test tube of molten solder was quenched in a large container of water at room temperature 23 oc
Dynamic material characterisation of solder interconnects in microelectronic packaging
... (approximately 90 oC) for another 90 seconds • Test tube was dipped into water at room temperature to cool down to room temperature Quench 70 oC/ s • container of water at room temperature (23 ... Designation Slow Approximate Cooling Rate o 0.1 C/s Steps • Cooled Test tube of molten solder was placed in insulated cooling chamber and cooled at ambient temperature • (SC) Temperature was lowered ... 20-30mm and then placed in a glass evaporating dish and heated up to their melting temperature using a butane gas burner The semi -molten solder was stirred using a glass rod to facilitate even melting...
- 141
- 612
- 0
The interference of mother tongue as vietnames in learning english souds and stress at high school = ảnh hưởng của tiếng mẹ đẻ đối với việc học âm và trọng âm tiếng anh ở trường phổ thông
... glass, Barbara? Barbara: Its on the bar Martin: Barbara! Margaret! Come into the garden! Martha and Charles are dancing in the dark Margaret: In the garden? What a laugh! Barbara: Ah! Lets take ... Pronunciation of Grammatical Endings 5.1 Pronunciation of Grammatical Endings in English 2.5.1.1 The Importance of Pronunciation of Grammatical Endings We know that English is an inflected language ... several different ways Look at this list of words Write them in the correct columns: castle bald rapid ancient arent calm water start saw today man park natural hand final / ổ/ again assistant fat...
- 50
- 3,120
- 9
Báo cáo khoa học: Variants of b2-microglobulin cleaved at lysine-58 retain the main conformational features of the native protein but are more conformationally heterogeneous and unstable at physiological temperature potx
... demonstrated by size exclusion chromatography of dK58-b2m incubated at 310 K [10] The NMR data clearly indicate that the overall folding pattern of the cleaved b2m variants is very similar to that of ... Capillary electrophoresis separation of b2-microglobulin (b2m) with Lys58 deleted (dK58-b2m) incubated at different temperatures (A) Separation profiles to show that sample temperature (indicated in ... high-concentration samples and s injections of low-concentration samples) were analyzed by CE performed at constant current of 80 lA, with the capillary cooling fluid maintained at 278 K Samples also contained...
- 14
- 358
- 0
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
... (MedCalc Software, Mariakerke, Belgium) statistical software was used for all statistical analyses Categorical data are presented as absolute and relative frequencies, continuous variables as median ... Jr: ACC/AHA guidelines for the management of patients with unstable angina and non-STsegment elevation myocardial infarction A report of the American College of Cardiology/American Heart Association ... syndrome (unstable angina and myocardial infarction) c Medians and ranges of all measured blood glucose levels for all patients in a group Categorical data are presented as absolute and relative frequencies,...
- 8
- 656
- 1
Tài liệu The Development of the Feeling for Nature in the Middle Ages and Modern Times doc
... sympathy with human joys and griefs was taken for granted, and she played a part of her own in drama In the _Mahõbhõrata_, when Damajanti is wandering in search of her lost Nala and sees the great ... that the taste for the beauty of Nature, even at that wild time, was not dead, and that the writer's attitude was not mainly utilitarian He noted the fertility of the land in wine and grain, and ... Toscanelli, Lucca Baccioli, and Leonardo da Vinci, Italy was beyond all comparison the first nation in Europe in mathematics and natural science A significant proof of the wide-spread interest in...
- 194
- 633
- 0
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot
... AACGAGgtaggc ATCAAGgtaaga ACACAGgtttga GCAAAGgtaatg GAGAAAgtaagt CTTCAGgtaatt ACCACGgtaggc TTGCAAgtatgc ACCAGGgtaagt AACAAGgtaaga TACCAGgtatga TTGATGgtgaga CAGAAGgtaaca GGAAGGgtgagt 35209 16864 ... 70034 ttacagGTTTCT ctgcagGCTGTG ttttagATTCAA ttgcagGTCTGT ttatagGTTGCT tttcagGATGTG aaccagGTTATT tttcagACCCTA atttagCTTCAT ctttagGGGAAA atctagCATTGA atgtagGCAAAA aatcagGATGTT tttcagCTTTGA gene ... the primers 5¢-GTTCCTGAGCAAAGTCTTCAATG-3¢ and 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTT TTAAG-3¢ and 5¢-GGAGACAGTGACAAGTTATCTA GTGCT-3¢ for XPR70...
- 12
- 507
- 0
Báo cáo khoa học: Fatty acid composition of chylomicron remnant-like particles influences their uptake and induction of lipid accumulation in macrophages pot
... that oleate is oxidized more rapidly than palmitate in macrophages and that 7.5 times more oleate than palmitate is transferred from these cells to lymphocytes in coculture, indicating that ... quantified by absorbance volume analysis Cell protein content was measured by the method of Lowry et al [44] with BSA as standard Statistical analysis Data were analysed by two-way analysis of variance ... ester) and TG in CRLPs and in cells was determined by enzymatic analysis using commercial enzymatic reagent kits (Alpha Laboratories, Eastleigh, UK) For analysis of the fatty acid composition of...
- 9
- 349
- 0
Báo cáo khoa học: Initiation of JC virus DNA replication in vitro by human and mouse DNA polymerase a-primase ppt
... [a3 2P]dCTP and [a3 2P]dTTP (3000 CiÆmmol)1, AmershamBiosciences) DNA polymerase a- primase was added as indicated The incorporation of radioactive dNMP was measured by acid-precipitation of DNA and scintillation ... creatine kinase, 0.25 mgÆmL)1 heat treated BSA, and lCi [a- 32P]dCTP and lCi [a- 32P]dTTP (each 3000 CiÆmmol)1, AmershamBiosciences) Recombinant DNA polymerase a- primase was added as indicated After ... significant, albeit overall less efficient, incorporation by both murine and human DNA polymerase a- primase (data not shown) indicating that RPA also is not a speciesspecific factor In apparent contradiction...
- 8
- 326
- 0
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf
... PA gene, and the reverse primers bF24rv and bF57rv The bF24rv mutagenic primer was 5¢-ATAAGTATACGCAG GCGCATACCAGCCAAACTGCGGGCCATTTAC-3¢ and the bF57rv mutagenic primer was 5¢-GGAAATC ACACCATTATGACCAAAAACCAGCCCGGGATA ... that the mutations in uence the rate of acylation by PGA in a similar way as the acylation by NIPAB A notable exception was the twofold increased activity for PGA of the aF146Y mutant It appeared ... rather than an increased affinity for 6-APA The fact that higher Vs/Vh ratios for bF2 4A were observed at all concentrations of 6-APA, indicates that under a broad range of conditions this mutant...
- 8
- 561
- 0
state university of new york press dreams in exile rediscovering science and ethics in nineteenth-century social theory apr 2009
... the social pathologies of modern life: alienation, rationalization, and anomie The basis for social critique and practical action requires a critical imagination and institutional insight that ... conceptions of practical reason itself A particular action must be seen as abstract and universal, that is, as capable of serving as a natural law transcending individual interests and intentions Just as ... impressions and empirical observations or by means of human reason penetrating into the conceptual heart of unchanging mathematical relations and quantifiable forms, shapes, and motion? Within the tradition...
- 388
- 393
- 0
Báo cáo khoa học nông nghiệp " Effects of Stocking Biomass on Growth, Survival and Production of the Two Sizes of Clam Meretrix lyrata Cultured in the Intertidal Areas And Notes on Hatchery Production of Clam Spat " pot
... the variation of fatty acid of clam Ruditapes decussatus reared in sea water and effluent from a fish farm in Galicia (JaraJara et al., 1997) The fatty acid variation and the factors affecting ... The average water temperature was 23. 59±2.4 0oC, relatively low compared to the normal water temperature in the south of Vietnam, where M lyrata naturally distributes This mean clam are not be affected ... as feces, which regarded as a detriment to the clam growing (Yan et al., 2006) It was also investigated that at the same temperature, the clearance rate and ingestion rate of clam were increased...
- 18
- 442
- 0
Báo cáo lâm nghiệp: "Spatio-temporal patterns of the Norway spruce decline in the Beskid Śląski and Żywiecki (Western Carpathians) in southern Poland" pot
... R2 = Years bark was very advanced; mostly adults entered in winter diapause In consequence, the attack potential of swarming adults in the spring of 2007 was very high Spatial aspect The bark beetle ... mountain area under the greatest threat The yearly data covering the period 2003 to 2006 were used For this study a simple database was built; it was arranged by forest compartments as the basic area ... as an indicator of dramatic collapse in tree health and vitality The fast increase in the bark beetle population level, started and supported by favourable breeding and weather conditions (warm...
- 7
- 392
- 0
Báo cáo khoa học: "Survival of avirulent thermostable Newcastle disease virus (strain I-2) in raw, baked, oiled, and cooked white rice at ambient temperatures" pps
... eltsacweN tsniaga snekcihc fo noitaniccav larO ADWWAD aradnaB ,LCM siwlA ed ,LWG enadrawayaJ 2991 ,arrebnaC ,hcraeseR larutlucirgA lanoitanretnI rof ertneC nailartsuA ,87-57 pp 93 oN seniccaV larO ... mrof eht ni teid nekcihc eht ni tnemelppus a sa desu si ecir dna ,segalliv ni elbaliava ylnommoc si ecir etihw dekooC elbaliava emoceb yam eniccav DN laro rof reirrac tneinevnoc dna laedi na ... eltsacweN elbatsomreht a htiw slairt latnemirepxE KMJ areyH ,MA agapaK ,NP arubmaW 61 412-502 ,43 ,8991 deM teV verP snekcihc egalliv dna latnemirepxe ni )2I niarts( eniccav esaesid eltsacweN...
- 3
- 202
- 0
Báo cáo lâm nghiệp: "Allozyme variation of Pinus pallasiana D. Don in Natural Crimean populations and in plantations in technogenously-polluted areas of the Ukraine steppes" ppsx
... specific goal of this investigation was to compare the allozyme variation parameters of a P pallasiana natural reference Figure Location of Black Pine natural stands and plantations examined (see also ... 122–179 (in Russian) [22] Silin A. E., Goncharenko G.G., Allozyme variation in natural populations of Eurasian pines Population structure and genetic variation in geographically related and isolated ... potential of possible basic materials needs to be investigated and compared to a reference system of natural populations This comparison can also be very important in the case of Pinus pallasiana, in...
- 8
- 356
- 0
Báo cáo y học: "Differential Constitutive and Cytokine-Modulated Expression of Human Toll-like Receptors in Primary Neutrophils, Monocytes, and Macrophages" docx
... AGAGTTTCCTGCAATGGATCAAG, TLR4; GGCTTAATCACACCAATGTCACTATAG, TLR5; and TCTGAAGACTTCAGGCCCAACT, TLR9 for forward primers, and GCAGCTCTCAGATTTACCCAAAA, TLR2; TTATCTGAAGGTGTTGCACATTCC, TLR4; TTAAGACTTCCTCTTCATCACAACCTT, ... TLR2 and TLR4 in anti-bacterial innate immunity surveillance Alternatively, they suggest that separate expression control of TLR5 by inflammatory cytokines may contribute to regulation of innate ... from the National Institutes of Health (WCL), and a Canada Research Chair in Infectious Diseases and Inflammation (WCL) Conflict of interest The authors have declared that no conflict of interest...
- 8
- 349
- 0
Báo cáo y học: "The active metabolite of leflunomide, A77 1726, increases the production of IL-1 receptor antagonist in human synovial fibroblasts and articular chondrocytes" ppsx
... macrophages, into the joint Local release of proinflammatory mediators and metalloproteinases causes joint cartilage destruction and leads to the perpetuation of joint inflammation Potential direct ... kinases that are involved in cytokine and growth factor signalling [13–15] RA is characterized by synoviocyte proliferation and infiltration of inflammatory cells, such as lymphocytes and macrophages, ... determined as previously described [12] Statistical analysis The statistical significance of differences was calculated using analysis of variance P < 0.05 was considered statistically significant...
- 9
- 437
- 0
báo cáo khoa học: "The role of 18F-FDG-PET/CT in the preoperative staging and posttherapy follow up of gastriccancer:Comparison with spiral CT" docx
... metastasis was 18 (75%) (Kappa:0.42), bone metastasis was 21 (87%) (Kappa:0.33) and intestinal wall was 23 (95%) Becasue there was only one patient who had intestinal wall involvement, Kappa could ... Oral contrast agent was given to all patients during PET/CT imaging A semiquantitative and visual analysis was made Images were evaluated by two nuclear medicine specialists and a consensus was ... the data, literature analysis and participated in drafting the manuscript OK conceived of the study, and participated in its design and coordination All authors read and approved the final manuscript...
- 5
- 390
- 0
Báo cáo y học: "Analysis of immunoglobulin light chain rearrangements in the salivary gland and blood of a patient with Sjögren’s syndrome" pptx
... years at the time of analysis The patient expressed elevated titers of anti-52 kDa Ro(SS -A) and anti-52 kDa La(SS-B) antibodies, had marked hypergammaglobulinemia, and was rheumatoid factor (RF) ... classification of SS [8] were analyzed The patient was a 76-year-old female who manifested a typical histology of the minor salivary glands (focus score >1) The duration of the disease was years ... obtained from the peripheral blood of the same patient This patient manifested increased titers of autoantibodies (anti-Ro and anti-La), hypergammaglobulinemia and enlargement of the parotid glands,...
- 12
- 441
- 0
Báo cáo y học: " Effects of cyclophosphamide on pulmonary function in patients with scleroderma and interstitial lung disease: a systematic review and meta-analysis of randomized controlled trials and observational prospective cohort studies" ppt
... data acquisition and analysis, and in manuscript preparation CPW and ELM participated in the study design, data acquisition and analysis, and in manuscript preparation PJE participated in data ... versus azathioprine [11] for at least 12 months In the observational prospective studies, scleroderma patients were treated with CYC for at least 12 months, and were evaluated at baseline and after ... Data presented as mean ± standard deviation AZA, azathioprine; CYC, cyclophosphamide; DLCO, diffusing capacity for carbon monoxide; FVC, forced vital capacity aPercentage predicted value at baseline...
- 9
- 477
- 0
Báo cáo y học: "Expression of cartilage-derived morphogenetic protein in human intervertebral discs and its effect on matrix synthesis in degenerate human nucleus pulposus cells" potx
... GAG concentration was then normalised to DNA content per bead and means and standard errors calculated In addition DNA content per bead was calculated as an indication of cell proliferation Available ... weeks was calculated DNA from papain digests of cell-associated fractions were assayed along with calf thymus DNA standards using the Pico Green DNA quantification kit as per manufactures' instructions ... After washing, sections were incubated in a 1:300 dilution of biotinylated donkey anti-goat antiserum (SantaCruz biotechnology, SantaCruz, California, USA) for 30 minutes at room temperature...
- 10
- 437
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25