0

‎4 10 cre regulated recombination pattern at adult stages and at 2 wpt in a and b foregut and c and d mid gut the ribbons of recombinant cells decreased in number but increased in width by 2 wpt β actin dtomato red β actin yfp yell

The structure basis for burkholderia pseudomallei hcp induced multinucleated giant cell formation

The structure basis for burkholderia pseudomallei hcp induced multinucleated giant cell formation

Cao đẳng - Đại học

... Sequence (5'-3') Hcp1F CATATGCTGGCCGGAATATATC 55 Hcp1R CTCGAGTCAGCCATTCGTCCAGTT 55 Hcp1UpF CCATGATTACGAATTCGTACGTCGTCGACATGGAC A < /b> 60 Hcp1UpR TACCCGGGGATCCTCGATGTGGATTTTCCCGTCAT 60 Hcp1DnF GAG GAT CCC ... GGCCAGTGCCAAGCTTGCAGATCGTCGTGTCGGA 60 Hcp1RB CGGTACCCGGGGATCCGATCAGCCATTCGTCCAG T 60 TssCRB CGGTACCCGGGGATCCGCGCTTCAGGAAATCGTT 60 Hcp1Q46AE47AF GCGGCGGGCCTGACGCCCGCCGCCGCCGCTCGC 60 Hcp1Q46AE47AR CGTCAGGCCCGCCGCGAGCCTGGCAGGCATGTC ... CCC CGG GTA TCA CGT TGA CGA AGG AAA TG 60 Hcp1DnR CCAAGCTTGCATGCCTGCAGCGATCTGCGCTTCG ATTT 60 Hcp1Up3 GGAGCCTTTGATTTCCCCCT 60 Hcp1Dn3 GAAATCAAAGGCTCCGCGGGCGCCGCAAACTGG AC 60 Hcp1FH GGCCAGTGCCAAGCTTGCAGATCGTCGTGTCGGA...
  • 155
  • 1,103
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The interaction between different types of activated RAW 264.7 cells and macrophage inflammatory protein-1 alpha" potx

Báo cáo khoa học

... (one way ANOVA) To obtain activated states of MF, MF was stimulated by LPS, IL-4, and < /b> IL-13, and < /b> then the activated states were evaluated by measuring iNOS and < /b> arginase activity M1 induced by LPS ... Amplification was terminated by 10 < /b> at < /b> 72< /b> C For data analysis, the comparative threshold cycle (CT) value for b- actin was used to normalize loading variations in < /b> the real-time PCRs ΔΔCT value then was ... activated MF in < /b> RPI are induced by distinct cytokines generated by damaged cells after g-ray irradiation of the lung Classical activation of macrophages was originally reported to require both...
  • 7
  • 380
  • 0
Báo cáo khoa học: Ascorbic acid-pretreated quartz enhances cyclo-oxygenase-2 expression in RAW 264.7 murine macrophages pdf

Báo cáo khoa học: Ascorbic acid-pretreated quartz enhances cyclo-oxygenase-2 expression in RAW 264.7 murine macrophages pdf

Báo cáo khoa học

... significantly increased by incubation of the cells with AA-treated and < /b> untreated quartz, at < /b> all particle Fig NF-jB, pCREB and < /b> AP-1 nuclear translocation in < /b> quartz-treated RAW 26< /b> 4.7 cells EMSA analyses of ... (black, dotted bars) and < /b> 18 h (white, dotted bars) incubation (analysis of variance, P < 0.01) In < /b> this case, the PGE2 concentration in < /b> the medium of cells incubated with AA-treated quartz increased ... COX -2 < /b> band and < /b> the corresponding b- actin band, relative to control Values are the mean ± SD from eight experiments The symbol # indicates a < /b> significant increase in < /b> COX -2 < /b> at < /b> increasing aerosil concentrations...
  • 14
  • 253
  • 0
Báo cáo y học:

Báo cáo y học: "Stable expression of a recombinant human antinucleosome antibody to investigate relationships between antibody sequence, binding properties, and pathogenicity" doc

Báo cáo khoa học

... incubated for hour at < /b> 37 C The plates were washed again with PBST Bound antibody was detected by adding goat antihuman IgG alkaline phosphatase conjugate and < /b> incubating for hour at < /b> 37 C Substrate ... and < /b> established the antinucleosome ELISA DL and < /b> DI participated in < /b> the design and < /b> coordination of this project AR conceived the study, participated in < /b> the design and < /b> coordination, and < /b> wrote the ... are numbered according to the system of Wu and < /b> Kabat [26< /b> ] Amino acids are indicated by their one-letter code Dots have been inserted to facilitate the alignment A < /b> dash indicates sequence identity...
  • 13
  • 472
  • 0
Báo cáo y học:

Báo cáo y học: "A randomized, double-blind study of AMG 108 (a fully human monoclonal antibody to IL 1R1) in patients with osteoarthritis of the knee" pdf

Báo cáo khoa học

... (pneumonia); and < /b> patients in < /b> the placebo SC group (Staphylococcus infection in < /b> one; and < /b> abdominal pain in < /b> the other) Table Pharmacokinetic data after intravenous and < /b> subcutaneous administration of amg 108< /b> ... pneumonia and < /b> supraventricular tachycardia in < /b> the other); and < /b> patients in < /b> the placebo SC group (arthropod bite and < /b> Staphylococcus infection in < /b> one; abdominal pain in < /b> the second; and < /b> coronary artery disease ... weeks and < /b> 12 < /b> include all evaluable patients Panel b, change from baseline, by stratification for pain at < /b> baseline dGEMRIC: delayed gadolinium-enhanced magnetic resonance imaging of cartilage; LOCFLlast...
  • 30
  • 277
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of signaling components required for the prediction of cytokine release in RAW 264.7 macrophages" pdf

Báo cáo khoa học

... are provided in < /b> Additional data file Matlab code and < /b> the data can be obtained upon request Additional data files The following additional data are available with the online version of this paper ... Measured versus predicted log-transformed concentration values are indicated for training data (unfilled circles) and < /b> test data (filled triangles) Dashed and < /b> dotted lines indicate one and < /b> two standard ... considered To validate the minimal models, test data are used If validation fails, the test data are also included in < /b> the training set and < /b> the model-reduction procedure is repeated Additional details...
  • 14
  • 182
  • 0
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot

Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot

Báo cáo khoa học

... Yb3+ to apo-Tf, two absorbance bands appeared at < /b> 24< /b> 2 and < /b> 29< /b> 2 nm, the characteristic of metal binding to phenolate groups of tyrosine residues at < /b> the speci c iron bind-sites of apo-Tf The De2 42 < /b> ... water bath at < /b> 29< /b> 8 ± 0.5 K Fourhundred data points were collected over various times (2,< /b> and < /b> 10 < /b> s) for each trace and < /b> each curve was obtained by averaging 5 10 < /b> traces The dead-time of the instrument ... added to a < /b> solution of apo-Tf containing 2.< /b> 5 mol equiv of Yb3+, a < /b> new broad band centred at < /b> 465 nm appeared and < /b> increased in < /b> Fig The dependence of e (top) and < /b> k (bottom) on the molar ratio of...
  • 9
  • 385
  • 0
báo cáo hóa học:

báo cáo hóa học:"Interdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells" pdf

Hóa học - Dầu khí

... A)< /b> , the CD66ae mAb and < /b> CD6 6b mAb (panel B) , the CD66ae mAb and < /b> CD6 6c mAb (panel C) , the CD66ae mAb and < /b> CD66de mAb (panel D) , the CD6 6b mAb and < /b> CD6 6c mAb (panel E), the CD6 6b mAb and < /b> CD66de mAb ... with each family member as indicated by a < /b> lower case letter after "CD66" as follows: CD6 6a < /b> mAb, CEACAM1, biliary glycoprotein; CD6 6b mAb, CEACAM8, CGM6; CD6 6c mAb, CEACAM6, NCA; CD6 6d mAb, CEACAM3, ... CD6 6b mAb, and < /b> CD66de mAb (panel C) , the CD66ae mAb, CD6 6c mAb, and < /b> CD66de mAb (panel D) , or the CD6 6b mAb, CD6 6c mAb, and < /b> CD66de mAb (panel E), were added (see Methods) Neutrophils in < /b> Ca2+ free...
  • 12
  • 599
  • 0
báo cáo hóa học:

báo cáo hóa học: " Human brain endothelial cells endeavor to immunoregulate CD8 T cells via PD-1 ligand expression in multiple sclerosis" pdf

Toán học

... BBB model HBECs were plated to the upper chamber of a < /b> Boyden chamber and < /b> then inflamed Activated CD8 (A,< /b> B) and < /b> CD4 (C, D) T cells were added to the upper chamber and < /b> allowed to migrate for 24< /b> ... been previously demonstrated that the ligation of PD-1 blocks the b1 and < /b> b2 integrin-mediated adhesion by human T cells induced with anti-CD3 [35] Therefore, based on these published data and < /b> ... entire co-culture After a < /b> day co-culture, CD8 T cells were collected and < /b> stained for Live/dead fixable Aqua dead cell stain kit (Invitrogen) to exclude dead cells and < /b> stained for CD8, granzyme B, and...
  • 12
  • 294
  • 0
Báo cáo y học:

Báo cáo y học: " Human embryonic stem cell (hES) derived dendritic cells are functionally normal and are susceptible to HIV-1 infection" pot

Báo cáo khoa học

... cultured in < /b> cytokine media and < /b> analyzed by FACS for CD14 and < /b> CD 1a < /b> markers at < /b> different days by staining with CD 1a-< /b> PECY5 and < /b> CD14-PE conjugated antibodies Dot plots are representative of triplicate ... sorted based on CD 1a < /b> marker The cells were then incubated with Alexa-Dextran at < /b> 0 C and < /b> 37 C for hr and < /b> analyzed by FACS as described in < /b> Methods The percent antigen uptake was measured as the difference ... was assessed by co-incubating graded numbers of CD 1a+< /b> cells previously sorted on the basis of CD 1a < /b> immunomagnetic labeling (Miltenyi Biotech, Auburn, CA), and < /b> irradiated (3500 rads) DCs for days...
  • 9
  • 261
  • 0
Quy trình bảo dưỡng, sữa chữa ô tô con 4-7 chỗ. thiết kế trạm bảo dưỡng, sữa chữa theo tiêu chuẩn

Quy trình bảo dưỡng, sữa chữa ô tô con 4-7 chỗ. thiết kế trạm bảo dưỡng, sữa chữa theo tiêu chuẩn

Cơ khí - Vật liệu

... lượng d u B c tr c khuỷu hỏng B c truyền hỏng L c d u t c Van tràn hỏng 35 Kh c ph c S a < /b> ch a < /b> Thay phớt d u Thay gioăng S a < /b> ch a < /b> S a < /b> van d u S a < /b> b m d u Thay d u Thay b c Thay b c Thay l c d u S a < /b> ... 4.000 Chạy rà Sau chạy rà Sau s a < /b> ch a < /b> lớn Chạy rà Sau chạy rà Sau s a < /b> ch a < /b> lớn Chạy rà Sau chạy rà Sau s a < /b> ch a < /b> lớn 1 .2.< /b> 2 S a < /b> ch a:< /b> Gồm c ng vi c :Kiểm tra, chẩn đoán, tháo lắp điều chỉnh ph c hồi ... Kiểm tra độ cong tr c khuỷu, tr c cam Mài c tr c khuỷu, c biên, c tr c cam theo tiêu chuẩn kỹ thuật Thay b c lót, ổ bi đỡ tr c cam Kiểm tra c n tr c khuỷu Kiểm tra, phân loại s a < /b> ch a < /b> chi tiết...
  • 118
  • 4,283
  • 55
8 cách đơn giản tăng tốc windows 7

8 cách đơn giản tăng tốc windows 7

Công nghệ

... đến c ng vi c b n: ASP.NET State Service, Automatic Updates, Help and < /b> Support, Indexing Service, Messenger, Remote Registry, Upload Manager, Web Client, Machine Debug Manager Chỉnh s a < /b> File boot.ini ... và nhấn Enter - Tại c a < /b> sổ System Configuration hiện ra, chọn tab Boot và nhấn vào nút Advanced Options… - a< /b> nh d ́u vào mu c Number of processors và chọn số nhân cu a < /b> cpu mà ... hoạt ch c Windows, b n chọn Start/Programs /Accessories /System Tools /Disk Defragmenter B n c n chọn ổ d a < /b> c ng click nút Defragment để b t đầu vi c d n d p B n sử d ng phần mềm O&O Defrag để...
  • 19
  • 440
  • 0
cac nguyen to thuoc nhom 7

cac nguyen to thuoc nhom 7

Tiếng anh

... Ca(OH )2 < /b> đun nóng nhẹ: Cl2 + Ca(OH )2 < /b> = CaOCl2 + H2O  CaOCl2 không b n, d phân huỷ + Trong không khí ẩm : 2CaCl(OCl) + CO2 + H2O = CaCO3 + CaCl2 + 2HClO + T c d ng với HCl: CaOCl2 + 2HCl = CaCl2 ... ứng ; 5F2 + X2 = 2XF5 (Cl2, Br2 pư 20< /b> 0 0C, I2 t0 thường) Cl2 + X2 = 2XCl (Br2 pư 0 0C, I2 t0 thường) Br2 + X2 = 2BrX (F2, Cl2 pư 0 0C) Br2 + I2 = 2IBr (pư 45 0C, môi trường N2)  Halogen c tính ... HCl + I2↓ + H2O 3ClO- + 2NH3 = N2 + 3Cl- +3H2O 29< /b> HỢP CHẤT HALOGEN Nư c Javen dung d ch nư c NaCl + NaClO tạo nên cho khí Cl2 phản ứng với dung d ch NaOH nguội: Cl2 + 2NaOH nguội = NaCl + NaClO...
  • 45
  • 754
  • 2
Essential guide to writing part 7

Essential guide to writing part 7

TOEFL - IELTS - TOEIC

... respect for their physical appearance.) The third has a < /b> few books or many—every one of them dog-eared and < /b> dilapidated, shaken and < /b> loosened by continual use, marked and < /b> scribbled in < /b> from front to back ... the grammatically incomplete sentence, as in < /b> the second paragraph of this passage (italics added): Approaching the lake from the south, spread out, high up in < /b> a < /b> great V, was a < /b> flock of Canada ... natural And < /b> it can accommodate more complex relationships among ideas; it is not confined to topics that can be broken into a < /b> numbered series Sentences can be linked in < /b> several ways t> Repeating...
  • 15
  • 371
  • 0
British English A to Z - past 7

British English A to Z - past 7

Anh ngữ phổ thông

... sides (teams) play a < /b> match, rather than a < /b> game, in < /b> Britain game match, test See Test Match matchcard, n scorecard mate, n Inf buddy Inf Matey or maty is a < /b> slang adjective for chummy A < /b> penmate ... Italian vermouth—is still occasionally ordered, but not by Americans mash, n mashed potatoes Inf Occasionally, creamed potatoes in < /b> Britain A < /b> pub used to present sausages and < /b> mash in < /b> the public bar ... during the over, the result is called a < /b> maiden over, and < /b> the bowler is said to have bowled a < /b> maiden over Metaphorically maiden over can be used as an elegant and < /b> dramatic way of describing any achievement...
  • 29
  • 443
  • 0
Đề thi HKI Toán 7-Năm 2010.2011             I m«n to¸n - líp 7

Đề thi HKI Toán 7-Năm 2010.2011 I m«n to¸n - líp 7

Toán học

... Vẽ hình viết giải thiết, kết luận đúng: 0.5đ a)< /b> Chứng minh đ c tam gi c ABC = tam gi c ADE 0.75đ b) Chứng minh đ c DE//BC c) Chứng minh đ c AF=AC CFEF 0.75đ 0.5đ ... h c kỳ I môn toán - lớp Thời gian làm b i: 90 phút C u 1: Mỗi c u trả lời đ c 0 .25< /b> đ c u đáp án Đ S đ s C u 2:< /b> Mỗi ý đ c 0 .25< /b> đ c u a < /b> b c d đáp án a < /b> c d b Tự luận: THPT: Mỗi c u 0.5đ a < /b> 20< /b> b -36 c ... b -36 c Tìm x: Mỗi c u 0.5đ a < /b> x= 28< /b> b x=9 c x= 16 x= Gọi ẩn viết đ c tỷ lệ th c: 1đ - áp d ng tính chất d y tỉ số c kết đúng: 1đ + Lớp 7A:< /b> 3 5c y + Lớp 7B: 25< /b> + Lớp 7C: 1 5c y Vẽ hình viết giải...
  • 2
  • 447
  • 0
Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc

Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc

Tiếp thị - Bán hàng

... invited by a < /b> prospective client to propose how they would tackle a < /b> given brief • Press Pack/Kit: a < /b> branded pack handed out to the media by an organisation It normally contains background material, ... employees Common tools include newsletters and < /b> intranets • Logo: A < /b> graphic or symbol owned by and < /b> representing a < /b> company or brand • Media Relations: communicating with the media by pro-actively speaking ... media: media relating to different market sectors for a < /b> product or service For example, you can promote a < /b> barcode printer in < /b> the printing media, packaging media and < /b> food retailing media • Viral...
  • 2
  • 490
  • 0
Tài liệu Thêm Dropbox vào menu Send To trong Windows 7, XP và Vista ppt

Tài liệu Thêm Dropbox vào menu Send To trong Windows 7, XP và Vista ppt

Tin học văn phòng

... link sau vào Windows Explorer m c Search menu Start %APPDATA%\Microsoft\Windows\SendTo Nếu b n c dropbox Favorites, phải chuột vào folder chuyển tới folder Send To Khi b n d n folder này, b n ... C: \Documents and < /b> Settings\[User Name]\SendTo (User Name tên máy tính b n) tạo shortcut cho folder Dropbox Giờ b n c folder Dropbox thêm vào m c Send To Menu Context Nếu b n sử d ng Send To menu Context, ... b n di chuyển, chép tạo shortcut… Trong ví d , tạo shortcut Khi phải chuột vào file folder, b n chuyển tới folder Dropbox Nếu b n c folder chia sẻ folder Dropbox, b n thêm chúng vào menu Send...
  • 8
  • 385
  • 0
Tài liệu Human Resources Development Division Head Office, 7, Bhikaiji Cama Place, New Delhi -110607 docx

Tài liệu Human Resources Development Division Head Office, 7, Bhikaiji Cama Place, New Delhi -110607 docx

Ngân hàng - Tín dụng

... scribe should be from an academic discipline other than that of the candidate The academic stream of the scribe should be different from that of the candidate iv) Both the candidate as well as ... 08 – 10 < /b> SC/ST/PC category candidates General/OBC/EXSM category candidates Rs 50/- per candidate (only intimation charges) Rs 400/- per candidate Rs 20< /b> /- per candidate (only intimation charges) ... interview The result of the qualification prescribed must have been declared on or before 1.8 .20< /b> 12 < /b> Candidates must specifically indicate the class/division and < /b> percentage of marks obtained (calculated...
  • 17
  • 347
  • 0

Xem thêm