withdrawals as it was suggestive of an account being used to plan for and to respond to normal households contingencies in a short time period and it has been labelled as the contingency account
báo cáo khoa học: " Can the ubiquitous power of mobile phones be used to improve health outcomes in developing countries" pps
... (Continued) Spain Hypertension United States Hospice patients Scotland Asthma United States Smoking cessation Croatia Asthma Spain Cardiovascula r disease Finland Diabetes Spain Vaccination rates ... have a conversation Forms of payment and market potential The standard way of paying for a mobile phone service in the United States and Europe is on the basis of a minimum use of a certain time ... texting study All subjects received asthma education, self-management plan, and standard treatment All measured PEF three times daily and kept a symptom diary In the study group, therapy was adjusted...
- 14
- 401
- 0
Exergoeconomic performance optimization of an endoreversible intercooled regenerative Brayton combined heat and power plant coupled to variable-temperature heat reservoirs
... and Cwf , CL and CL max are the smaller and the larger of the two capacitance rates CL and Cwf , CIm in and CIm ax are the smaller and the larger of the two capacitance rates CI and Cwf N H ... temperature is TK The heat exchangers between the working fluid and the heat reservoir, the regenerator and the intercooler are counter-flow and the heat conductances (heat transfer surface area and ... pressure ratio and the total pressure ratio by taking the maximum dimensionless profit rate as the objective Effects of design parameters on the optimal performance are analyzed in detail and the thermal...
- 16
- 605
- 0
The Project Gutenberg EBook of An Elementary Treatise on Fourier’s Series and Spherical, potx
... of the ring Let us use spherical co¨rdinates, taking the centre of the ring as origin and o the axis of the ring as the polar axis To obtain the value of the potential function at any point in ... from the base; we shall attempt to find the temperature at any point of the plate Let us take the base as the axis of X and one end of the base as the origin Then to solve the problem we are to ... instantaneous and to permanent heat sources and sinks, and to heat doublets Examples Application to the case where there is leakage.—Arts 55–56 Transmission of a disturbance along an in nite stretched elastic...
- 309
- 537
- 0
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx
... overlapping PCR using oligonucleotide primers N8517 (Forward: 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC ... The VNAR library was transformed into E coli TG1 and phagemid particles rescued and panned against the immobilized Tom70 antigen Four rounds of biopanning were performed with an increase in the ... generate an in vitro library of VNAR domains, containing both synthetic and natural CDR3 loops, and then to isolate specific binding molecules using as an initial target antigen the mitochondrial outer...
- 12
- 522
- 0
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt
... G A G A A A A A AT T TA A G AT C T AT T T G A A C T A G A C C A AT G C T G G G A G A A A A A AT T TA A G AT C T Mut A AT T T G A A C T G T G A A G AT G C T G G G A G A A A A A AT T TA A G AT ... population of cells in S phase As shown in Fig 2A, LIN54 depletion results in an accumulation of cells in G2 ⁄ M and in a reduction in the fraction of cells in S phase Staining with an antibody against ... CMV-b-gal were transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) Luciferase and b-galactosidase activities were determined The luciferase activity was normalized to the b-galactosidase...
- 14
- 456
- 0
Báo cáo khoa học: Recombinant expression of an insulin-like peptide 3 (INSL3) precursor and its enzymatic conversion to mature human INSL3 pot
... Functional cAMP assay The activity of the mature INSL3 and its precursor was measured using a receptor-activating assay Chemically synthesized INSL3 was used as the standard As shown in Fig 7, the recombinant ... B-chain and A- chain were linked by an eight-residue linker sequence For insulin and insulin-like growth factor-1, the C-terminus of the B-chain and N-terminus of the A- chain can be linked by an ... of INSL3 and its analogues has relied on solid-phase chemical synthesis of the separate A- and B-chains and subsequent chain recombination [17] To establish an alternative source of INSL3, in...
