0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... (5¢-to3¢) Vps4 DEL F TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT Vps4 DEL R ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA Vps4 TRP F TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA Vps4 TRP R TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA Vps4 RDF ... meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain. The distinguishing feature of members of the meiotic clade of AAA ATPases is the SRH motif, which ... modulating the function of the SRH. The C-terminal region of human VPS4B contains the b domain (b strands 7 and 8), the final helix of the AAA domain (a helix 10) and the C-terminal helix (a helix...
  • 23
  • 490
  • 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

... coenzyme analog lacking the ade-nine ring in the upper axial ligand; a model of damagedcofactors) for free adeninylpentylcobalamin (AdePeCbl)(an inactive coenzyme analog containing the adeninering ... 11 A ˚ in height. The size of this cavity is comparable with that of adenine-lacking cobalamins, and thus allows the damagedcofactor to pass through it. Intact cofactor, an ade-nine-containing ... centrifugation at 16 000 g for 5 min. The amount of radioactivity in 0.2 mL of the super-natant was determined by liquid scintillation counting, and ATPase activity was obtained by subtracting the radioactiv-ity...
  • 13
  • 620
  • 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

... in the vicinity of the steadystate. We do this to investigate the stability of this state. In this way we obtain the in uence a small change in the concentration of substance j, i.e. Dxj,hasonthetimedisplacement ... (IMC, VUA) and Mathematical Biochemistry (SILS, UvA),Amsterdam, the Netherlands;3Department of Biochemistry and Molecular Biology, Faculty of Chemistry and CeRQT at BarcelonaScientific Parc, ... (negative) in uence a substrate has on its own removal. It is obtained for allsubstrates of any elementary reaction. The main point of the present section is that any Jacobianmatrix element equals the...
  • 11
  • 638
  • 0
Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc

Báo cáo khoa học: The hinge region operates as a stability switch in cGMP-dependent protein kinase Ia doc

... domain interactions in presence and absence of cGMP. The interaction of the auto-inhibi-tory domain with the catalytic domain in the presence and absence of cGMP is of particular interest, as itforms ... release of the auto-inhibitory domain from the active site, thereby activa-ting the kinase. This is indicated by a remarkableincrease in the proteolytic sensitivity of the N-terminus in the ... run at 5 mA for 2 h and subsequently at 10 mA for an additional 5 h. A 5% stack-ing gel was used and proteins were stained using Coomassiebrilliant blue staining.Native ESI-MSSample preparation...
  • 13
  • 440
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Acquiring Lexical Generalizations from Corpora: A Case Study for Diathesis Alternations" pdf

... acquire alternating verbs from large balanced corpora by using partial- parsing methods and taxonomic information, and discuss how corpus data can be used to quantify lin- guistic generalizations. ... in the benefactive alternation if it has the double object and 'V NP1 for NP2' frames. Ta- ble 5 shows a comparison of the verbs found in the corpus against Levin's list of ... class for a given alter- nation. The underlying assumption is that a verb is typical for an alternation if it is equally frequent for both frames which are characteristic for the alter- nation....
  • 8
  • 483
  • 0
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

... primer pairs and TaqMan MGB probesused for inverted terminal repeat amplification were:1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGCATGGC-3¢; and AAV65MGB/taq, ... TCGGCGGTCTTTCTGTGAG51mUbiq.P: TGTTTCGACGCGCTGGGCG96mUbiq.R: GTTAACAAATGTGATGAAAGCACAAACardiac ankyrin repeat protein in muscle plasticity L. Laure et al.680 FEBS Journal 276 (2009) 669–684 ª 2008 The Authors ... to investigate the role of CARP in thesesignalling pathways.Experimental proceduresAnimalsAll mice were handled in accordance with the Europeanguidelines for the humane care and use of experimentalCardiac...
  • 16
  • 428
  • 0
Tài liệu Báo cáo khoa học: The Alzheimer b-peptide shows temperature-dependent transitions between left-handed 31-helix, b-strand and random coil secondary structures doc

Tài liệu Báo cáo khoa học: The Alzheimer b-peptide shows temperature-dependent transitions between left-handed 31-helix, b-strand and random coil secondary structures doc

... Tmvaluesobtained by the two state interpretation of the CDdata. These values of Tmappear to fall near the minima of the / angle curves. For comparison we also studied the variant peptideAb(12–28)G19G20. ... shorterfragments, Ab(1–9) and Ab(12–28) at varying tempera-tures at 500 lm concentration and pH 7. Assignmentwas based on standard procedures. The aim was toobtain information on the temperature ... From the fitting of hPIIaccording to the linearized model in Eqns (5) and (6) to the data of Fig. 2, a transitiontemperature Tm, an enthaply change DH and a cooper-ativity r was obtained for...
  • 12
  • 287
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"

... statistical analysis of the study. MS conceived and coordinated the study and wasinvolved in the interpretation of the data and manuscript revi-sion. All authors read and approved the final ... obtained on a daily basis, at least in The Netherlands [13].There may be advantages to eliminating daily routine CXRs.First, a routine strategy carries the risk that abnormalities thateither ... analysis and interpretation of the data and in drafting the manuscript. PS, JS and MV contributed to the conception and design of the study and manuscript revision.JK was involved in the design and...
  • 7
  • 722
  • 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc

... was basically stable at 35 °C, and retained60% of the initial activity at 45 °C for 90 min whenassayed at 35 °C (Fig. 3A, B). The presence of Ca2+increased the thermal stability of PhyH and ... they can increase the amount of available phosphate by interacting together. Additionally,fusing PhyH-DI to a single-domain phytase appears to be an efficient wayto improve the activity of the ... Coo-massie Brilliant Blue R250. Protein concentration wasdetermined using the Bradford assay with BSA as the standard [28].Phytase activity assayPhytase activity was determined by measuring the...
  • 9
  • 801
  • 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... Yasuda T (2002) Activation of AtMEK1, an Ara-bidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active mutants expressed in E.coli and generation of the active form ... [c-32P]-ATP. MBP was used as an artifi-cial substrate to assess the kinase activity and GST alone wasused as a negative control. The top panel shows the kinase assayvisualized by autoradiography and ... (2003)Growth signalling pathways in Arabidopsis and the AGC protein kinases. Trends Plant Sci 8, 424–431.9 Galvan-Ampudia CS & Offringa R (2007) Plant evolu-tion: AGC kinases tell the auxin tale. Trends...
  • 11
  • 700
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