β herpesviruses and epstein barr virus in the lower respiratory tract from lung transplant patients results of a study performed at the virology unit of the university hospital san giovanni battista turin italy
Báo cáo y học: "Primary effusion lymphoma associated with Human Herpes Virus-8 and Epstein Barr virus in an HIV-infected woman from Kampala, Uganda: a case repor" pptx
... the Institute of Haematology and Oncology “L and A Seragnoli”, Bologna University School of Medicine, Bologna, Italy The alkaline phosphatase anti-alkaline phosphatase method and the primary antibodies ... of Congo, Tanzania, Zambia and South Africa Nigeria, Ghana, Zimbabwe and Egypt have prevalence rates of 50% and the countries with relatively low rates of 25% and below are the Central African ... considerable variation in the seroprevalence rates of HHV-8 infection among adults and children; the highest adult rates of 26-100% have been found in Uganda, Cameroon, Ivory Coast, Gambia, the Democratic...
- 5
- 394
- 0
Báo cáo hóa học: " Quantitative profiling of housekeeping and Epstein-Barr virus gene transcription in Burkitt lymphoma cell lines using an oligonucleotide microarray" docx
... CTCTCTCTTTCAGGCCTCAACAGGCACTGTATTCATTGCCAATGTTCCAAAT TATCAAATTCAAGTGAAT TATCTTCGGAAGAACCCCAATTATGATCTCTAAGTGACCACCAGGGGCTCT GAACTGTAGCTGATGTTAT ATCATCGAGAAGGACAAAATCACCACCAGGACACTGAAGGCCCGAATGGA CTAACCCTGTTCCCAGAGCC ... TCATCCAGACTTAGCCAC GCAACCACTGATACACTGGAAAGCACAACAGTTGGCACTTCTGTCTAGAAA ATAATAATTGCAAGTTGTA ACCTTGGCCATCTATGACCTGGCTACGCAGACTCTTAGGCATCAGTGTCAG CACCAGTCGGGCATCGTGC TTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCC ... TTTCCCAAGTCCCGCATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAG CCCCTGAACTTCCACGCCA GCAAGAAGTTACGACACGTACACAACGACAGAACAACAGAGAAGACCCCG AAGACCACTAGCACGACCGT CGAAGGAAAGTGGAGCTCTTCATCGCCACCTCCCAGAAGTTTATCCAGGAG ACAGAGCTGAGCCAGCGCA CTCTCTCTTTCAGGCCTCAACAGGCACTGTATTCATTGCCAATGTTCCAAAT...
- 15
- 426
- 0
báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx
... Takei et al demonstrated that the expression level of SAP transcripts in the peripheral leukocytes of RA patients was significantly lower than in normal individuals, and RA patients had decreased ... KS and JT assembled, analyzed and interpreted the patient findings including the hematological disease, rheumatoid arthritis and pathological samples All authors contributed to writing the manuscript ... factor, anti-RNP antibody, and anti-SS -A antibody Bilateral hand X-rays showed mild swelling and destruction of the metacarpo-phalangeal (MP) and proximal-inter-phalangeal (PIP) joints He was diagnosed...
- 6
- 314
- 0
Báo cáo y học: "Possible roles of Epstein-Barr virus in Castleman disease" potx
... areas There are 12 cases having EBER signal in areas of germinal centers and cases having signals in inter-follicular areas In the group of EBV localized within germinal centers (GC-EBV), patients ... the applications of either alternative or adjuvant therapy Since many medications and even radiation therapy could block angiogenesis This may explaine why some reports showed radiation and chemotherapy ... write the article and submit the manuscript TT Hung helped analyze the results of the study HC Liu and TP Liu participated in reviewing the manuscript All authors have read and approved the final...
- 5
- 316
- 0
báo cáo hóa học:" Does self-regulation and autonomic regulation have an influence on survival in breast and colon carcinoma patients? results of a prospective outcome study" potx
... consecutively among inpatients at the Havelhöhe Hospital and from outpatients in the two practises In this paper we report the results from the breast cancer and colorectal cancer group and the healthy ... operated and 57.9% of all had received standard radio-chemotherapy and were still receiving hormonal treatment (table 1) Colorectal cancer patients participating in the study had a mean disease ... class, respectively Results At study inclusion breast cancer patients participating in the study had a mean disease duration of 4.7 years, 13 (13.7%) of them a disease duration of less than year,...
- 11
- 538
- 0
Báo cáo y học: " Diagnosing asthma in general practice with portable exhaled nitric oxide measurement – results of a prospective diagnostic study" ppsx
... manufacturer Aerocrine® recommended an elevated level at FENO > 20 ppb (as intermediate level) and a level of FENO > 35 ppb as a clear indication for an eosinophilic inflammation in adult patients ... COPD and three patients with overlap had already stopped smoking several years before the examination Four of them had accumulated one to three pack years The diagnoses of these four patients changed ... overlap of COPD and asthma were significantly older and had more pack years of smoking than asthma patients (p < 0.001 for each difference; t-Test) At the lung function laboratory the diagnosis of...
- 11
- 354
- 0
Báo cáo y học: " ''''Diagnosing Asthma in General Practice with Portable Exhaled Nitric Oxide Measurement – Results of a " pps
... line 4, "81%" should say "82%" and in line 5, "FENO £12" should say "FENO £16" In the second paragraph, in line 1, "five" should say "three" In line 5, "16 patients had FENO £12 ppb" should say ... line of the third paragraph "12 to 46 ppb" should say "16 to 46 ppb" and in the seventh line, the sec- Table 2: Likelihood ratio at different cut-off points (n = 160); unit of FENO is parts per ... "37 patients had FENO £ 16 ppb" Also in line 5, "three" should say "two" and in lines 11 and 12 "FENO £ 12 ppb" should say ""FENO £16 ppb" and 12 ppb
- 3
- 198
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... 5¢ interface between cDNA and pEBTet is AAGCTT GAATTCTGCAGAT TCGA gccacc ATGCGGGA (polylinker in bold, Kozak motif in lower case, cDNA underlined); the 3¢ interface is ATTTCTAGA TCCAGCAC For pEBTetD ... SLC2 2A1 6h, the 5¢ interface is GGTACC CCCCCGGA; the 3¢ interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC The cDNA of eGFP corresponds to GenBank entry ... 3B) and OCT2h (not shown) we obtained inadequate ratios; for our assays, we aim for at least a 10 : ratio It was reasoned that with some cDNAs, even the low mRNA levels in the off-state generate,...
- 8
- 331
- 0
Báo cáo y học: " Systemic Epstein-Barr-virus-positive T cell lymphoproliferative childhood disease in a 22-year-old Caucasian man: A case report and review of the literature" docx
... clinical information; AG, CM, SR, and MTS analyzed data; SAP and PPP performed research, analyzed data and wrote the manuscript All authors read and approved the final manuscript VT and CA contributed ... VT performed research, analyzed data and wrote the manuscript; CA performed research and analyzed data; ES and FB analyzed data; SC and GM were responsible for patient care and provided clinical ... that arose in the setting of acute primary EBV infection in our patient, characterized by a monoclonal proliferation of EBV-infected T cells Case presentation A 23-year-old Caucasian man was hospitalized...
- 5
- 379
- 0
Báo cáo y học: "Sequence analysis of the Epstein-Barr virus (EBV) BRLF1 gene in nasopharyngeal and gastric carcinomas" docx
... Fukayama M, Hayashi Y, Iwasaki Y, Chong J, Ooba T, Takizawa T, Koike M, Mizutani S, Miyaki M, Hirai K: Epstein- Barr virus- associated gastric carcinoma and Epstein- Barr virus infection of the ... populations in Southern China Interestingly, a silent mutation A G at 103654 was found in all the wild isolates, suggesting this interchange may be a specific marker of the EBV strains in local area and ... hydrophobic amino acid may alter the affinity of protein with DNA, while mutation at position 316 may contribute less to the change of the capacity of DNA binding, according to the results of Manet, E and...
- 8
- 348
- 0
The development of an in vivo humanized mouse model to investigate epstein barr virus infection and tumorigenesis
... differentiate into plasma cells 43 These findings indicate that EBV latency programs are closely aligned with the normal B cell differentiation and maturation pathways Proliferating activated lymphoblasts ... solid organ transplant patients and from recipient cells in bone marrow transplant patients A hypothetical role of latent EBV proteins in the pathogenesis of PTLD has been explained in the previous ... activation of the NF-κB pathway apoptotic proteins Bcl-2 76,77 73-75 and induces the upregulation of anti- and A2 0 78 Activation of cellular signaling pathways is responsible for the dramatic...
- 191
- 634
- 0
Báo cáo khoa học: "Epstein-Barr virus latent membrane protein-1 (LMP-1) 30-bp deletion and Xho I-loss is associated with type III nasopharyngeal carcinoma in Malaysia" docx
... only available for 16 out of 29 cases €Data was only available for 38 out of 39 cases The data was only available for 36 out of 39 cases ΩData was only available for 26 out of 30 cases ΨData was ... only available for 31 out of 34 cases ¥Data was only available for 28 out of 29 cases ∞Data was only available for 26 out of 29 cases ØData was only available for 27 out of 29 cases ¤Data are ... patient data YYY provided the plasma samples and applied for ethics approval HSSand HFSwere responsible for data analysis and preparation of the manuscript All authors read and approved final version...
- 10
- 356
- 1
Báo cáo y học: "Effect of methotrexate and anti-TNF on Epstein-Barr virus T-cell response and viral load in patients with rheumatoid arthritis or spondylarthropathies" ppt
... preparation and interpretation of the data CM-R was responsible for sample blood collection, manuscript preparation, interpretation of data and statistical analyses NG performed the ELISPOT assays ... SpA patients had anti-TNF + MTX Twenty-two MTX naive RA patients received MTX EBV viral load data were also available for 67 patients and 15 control individuals at week 0, and for 52 patients at ... effect A recent meta-analysis of randomized controlled trials of infliximab and adalimumab identified 10 cases of lymphoma (four cases in the randomized phase of the trials and six cases in the...
- 9
- 471
- 0
Báo cáo sinh học: "Epstein-barr virus induced cellular changes in nasal mucosa" pptx
... anesthesia The histology report of the Institute of Anatomy and Histologic Pathology stated "fragment of nasal mucosa with pronounced angiectatic-edematous aspects of the stroma and inflammatory infiltration ... angiectasic-edematous phenomena of the stroma and eosinophil lymphoplasma cell inflammatory infiltration That the finding was aspecific is obvious given the characteristics of the respiratory mucosa epithelium, ... meaning we are unable to explain as regards the acidophil area in the apical portion of the multinucleate cells and the presence of cells with PAS+ vacuoles A particularly interesting finding...
- 6
- 281
- 0
báo cáo hóa học: " Quantification of functional weakness and abnormal synergy patterns in the lower limb of individuals with chronic stroke" pdf
... characteristics of each subject group is shown in Table Instrumentation Each subject was placed in a custom setup that allowed for the study of strength and coordination of the lower extremities in a standing ... MA) and custom data acquisition software written in Matlab (Mathworks Inc Natick, MA) and stored for later analysis Protocol Subjects were asked to generate maximum voluntary torques (MVTs) about ... the amount of co-contraction during the generation of MVTs a co-contraction index was calculated The Page 10 of 11 (page number not for citation purposes) Journal of NeuroEngineering and Rehabilitation...
- 11
- 574
- 0
báo cáo hóa học:"Epstein-barr virus induced cellular changes in nasal mucosa" docx
... anesthesia The histology report of the Institute of Anatomy and Histologic Pathology stated "fragment of nasal mucosa with pronounced angiectatic-edematous aspects of the stroma and inflammatory infiltration ... angiectasic-edematous phenomena of the stroma and eosinophil lymphoplasma cell inflammatory infiltration That the finding was aspecific is obvious given the characteristics of the respiratory mucosa epithelium, ... meaning we are unable to explain as regards the acidophil area in the apical portion of the multinucleate cells and the presence of cells with PAS+ vacuoles A particularly interesting finding...
- 6
- 326
- 0
Báo cáo y học: "Patients with systemic lupus erythematosus have abnormally elevated Epstein–Barr virus load in blood" pps
... healthy control individuals using a semiquantitative PCR assay Materials and methods Patients and samples Sixty-six Korean patients with SLE treated at the Department of Internal Medicine (Kangnam ... healthy control individuals Spearman correlation analysis was performed to determine bivariate correlations Results Epstein Barr virus detection and Epstein Barr virus typing in mouthwash samples To ... semiquantitative PCR assay to evaluate the level of EBV genome in the peripheral blood of SLE patients We could detect and quantify EBV DNA in almost all of the patients with SLE and the control individuals...
- 8
- 251
- 0
Báo cáo y học: "Epstein–Barr virus and rheumatoid arthritis: is there a link''''" docx
... 110 Yamazaki M, Kitamura R, Kusano S, Eda H, Sato S, Okawa-Takatsuji M, Aotsuka S, Yanagi K: Elevated immunoglobulin G antibodies to the proline-rich amino-terminal region of Epstein- Barr virus ... Fujiwara S, Horie T, Ryu J, Osaka S, Yoshino S, Sawada S: Detection of Epstein- Barr virus- encoded small RNA and latent membrane protein in synovial lining cells from rheumatoid arthritis patients ... Costenbader and Karlson responses to Epstein- Barr virus- determined nuclear antigen (EBNA)-1 and EBNA-2 in acute and chronic Epstein- Barr virus infection Proc Natl Acad Sci USA 1987, 84:570-574 Linde...
- 7
- 346
- 0
Báo cáo y học: " Measurement of Epstein-Barr virus DNA load using a novel quantification standard containing two EBV DNA targets and SYBR Green I dye" pps
... ATA CTG TTA GCC CTG CGC CGG AGT AAG CAG ACA TAT AG /CAA AAC CTC AGC AAA TAT ATG AG 554 bp N /A Custom 95°C initial denaturation for 10 mins; 55°C annealing BG-1F TAG CAA CCT CAA ACA GAC ACC A ... plasma of nasopharyngeal carcinoma and lymphoma patients Cancer Res 2003, 63(9):2028-32 43 Lin JC, et al: Quantification of plasma Epstein- Barr virus DNA in patients with advanced nasopharyngeal ... from early to end-stage disease EBV DNA loads increased sequentially following transplantation, decreased after anti-viral therapy in Patients A and C and peaked ten days prior to death in Patients...
- 11
- 323
- 0
Báo cáo khoa học: "Genetic diversity and phylogeography of Seewis virus in the Eurasian common shrew in Finland and Hungary" ppsx
... A, Vaheri A, Vapalahti O, Plyusnin A: Co-circulation of three pathogenic hantaviruses: Puumala, Dobrava, and Saaremaa in Hungary J Med Virol 2009, 81:2045-2052 Garanina SB, Platonov AE, Zhuravlev ... (mtDNA), amplified by PCR, using previously described universal primers (5'-CGAAGCTTGATATGAAAAACCATCGTTG-3' and 5'-GCAGCCCCTCAGAATGATATTTGTCCAC-3') mtDNA sequences were deposited into GenBank ... trapping the conducted Maps with Maps with shaded areas, showing the (A) geographic range of the Eurasian common shrew (Sorex araneus) and administrative districts in (B) Hungary and (C) Finland,...
- 6
- 366
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008