- 9
- 314
- 0
Báo cáo khoa học: Development of an HSV-tk transgenic mouse model for study of liver damage pptx
... (data not shown) Biochemical analysis of the blood Twenty-one days after the injection of GCV, the values of alanine aminotransferase (ALT), aspartate aminotransferase (AST) and total bilirubin ... analysis of the GCV-treated HSV-tk rat model of Kawasaki et al [10] revealed moderate hepatocyte vacuolation and an increased number of in ammatory cells In this study, we found that there was ... than that of the rat and the cost of producing and maintaining transgenic mice is less than for rats The high conservation and strong liver-specific regulatory machinery of the mouse serum albumin...
- 9
- 475
- 0
Báo cáo hóa học: " REP-LECOTOX: an example of FP 6 INCO project to strengthen ecotoxicological research in WBC (Western Balkan countries)" ppt
... ecotoxicology and toxicology for measuring effects of stressors and understanding mechanism of their toxicity - was a perfect place to gain theoretical and practical knowledge, applicable to the planned ... goals, the upgraded and strengthened LECOTOX will have an important task in the future, as well as the capability and capacity to offer its expertise and advice to policy and decision makers as well ... as a tool for monitoring the effects of toxic agents in the environment The exchange and mobility at the level of permanent, senior, and junior staff of LECOTOX and partnering institutions was...
- 9
- 374
- 0
Báo cáo hóa học: " Optimization of an Electron Transport Layer to Enhance the Power Conversion Efficiency of Flexible Inverted " ppt
... seed layer and organic material was planar, and most of the photo generated excitons were unable to reach the interface This resulted in a large recombination probability in locations distant from ... dissociation interface area was greatly increased, and most of the photogene rated excitons were able to reach the interface before recombination A second possible reason is a higher mobility of the ... a larger area between ZnO and the active layer is favorable for increased exciton diffusion and separation events For IOSCs with a ZnO seed layer, the exciton dissociation interface between the...
- 5
- 327
- 0
Báo cáo hóa học: " Research Article Design and Analysis of an Energy-Saving Distributed MAC Mechanism for Wireless Body Sensor Networks" doc
... DQMAC performance and that of the standard facto 802.15.4 MAC and the BSN-MAC is portrayed BSN-MAC has been selected as a reference benchmark for its similarity in terms of design as well as structure, ... Communications and Networking star-based BSNs, where a body area network (BAN) coordinator is elected In a hospital BSN, the BAN coordinator can be a central care unit linked to a number of ward patients ... Nevertheless, it has already been proved that the CSMA/CA mechanism, used within the CAP, has a significant negative impact on the overall energy consumption, as the traffic load in the network steadily...
- 13
- 485
- 0
Báo cáo hóa học: " Research Article Design and Implementation of an Enhanced 802.11 MAC Architecture for Single-Hop " ppt
... perform a transmission attempt We denote with AOB-CR the standard AOB protocol enhanced with the capabilities of collecting credit and using these credits to regulate the duration of frame transmission ... procedures invoked at the end of 802.11 frame transmission and reception events The firmware was realized in such a way to maintain the maximum possible level of abstraction and to minimize the software ... permits to further increase the MAC protocol efficiency A final remark is on the implicit capability of the AOB scheme to mitigate the negative impact of external interferences In fact, the standard...
- 12
- 456
- 0
Báo cáo hóa học: " FPGA Implementation of an MUD Based on Cascade Filters for a WCDMA System" doc
... The authors are grateful for the financial support of the Natural Sciences and Engineering Research Council of Canada (NSERC) We also wish to thank Axiocom Inc for its technical and financial assistance ... (x) and (x) define the real and imaginary parts of x, and Rre and Rim represent the accumulation registers for real and imaginary parts Figure 6(b) illustrates the scheduling and register-transfer ... respectively He was two times the Laureate of the Governor General of Canada’s Academic Medal (gold medal—graduate level) and a Fellow of the Natural Sciences and Engineering Research Council of EURASIP...
- 12
- 388
- 0
Báo cáo lâm nghiệp: "Effect of an oil heat treatment on the leachability and biological resistance of boric acid impregnated wood" pps
... along the leaching procedure by using Inductively Coupled Plasma analysis (ICP) of leachates, leached and unleached samples Analyses of boron amount remaining before and after leaching were realized ... Before being submitted to an oil-heat treatment, the transverse sections of the specimens were coated with epoxy resin to forbid exchanges in longitudinal direction as we want to study radial and ... placed in each jar Tests jars were finally incubated at 26 ◦ C for 12 weeks Mass loss of specimens was calculated as the difference of final and initial oven-dried weight of each sample RESULTS AND...
- 6
- 417
- 0
Báo cáo lâm nghiệp:" How to relate the standing tree shape to internal wood characteristics: Proposal of an experimental method applied to poplar trees" pptx
... built in our laboratory and has certain similarities to a lathe The log was maintained between a fixed headstock and a moving tailstock mounted on slides and moved by an endless screw in order to ... vertical plates By means of a cog-wheel and an endless screw attached to the axis of the fixed headstock, the log could be rotated and maintained at a chosen angular position An angular coder measured ... tree and in the second one related to the AMEB The details are presented in Annex The transformation was applied to all points measured with AMEB including the targets of the discs Using this transformation...
- 8
- 291
- 0
Báo cáo khoa học: "Towards construction of an ultra high density linkage map for Pinus pinaster" pdf
... recombination to other displayed markers and the 206 associated markers, an integrated map of 1182 markers was achieved with an average of 99 markers per linkage group 3.3 Associations of linkage ... SSRs and ESTs into linkage groups for both parents, it was possible to assign all 12 homologous chromosomes for P1 and P2, and to obtain in this way an integrated consensus map with a total of ... multipoint linkage analysis and the EM algorithm for handling missing data were performed as described in [16, 17] The MAPRF program [17] was applied for the computational methods Firstly, linkage...
- 8
- 307
- 0
Báo cáo y học: "How possible is the development of an operational psychometric method to assess the presence of the 5-HTTLPR s allele? Equivocal preliminary findings" pdf
... analysing the data and writing the paper AL participated in the genetic and statistical analysis HSA participated in designing the study, analysing the data and writing the paper GB participated ... participated in the statistical analysis and wrote the paper KNF conceived the study, carried out the literature search and analysis and participated in writing the paper ZR participated in analysing ... this type of analysis Item analysis was performed, and the value of Cronbach’s a for each scale was calculated The sensitivity (Sn) and Specificity (Sp) were also calculated Results In all, 19 (13.76%)...
- 7
- 509
- 0
Báo cáo khoa học: " Validation of an elastic registration technique to estimate anatomical lung modification in NonSmall-Cell Lung Cancer Tomotherapy" docx
... used an intensity-based method adopting the sum of square distance as the similarity measure In that pioneering paper, the registration was performed only in two patients with lung cancer and was ... of an atlas-based automatic segmentation software for the delineation of brain organs at risk in a radiation therapy clinical context Radiotherapy and oncology 2008, 87:93-99 28 Jaccard P: The ... di Muzio N, Fazio F, Calandrino R: Treatment planning comparison between conformal radiotherapy and helical tomotherapy in the case of locally advanced-stage NSCLC Radiotherapy and Oncology 2008,...
- 10
- 358
- 0
báo cáo khoa học: "Increasing delivery of an outdoor journey intervention to people with stroke: A feasibility study involving five community rehabilitation teams" pps
... physiotherapists and occupational therapists, and involvement of therapy assistants Role sharing and expansion are examples of organisational interventions [35] A more in- depth examination of how therapists ... conceptualised and planned the study, collected and analysed the data, and drafted the manuscript The second author advised on study design and writing of the manuscript Both authors read and approved ... content of a workshop Education A half-day workshop was run in August 2007 The workshop was lead by AM First, we presented a critical appraisal of the original randomised trial by Logan and colleagues...
- 10
- 295
- 0
báo cáo khoa học: " Surface structure, model and mechanism of an insect integument adapted to be damaged easily" pot
... Loading The loading was always divided into two load cases: a force perpendicular to the patch surface (normal force) and parallel to it (shear force) In a real situation, the mandibles of an attacking ... and Rhadinoceraea Recently, the mechanical strength of dissected pieces of larval integument was measured in a calibrated manner The force needed to damage the integument can vary in more than ... attacking predator, typically a small arthropod, apply the loading [10] The diameter of a mandible's tip was measured on workers of the ant Myrmica rubra and reached 20 µm as the smallest value...
- 11
- 224
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu