeated three times for eachstrain.Mycobacterial species No. strains MIC (lgÆmL)1)M. tuberculosis H37Ra 1 0.10M. tuberculosis H37Rv 1 0.10M. bovis BCG 1 0.10Table 2. Susceptibility of M. tuberculosis clinical isolates toATB107 measured by the BACTEC radiometric system. The testswere repeated twice for each strain.M. tuberculosisstrainsTotalnumberof strainsNo. (%)strainsinhibited by1.0 lgÆmL)1No. (%)strainsinhibited by0.1 lgÆmL)1M. tuberculosis,fully susceptible clinicalisolates50 50 (100) 41 (82)MDR-TB strains(resistant to at leastisoniazid and rifampin)80 67 (83.8) 25 (31.3)H. Shen et al. Inhibitor of indole-3-glycerol phosphate synthaseFEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS 147(kD) was 3 · 10)3m. These results indicate thatATB107 can bind tightly to mIGPS in vitro.To elucidate the effect of ATB107 binding onenzyme activity, we tested the catalytic activity ofmIGPS in the presence of this ligand. A plot of theligand concentrations against mIGPS activity (Fig. 6A)showed that the activity decreased significantly withincrease in ligand concentration. The 50% inhibitoryconcentration was about 0.41 lm. The results indicatethat binding of ATB107 reduces the catalytic activityof mIGPS, and that ATB107 is a high-affinity inhi-bitor of mIGPS.Mechanism of inhibition by ATB107To identify whether ATB107 is a competitive or non-competitive inhibitor, we tested the effect of inhibitoron the Michaelis constant Kmof the substrate CdRP.Inhibitors were added to the reaction solutions toachieve concentrations of 0.2 and 2 lm, respectively. Aplot of reciprocal velocity versus reciprocal substrateconcentration (Fig. 6B) showed that the inhibitorincreased the Km, and that the Kmincrease was corre-lated with higher concentrations of inhibitors. It isconcluded that ATB107 might be a competitive inhibi-tor of mIGPS.In order to ascertain the mechanism by whichATB107 inhibits the catalytic activity of mIGPS, wemutated the residues close to the ATB107-binding sitesin mIGPS (Fig. 7A) and tested the enzyme activities ofthese mutants. There are 11 residues surroundingATB107 within a distance of 5 A˚. Ten of them weremutated to alanine, with a methyl group side chain,except for Ala190. The enzyme activities of mutantswere assayed under the same conditions. The results(Table 3) demonstrate that mutations of Glu168 andAsn189 greatly affected the activities of the enzymesand increased the Kmvalues 19-fold and 18-fold,respectively. These results suggest that the above resi-dues might play an important role in the catalytic pro-cess of mIGPS and may be related to the inhibitionmechanism of ATB107.To investigate the role of these residues in the inhib-itory effect of ATB107, we compared the binding sitesof CdRP and of ATB107. The substrate-binding siteswere also calculated using autodock software. Theresults showed that eight of the 11 residues surround-ing ATB107 (yellow) within 5 A˚in mIGPS (Fig. 7A)are the same as eight of the 14 residues surroundingthe substrate (red) within 5 A˚(Fig. 7B). This suggeststhat CdRP might bind to a similar region as the inhib-itor. Structure superposition results (Fig. 7C) con-firmed this conclusion. Therefore, these results suggestthat the inhibitor competes with substrate in binding15010050Resp. diff. (RU)0–50–10050 60 70 80 90 100 110 120 130abcdef140 150 160Time (s)Fig. 5. Kinetic analysis of ATB107 binding to mIGPS by SPR tech-nology using BIAcore 3000. The results show that the binding abil-ity of ATB107 is well correlated with its concentrations, whichmeans that ATB107 binds well to mIGPS in vitro. Representativesensorgrams obtained from injection of ATB107 at concentrationsof: (A) 0.50 · 10)5M; (B) 0.25 · 10)5M; (C) 0.13 · 10)5M; (D)0.31 · 10)6M; (E) 0.78 · 10)7M; (F) 0.39 · 10)7M.Fig. 6. Effect of ATB107 binding on mIGPS activity. ATB107 inhib-ited mIGPS enzyme activity (A), and the catalytic activity of mIGPSdecreased significantly with the increase in ATB107 concentrations.The results of reciprocal velocity plotted versus reciprocal substrateconcentration (r, no inhibitor;, 0.2 lM inhibitor; , 2.0 lM inhibi-tor) (B) demonstrated that ATB107 increased the Kmvalue of sub-strate, and that the increase in Kmvalue correlated with largeramounts of inhibitor.Inhibitor of indole-3-glycerol phosphate synthase H. Shen et al.148 FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBSto mIGPS, which is consistent with the conclusion thatATB107 is a competitive inhibitor of the enzyme.Among the residues surrounding CdRP within 5 A˚inmIGPS (Fig. 7B), there are four hydrogen bondsbetween the substrate and these residues, including twobonds formed with the atoms in the backbone andanother two bonds formed with side chains of Glu168and Asn189. Interestingly, they are the residues thathave been shown to play an important role in the cata-lytic process of mIGPS by site-directed mutagenesis.Thus, we conclude that ATB107 is a substrate compet-itive inhibitor, and that it inhibits mIGPS catalyticactivity through reducing the binding affinity forsubstrate of Glu168 and Asn189.Evaluation of the cytotoxicity of ATB107To determine the cytotoxicity of ATB107, we exam-ined its effect on the proliferation of THP-1 macro-phage cells. The important first-line TB drugs isoniazidand ethambutol were included as controls in the exper-iments. The results (Fig. 8) showed that at the highestconcentration of 200 lgÆmL)1, the drugs and ATB107could inhibit cell proliferation, with cell survival ofabout 60%. With the lower concentration of50 lgÆmL)1, cell survival was more than 80% forATB107 and both isoniazid and ethambutol. Theseresults indicate there is no obvious difference in cyto-toxicity between ATB107 and isoniazid and ethambu-tol. Thus, ATB107 did not have obvious cytotoxicity.Effect of tryptophan on inhibition of activity ofATB107 against M. tuberculosis strainsTo identify whether the inhibitory effect of ATB107could be reversed by the addition of tryptophan, weevaluated the inhibitory effect of ATB107 againstM. tuberculosis H37Ra strains in the presence of trypto-phan. The results (Fig. 9) showed that tryptophaninhibited the growth of M. tuberculosis H37Ra at highconcentrations, even without ATB107. The numbersof bacteria decreased significantly with increases in tryp-tophan concentrations, and there were few bacteria inFig. 7. Comparison between the binding region of ATB107 and thatof CdRP in the mIGPS structure. (A) Residues surrounding ATB107(yellow) within 5 A˚in mIGPS. (B) Residues surrounding substrate(yellow) within 5 A˚in mIGPS. Dashed lines (green) represent thehydrogen bonds. The comparison result revealed that eight (num-bering in red) of the 11 residues surrounding ATB107 within 5 A˚inmIGPS (A) were also included in the 14 residues surrounding sub-strate within 5 A˚(B). (C) Binding regions of substrate (red) andATB107 (yellow) in mIGPS.H. Shen et al. Inhibitor of indole-3-glycerol phosphate synthaseFEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS 149the medium when the tryptophan concentration wasmore than 5%. The results also showed that there wasno obvious difference among the inhibitory effects ofATB107 against M. tuberculosis H37Ra in media withdifferent concentrations of tryptophan. These resultssuggest that IGPS’s role in M. tuberculosis might not beconfined to tryptophan synthesis, or that ATB107 mightaffect not only the biosynthesis of tryptophan but alsoother essential pathways. Further studies are needed todetermine the mechanism of action of ATB107.ConclusionIn conclusion, through the combination of computa-tional prescreening and biological studies, we identifiedATB107 as a high-affinity inhibitor of mIGPS.ATB107 was found to be highly active againstM. tuberculosis, including MDR-TB clinical isolateswith MICs of 0.1–1 lgÆmL)1. mIGPS represents anovel drug target that is different from those of exist-ing TB drugs. Enzymology and site-directed mutagene-sis studies have identified Glu168 and Asn189 as keyresidues affecting enzyme activity. Further evaluationof ATB107 in vivo in animal models in terms of toxic-ity, pharmacology and activity against M. tuberculosisis warranted.Experimental proceduresHomology modelingThe 3D structure of mIGPS was generated by homologymodeling using modeller 8.0 software [21]. The mIGPSamino acid sequence (GI:15608749) was put into the PIRformat that is readable by modeller. Subsequently, asearch for potentially related sequences of known structureswas performed by the profile.build() command of model-ler, using default parameters. We assessed the structuraland sequence similarities between the possible templates toselect the most appropriate template for the query sequenceover other similar structures. We finally picked the A-chainof 1VC4 as a template, because of its better crystallogophicresolution (1.8 A˚) and higher overall sequence identity tothe query sequence (45.6%). Then, the query sequence wasaligned with the template, and the model was constructedand evaluated.Table 3. Kmvalues of wild-type and mutant enzymes for the substrate CdRP. ND, not determined.Protein type Km(mM)Km(mutant) ⁄ Km(wild-type) Protein type Km(mM)Km(mutant) ⁄ Km(wild-type)Wild type 1.13 Asn189 fi Ala 20.34 18.00Pro63 fi Ala 2.49 2.20 Ala190 fi Ala ND NDSer64 fi Ala 1.53 1.40 Arg191 fi Ala 6.63 5.87Glu168 fi Ala 21.67 19.17 Asn192 fi Ala 2.57 2.28Val169 fi Ala 1.53 1.40 Leu193 fi Ala 1.42 1.25His170 fi Ala 1.19 1.10 Leu196 fi Ala 1.81 1.61Fig. 8. Effect of ATB107 on the growth of THP-1 macrophages.The effect was detected with the MTT method. The results sug-gest that ATB107 is not very toxic and has a similar toxicity patternto the first-line TB drugs. The tests were repeated five times. INH,isoniazid; ETH, ethambutol.Fig. 9. Effect of tryptophan on the growth of M. tuberculosisstrains in culture media with ATB107. Bacteria (105CFUÆmL)1)were inoculated in Middlebrook 7H9 broth with OADC. ATB107 atthree concentrations (0 · MIC, 1 · MIC and 0.1 · MIC; MIC is0.1 lgÆmL)1) was added to the culture media with tryptophan at sixconcentrations. After 3 weeks of incubation, the cultures werediluted and plated on agar plates for CFU determination. The resultsshow that tryptophan at high concentrations had definite inhibitoryactivity against M. tuberculosis but did not antagonize the activityof ATB107. The tests were repeated three times.Inhibitor of indole-3-glycerol phosphate synthase H. Shen et al.150 FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBSMolecular dynamics simulationsNanosecond timescale molecular dynamics simulation withexplicit solvent representation was performed with thegromacs suite of programs (Version 3.3) [22,23], using theall-hydrogen force fields OPLS-AA [24]. A simulation sys-tem was built for mIGPS. The mIGPS was solvated withTIP4P [25] water molecules in a rectangular box, with thethickness of the water layer between the protein and theclosest box boundary being 1.5 nm. Counterpart ions wereplaced into the box to make the system neutral. The simu-lation was performed using an ensemble of constant num-ber of molecules, pressure, and temperature (N–P–Tensemble), with the pressure P = 1 bar and the tempera-ture T = 300 K. The Berendsen temperature couplingmethod [26] was used, with a constant coupling of 0.1 ps.The cutoff distance for van der Waals forces was 1.0 nm.Electrostatic forces were treated with the particle meshEwald method [27]. The lincs algorithm [28] was used toconstrain the bonds containing hydrogen. The simulationwas run under periodical boundary conditions, using a timestep of 2 fs. The period for each simulation run was 10 ns.The simulation was completed on the Lenovo Shenteng1800computer with 32 Intel 2.8 GHz Xeon CPUs in the StateKey Laboratory of Genetic Engineering, Fudan University.Molecular graphics were created using the programs pymol(http://pymol.sourceforge.net) and vmd [29].Docking studiesProtein–ligand docking simulations were carried out usingthe software autodock 3.0.5 [30], which combines a rapidenergy evaluation through precalculated grids of affinitypotentials with a variety of search algorithms to find suitablebinding positions for a ligand on a given macromolecule. The3D structure of mIGPS was built by homology modeling.Polar hydrogens were added to the macromolecule, and par-tial charges were assigned to the macromolecule using auto-docktools [31]. The ligands from the Maybridge databasewere transformed using a modified autodocktools program(written by Q. Huang) to 3D structures, adding partialatomic charges for each atom, and defining the rigid root androtatable bonds for each ligand automatically. The 3D struc-ture and parameters of CdRP were generated by the programprodrg (http://davapcl.bioch.dundee.ac.uk/programs/prod-rg) [32]. Mass-centered grid maps were generated with thedefault 0.375 A˚spacing by the autogrid program for thewhole protein target. The sigmoidal distance-dependentdielectric permittivity of Mehler and Solmajer [33] was usedfor the calculation of the electrostatic grid maps. TheLamarckian genetic algorithm [31] and the pseudo-Solis andWets methods were applied for minimization, using defaultparameters. Random starting positions on the entire proteinsurface, random orientations and torsions (flexible ligandsonly) were used for the ligands.Mycobacterial strains and culture conditionsM. tuberculosis H37Rv, M. tuberculosis H37Ra and clinicalisolates of M. tuberculosis were provided by Shanghai Pul-monary Hospital of China. M. tuberculosis and Mycobacte-rium bovis BCG strains were grown in Middlebrook 7H9broth and on Middlebrook 7H10 agar supplemented with10% oleic acid ⁄ albumin ⁄ dextrose ⁄ catalase-enriched Middle-brook (OADC). The other plasmids and strains used in thisstudy were purchased from Novagen (Madison, WI, USA).Effect of ligands on inhibition of bacterial growthin vitroStock solutions of 5 mgÆmL)1for each ligand were pre-pared in sterile dimethylsulfoxide. Appropriate dilutions foreach ligand were added to 1 mL cultures to obtain concen-trations ranging from 0.01 to 200 lgÆmL)1. The bacteriawere inoculated at about 105colony-forming units(CFUs) ⁄ mL. After incubation at 37 °C for 3 weeks, the cul-tures were diluted and plated on agar plates for CFU deter-mination. The MIC was defined as the lowest concentrationinhibiting 99% of growth.The radiometric BACTEC 460 method [34] (BectonDickinson, Sparks, MD, USA) was used to determine sus-ceptibility to 0.1 lgÆmL)1and 1.0 lgÆmL)1ATB107 for 50clinical isolates of drug-sensitive and 80 clinical isolates ofMDR-TB (resistant to at least isoniazid and rifampin)M. tuberculosis, with M. tuberculosis H37Rv as a control.Effect of ATB107 on mIGPS activity in vitroThe concentration of mIGPS was determined with theBradford method, using the kit from Bio-Rad (Hercules,CA, USA) [35]. The substrate CdRP was chemically synthe-sized, with a yield of 30 mm [36]. Ten microliters of 30 mmCdRP and 10 l L of 1.24 lm IGPS were added to 480 lLof 5 mm Tris ⁄ HCl (pH 7.0), and incubated at 37 °C for20 min. The enzyme activity was measured with a spectro-photometer by following the increase in absorbance of thesolution at 280 nm [37,38]. ATB107 was added to the assaymixture to obtain concentrations of 10)4m, 7.5 · 10)5m,5 · 10)5m, 2.5 · 10)5m, and 10)5m, respectively. The50% inhibitory concentration (IC50) of ATB107 was calcu-lated from the equation fitted by the curve of enzyme activ-ity versus ATB107 concentration.SPR analysisThe interaction of mIGPS and ATB107 was investigatedthrough SPR analysis, using a BIAcore 3000 instrumentwith software version 4.0 and Sensor Chip CM5 (carbo-xymethylated dextran surface). mIGPS was directly immo-bilized to the preactivated chip surface via amine groups.H. Shen et al. Inhibitor of indole-3-glycerol phosphate synthaseFEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS 151The concentrations of ATB107 were 0.50 · 10)5m,0.25 · 10)5m, 0.13 · 10)5m, 0.31 · 10)6m, 0.78 · 10)7m,and 0.39 · 10)7m. All assays were carried out at 25 °C.Site-directed mutagenesisResidues surrounding ATB107 within 5 A˚distance inmIGPS were mutated. Site-directed mutagenesis was carriedout according to the protocol described in the QuikChangeSite-Directed Mutagenesis Kit (Catalog #200518; Strata-gene, Cedar Creek, TX, USA). The primers for site-directedmutagenesis are listed in Table 4. The wild-type trpC gene-encoding plasmid was constructed as previously described[8]. This plasmid was used as the template in the construc-tion of the mutant IGPS plasmids. The plasmids were puri-fied and transformed into Escherichia coli strain BL21(DE3) for expression of IGPS proteins. The conditions forprotein purification and enzyme assay were as describedpreviously [8].Cell proliferation assayThe tetrazolium dye reduction assay [3-[4,5-dim-ethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide (MTT);Sigma-Aldrich, USA] was used to determine the effect ofATB107 on cell survival and growth. At first, the THP-1macrophage cells were inoculated at 8 · 104cellsÆmL)1into 96-well plates and incubated at 37 °Cina5%CO2⁄ 95% air atmosphere for 24 h. ATB107, isoniazid andethambutol were each added to give concentrations of 50,100, 150 and 200 lgÆmL)1. After incubation of cells trea-ted with compounds for 12 h, 20 lL(5gÆL)1) of MTTsolution was added to each well; this was followed byincubation for another 4 h to allow the formation of for-mazan crystals. Finally, 10% SDS was added to dissolvethe formazan crystals, and the plates were read on a Dy-natech MR600microplate reader at 570 nm. Controls wereincluded in which only culture media were added to wellscontaining cells.Effect of tryptophan on activity of ATB107M. tuberculosis H37Ra was cultured in Middlebrook 7H9broth with 10% OADC containing ATB107 at three concen-trations (0 · MIC, 1 · MIC and 0.1 · MIC; MIC is0.1 lgÆ mL)1). Tryptophan was added to the media to giveconcentrations of 10%, 5%, 2.5%, 1%, and 0.5%. Afterincubation for 3 weeks, the cultures were diluted to differentextents and plated on Middlebrook 7H10 agar with 10%OADC. The CFUs were counted after another 2–3 weeks.AcknowledgementsThis work was supported by the National NaturalScience Foundation of China (30670109), the ChinaPostdoctoral Scientific Program (20060390605), andthe National Basic Research Program of China (973Program) (2009CB918604).References1 Keshavjee S & Becerra MC (2000) Disintegrating healthservices and resurgent tuberculosis in post-soviet Tajiki-stan: an example of structural violence. JAMA 283, 1201.2 Lenaerts A, Degroote M & Orme I (2008) Preclinicaltesting of new drugs for tuberculosis: current challenges.Trends Microbiol 16, 48–54.3 Hondalus MK, Bardarov S, Russell R, Chan J, WilliamR, Jacobs J & Bloom BR (2000) Attenuation of andprotection induced by a leucine auxotroph of Mycobac-terium tuberculosis. Infect Immun 68, 2888–2898.4 Smith DA, Parish T, Stoker NG & Bancroft GJ (2001)Characterization of auxotrophic mutants of Mycobacte-rium tuberculosis and their potential as vaccine candi-dates. Infect Immun 69, 1142–1150.5 Lee CE, Goodfellow C, Javid-Majd F, Baker EN & LottJS (2006) The crystal structure of TrpD, a metabolicenzyme essential for lung colonization by Mycobacteriumtuberculosis, in complex with its substrate phosphoribo-sylpyrophosphate. J Mol Biol 355, 784–797.6 Creighton TE & Yanofsky C (1966) Indole-3-glycerolphosphate synthetase of Escherichia coli, an enzyme ofthe tryptophan operon. J Biol Chem 241, 4616–4624.Table 4. Primers used in site-directed mutagenesis studies.Changes in DNA sequences are expected to change the aminoacids to alanine.Mutation type Mutagenic primers (5¢-to3¢)Pro63 fi Ala Up: CAAGCGCGCTAGTGCTTCGGCAGGCGDown: CGCCTGCCGAAGCACTAGCGCGCTTGSer64 fi Ala Up: CGCTAGTCCTGCGGCAGGCGCATTGGDown: CCAATGCGCCTGCCGCAGGACTAGCGGlu168 fi Ala Up: CAGCACTCGTCGCGGTCCATACCGAGDown: CTCGGTATGGACCGCGACGAGTGCTGVal169 fi Ala Up: CACTCGTCGAGGCCCATACCGAGCAGDown: CTGCTCGGTATGGGCCTCGACGAGTGHis170 fi Ala Up: CGTCGAGGTCGCTACCGAGCAGGAAGDown: CTTCCTGCTCGGTAGCGACCTCGACGAsn189 fi Ala Up: GGTGATTGGCGTTGCCGCCCGCGACCDown: GGTCGCGGGCGGCAACGCCAATCACCArg191 fi Ala Up: GCGTTAACGCCCGGCACCTCATGACGDown: CGTCATGAGGTGCCGGGCGTTAACGCAsp192 fi Ala Up: CGTTAACGCCCGCGCCCTCATGACGCDown: GCGTCATGAGGGCGCGGGCGTTAACGLeu193 fi Ala Up: CGCCCGCGACGCCATGACGCTGGACGDown: CGTCCAGCGTCATGGCGTCGCGGGCGLeu196 fi Ala Up: GACCTCATGACGGCGGACGTGGACCGDown: CGGTCCACGTCCGCCGTCATGAGGTCInhibitor of indole-3-glycerol phosphate synthase H. Shen et al.152 FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS7 Sassetti CM, Boyd DH & Rubin EJ (2003) Genesrequired for mycobacterial growth defined by highdensity mutagenesis. Mol Microbiol 48, 77–84.8 Yang Y, Zhang M, Zhang H, Lei J, Jin R, Xu S, Bao J,Zhang L & Wang H (2006) Purification and characteriza-tion of Mycobacterium tuberculosis indole-3-glycerolphosphate synthase. Biochemistry (Moscow) 71, S38–S43.9 Amzel L (1998) Structure-based drug design. Curr OpinBiotechnol 9, 366–369.10 Greer J, Erickson J, Baldwin J & Varney M (1994)Application of the three-dimensional structures ofprotein target molecules in structure-based drug design.J Med Chem 37, 1035–1054.11 Hilpert K, Ackermann J, Banner DW, Gast A, Guber-nator K, Hadva´ry P, Labler L, Mu¨ller K, Schmid G &Tschopp TB (1994) Design and synthesis of potent andhighly selective thrombin inhibitors. J Med Chem 37,3889–3901.12 Varghese J, Smith P, Sollis SL, Blick TJ, SahasrabudheA, McKimm-Breschkin JL & Colman PM (1998) Drugdesign against a shifting target: a structural basis forresistance to inhibitors in a variant of influenza virusneuraminidase. Structure 6, 735–746.13 Ely B & Pittard J (1979) Aromatic amino acidbiosynthesis: regulation of shikimate kinase inEscherichia coli K-12. J Bacteriol 138, 933–943.14 Hennig M, Darimont BD, Jansonius JN & Kirschner K(2002) The catalytic mechanism of indole-3-glycerolphosphate synthase: crystal structures of complexes ofthe enzyme from Sulfolobus solfataricus with substrateanalogue, substrate, and product. J Mol Biol 319, 757–766.15 Berman HM, Westbrook J, Feng Z, Gilliland G, BhatTN, Weissig H, Shindyalov IN & Bourne PE (2000)The protein data bank. Nucleic Acids Res 28, 235–242.16 Braun W & Go˜N (1985) Calculation of proteinconformations by proton–proton distance constraints: anew efficient algorithm. J Mol Biol 186, 611–626.17 Eramian D, Shen MY, Devos D, Melo F, Sali A &Marti-Renom MA (2006) A composite score for pre-dicting errors in protein structure models. Protein Sci15, 1653–1666.18 Gerlt J & Raushel F (2003) Evolution of function in(alpha ⁄ beta)8-barrel. Enzymes 7, 252–264.19 Soto CY, Andreu N, Gibert I & Luquin M (2002)Simple and rapid differentiation of Mycobacteriumtuberculosis H37Ra from M. tuberculosis clinicalisolates through two cytochemical tests using neutralred and nile blue stains. J Clin Microbiol 40, 3021–3024.20 Lipinski C, Lombardo F, Dominy B & Feeney P (2001)Experimental and computational approaches to estimatesolubility and permeability in drug discovery and devel-opment settings. Adv Drug Deliv Rev 46, 3–26.21 Marti-Renom MA, Stuart A, Fiser A, Sa´nchez R, MeloF & Sali A (2000) Comparative protein structure mod-eling of genes and genomes. Annu Rev Biophys BiomolStruct 29, 291–325.22 Spoel DVD, Lindahl E, Hess B, Groenhof G, Mark AE& Berendsen HJC (2005) GROMACS: fast, flexible andfree. J Comp Chem 26, 1701–1718.23 Lindahl E, Hess B & Spoel DVD (2001) GRO-MACS 3.0: a package for molecular simulation andtrajectory analysis. J Mol Mod 7, 306–317.24 Jorgensen WL (1998) OPLS force field. In The Encyclo-pedia of Computational Chemistry (Schleyer PVR, ed.),pp. 1986–1989. Wiley, New York.25 Jorgensen WL & Madura JD (1985) Temperature andsize dependence for Monte Carlo simulations of TIP4Pwater. Mol Phys 56, 1381–1392.26 Berendsen HJC, Postma JPM, van Gunsteren WF,DiNola A & Haak JR (1984) Molecular dynamics withcoupling to an external bath. J Chem Phys 81, 3684–3690.27 Essmann U, Perera L, Berkowitz ML, Darden T, LeeH & Pedersen LG (1995) A smooth particle meshEwald method. J Chem Phys 103, 8577–8593.28 Hess B, Bekker H, Berendsen H & Fraaije J (1997)LINCS: a linear constraint solver for molecular simula-tions. J Comp Chem 18, 1463–1472.29 Humphrey W, Dalke A & Schulten K (1996)VMD – visual molecular dynamics. J Mol Graphics 14,33–38.30 Goodsell DS & Olson AJ (1990) Automated docking ofsubstrates to proteins by simulated annealing. Proteins8, 195–202.31 Morris GM, Goodsell DS, Halliday RS, Huey R, HartWE, Belew RK & Olson AJ (1998) Automated dockingusing a Lamarckian genetic algorithm and an empiricalbinding free energy function. J Comput Chem 19, 1639–1662.32 Aalten DMF, Bywater R, Findlay JBC, Hendlich M,Hooft RWW & Vriend G (1996) PRODRG, a programfor generating molecular topologies and unique molecu-lar descriptors from coordinates of small molecules.J Comput Aided Mol Des 10, 255–262.33 Mehler EL & Solmajer T (1991) Eletrostatic effects inproteins: comparison of dielectric and charge models.Protein Eng 4, 903–910.34 Siddiqi SH, Libonati JP & Middlebrook G (1981) Eval-uation of rapid radiometric method for drug susceptibil-ity testing of Mycobacterium tuberculosis. J ClinMicrobiol 13, 908–912.35 Bradford MM, McRorie RA & Williams WL (1976) Arapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principleof protein-dye binding. Anal Biochem 72, 248–254.36 Kirschner K, Szadkowski H, Jardetzky TS & Hager V(1987) Phosphoribosylanthranilate isomerase-indoleglyc-H. Shen et al. Inhibitor of indole-3-glycerol phosphate synthaseFEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS 153[...].. .Inhibitor of indole-3-glycerol phosphate synthase H Shen et al erol -phosphate synthase from Escherichia coli Methods Enzymol 142, 386–397 37 Anderotti G, Cubellis MV, Palo MD, Fessas D, Sannia G & Marino G (1997) Stability of a thermophilic TIMbarrel enzyme: indole-3-glycerol phosphate synthase from the thermophilic archaeon Sulfolobus solfataricus Biochem J 323, 259–264 154 38 Pino MMS & Fersht AR... MMS & Fersht AR (1997) Nonsequential unfolding of the beta ⁄ alpha barrel protein indole-3-glycerol- phosphate synthase Biochemistry 36, 5560–5565 39 Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95 ⁄ 98 ⁄ NT Nucleic Acids Symp Ser 41, 95–98 FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS . CTCGGTATGGACCGCGACGAGTGCTGVal169 fi Ala Up: CACTCGTCGAGGCCCATACCGAGCAGDown: CTGCTCGGTATGGGCCTCGACGAGTGHis170 fi Ala Up: CGTCGAGGTCGCTACCGAGCAGGAAGDown:. CTTCCTGCTCGGTAGCGACCTCGACGAsn189 fi Ala Up: GGTGATTGGCGTTGCCGCCCGCGACCDown: GGTCGCGGGCGGCAACGCCAATCACCArg191 fi Ala Up: GCGTTAACGCCCGGCACCTCATGACGDown: CGTCATGAGGTGCCGGGCGTTAACGCAsp192
- Xem thêm -

Xem thêm: Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx, Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx, Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx