0

when the carrying amount is a reasonable approximation of fair value for example in the case of non current trade receivables and payables

Báo cáo y học:

Báo cáo y học: "Timing of adequate antibiotic therapy is a greater determinant of outcome than are TNF and IL-10 polymorphisms in patients with sepsis." potx

Báo cáo khoa học

... and SB participated in the acquisition of the data and performed DNA testing AC conducted data analyses and interpreted the results COL participated in the study design, acquisition of data and ... sponsorship TAP participated in the acquisition, analysis and interpretation of data CGM participated in the design of the study, carried out DNA testing and participated in the writing of the manuscript ... hours in the hospital, and the dose and pattern of administration were in accordance with current standards Failure of organs was evaluated using the Sequential Organ Failure Assessment (SOFA) scale...
  • 12
  • 293
  • 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Báo cáo khoa học

... GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 ... variety of external stimuli and consist of three sequentially acting protein kinases: a MAPK kinase kinase, a MAPK kinase (MAPKK) and finally a MAPK [19] However, little is known about the function and ... Matsuoka D, Nanmori T, Sato K, Fukami Y, Kikkawa U & Yasuda T (2002) Activation of AtMEK1, an Arabidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active mutants...
  • 11
  • 700
  • 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx

Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx

Báo cáo khoa học

... screen We are grateful to Nicola Minshall and Nancy Standart for the tethering assay constructs, and to Marvin Wickens and Labib Rouhana for the gifts of HA-MS2-XGld2 and HAMS2-XGld2 D24 2A, respectively ... mRNA The molecular mechanism underlying XRbm9-dependent translational activation is unclear and awaits further investigations The subcellular localization of mammalian Rbm9 is unclear and is ... suggesting an acceleration of the G2 ⁄ M transition in meiosis I This hastening of maturation was correlated with a precocious synthesis of Mos and AuroraA proteins, and with the activation of the mitogen-activated...
  • 14
  • 502
  • 0
Báo cáo khoa học: The leech product saratin is a potent inhibitor of platelet integrin a2b1 and von Willebrand factor binding to collagen pdf

Báo cáo khoa học: The leech product saratin is a potent inhibitor of platelet integrin a2b1 and von Willebrand factor binding to collagen pdf

Báo cáo khoa học

... adhesion and activation Three such molecules, LAPP (an approximately 13 kDa leech antiplatelet protein isolated from Haementeria of cinalis) and calin and saratin (approximately 65 kDa and 12 kDa proteins, ... alimentary habit of hematophagy The presence of anticoagulants in the salivary glands of the leech, Hirudo medicinalis, was originally discovered by Haycraft in 1884 and led to the isolation of hirudin, ... significant implications for the use of saratin as a tool to inhibit platelet–collagen interactions, and may provide the basis for the therapeutic use of saratin as a potent antithrombotic agent...
  • 11
  • 440
  • 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học

... within the 56-amino-acid MADS box at their N-termini and within an adjacent 29-amino-acid region referred to as the MEF2 domain The MADS box is essential for DNA binding and dimerization, and the ... throughout the brain lobes and at the midline in the subesophageal ganglion (SG) (Fig 1A) The axons emanating from the somata of the two pairs of lateral cells extend towards the pars intercerebral with ... gene The axon emanating from the somata (light blue arrowheads and enlarged image shown in E) runs towards the midline of the brain with some arborization (boxed area in A) , contralateral after...
  • 10
  • 437
  • 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

Báo cáo khoa học

... stimulation of glycogen synthesis by inactivation of phosphorylase is associated with both activation and translocation of glycogen synthase, and that the former mechanism alone cannot explain the ... phosphatase This reverses the inhibition of synthase phosphatase by phosphorylase a There is a long-standing debate as to whether inactivation of phosphorylase is a component of the mechanism by ... GSK-3 inhibitors indicates that insulin activates glycogen synthase by mechanisms additional to inactivation of GSK-3 This can be explained, at least in part, by the inactivation of phosphorylase...
  • 9
  • 381
  • 0
the nothing that is, a natural history of zero - robert kaplan

the nothing that is, a natural history of zero - robert kaplan

Vật lý

... karikara, vivara, achobya, vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that's 1031), and so through the alluring samaptalambha (1037) and the tongue-twisting visandjnagati ... in endless space; and each Indra lives 71 eons, and the lives of 28 Indras are a day and a night in the life of Brahma, which is made up of 108 years of such days and nights; and before and after ... ever further from individuals and instances, lunging always toward generalities and abbreviating the singularity of things to an Escher array, an orchard seen from the air rather than this gnarled...
  • 238
  • 5,165
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx

Điện - Điện tử

... participated in the design of the study and performed the statistical analysis YD, MAH, CM conceived of the study, and participated in its design and coordination and helped to draft the manuscript All authors ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi ... the vendor The majority of the cell lines were used within months of acquisition and no re-authentication was performed For the DSMZ cell bank STR DNA typing is performed for authentication and...
  • 10
  • 618
  • 0
o cáo hóa học:

o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt

Hóa học - Dầu khí

... participated in the design of the study and performed the statistical analysis YD, MAH, CM conceived of the study, and participated in its design and coordination and helped to draft the manuscript All authors ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi ... the vendor The majority of the cell lines were used within months of acquisition and no re-authentication was performed For the DSMZ cell bank STR DNA typing is performed for authentication and...
  • 10
  • 665
  • 0
Báo cáo y học:

Báo cáo y học: "The P2X7 receptor is a candidate product of murine and human lupus susceptibility loci: a hypothesis and comparison of murine allelic products" potx

Báo cáo khoa học

... alleles We also show that current genetic mapping indicates that the P2RX7 gene is located within the region defined as lbw3 and is a therefore a strong candidate for being the product of this ... PS and associated proteins are major targets of autoantibodies in SLE [8], cells stimulated via the P2X7 receptor may be a significant source of autoantigen in this disease An allelic variation ... to the design of experiments and drafting of the manuscript All authors read and approved the final manuscript Acknowledgements This work was supported by the Medical Research Council of Great...
  • 8
  • 429
  • 0
báo cáo khoa học:

báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx

Báo cáo khoa học

... NRP -A and NRP-B, an ubiquitin-associated (UBA) protein homolog and NAC (NAM, ATAF1, ATAF2 and CUC2) domaincontaining proteins NAC proteins are plant specific transcriptional factors that are involved ... activate an osmotic- and ER-stress integrating pathway, also called the integrated pathway The enhanced accumulation of membrane-associated NRPs activates a cascade to induce the expression of ... Federal de Viçosa, 36570.000, Viçosa, Minas Gerais, Brazil Authors’ contributions JAQA carried out the experiments, the statistical analysis of the data and drafted the manuscript MTBR and PABR assisted...
  • 14
  • 254
  • 0
Báo cáo y học:

Báo cáo y học: " Peptide P5 (residues 628–683), comprising the entire membrane proximal region of HIV-1 gp41 and its calcium-binding site, is a potent inhibitor of HIV-1 infection" pptx

Báo cáo khoa học

... biophysical studies and neutralization assays, and drafted the manuscript DT participated to the neutralization and binding assays AA participated in the design of the study and writing of the manuscript ... explain how P5 exhibited an antiviral activity against the T20-resistant viruses ENF-1 and that lack this GIV motif P5 also comprises a lipid-binding domain (666–673) essential for maintaining the ... HIV-1HXB2 The N-ter of T20 (aa 638) located within the calcium-binding site and that of P1 (a. a 649) are indicated (grey arrow head) The calcium-binding site in P5 and P5 (L) are underlined Chemically...
  • 12
  • 304
  • 0
Báo cáo y học:

Báo cáo y học: "Shuffling of cis-regulatory elements is a pervasive feature of the vertebrate lineage" ppsx

Báo cáo khoa học

... T-AGCCGTGTGCTATGTGAAAGATGGCAG-GCTTAAAAAAT human TCAGCCATGTGCTATGTGAAAGATGGCAGGCTTAAAAAAAT rat T-AGCCATGTGCTGTCTGAAGGATGGCAG-GCTTAAAAAAT dog TCAGCCATGTGCTGTGTGAAAGATGGCAGGCT-TAAAAAAT fugu TTAGCCATGT ... TGGTTCAGCCAGACTCTCTGGCTCAGATACACTAAGGGGT TGGTTCAGCCAGACTCTCTGGCTCAGATACACTAACTGCT TGGTTCAGCCAGACTCTCTGACTCAGATACACTAAGGGGT TGGCTCAGCCAGACTCTCTGGCTCACATACACTAACTGGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT ... TTAGCCATGT CATGATAAAGATAGCAC-CTATATTTGAT TTAGCTGTGT CATGATAAAGATAGCAC-CTATATTTGAT tetr danio TTAATCTGGTGCTTTGTGCAGTAAAACAG-TTCTACAGAAT refereed research fugu deposited research 5‘ SCE Rat Dog...
  • 19
  • 510
  • 0
Báo cáo y học:

Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf

Báo cáo khoa học

... stable cell lines, and performed luciferase and β-galactosidase assays AS, SW, and NC performed western blots All authors read and approved the final manuscript RNA purification and qRT-PCR analyses ... Additional data files 13 The following additional data are available with the online version of this paper Additional data file is a table listing the G1/S associated mRNAs predicted to be targets ... standard deviations away from what was seen for random sampling of similar sized sets of targets The complete list of G1/S-phase related predictions is detailed in Additional data file This analysis...
  • 14
  • 331
  • 0
The small GTPASE   ARF like protein 1 (ARL1) is a new regulator of golgi structure and function

The small GTPASE ARF like protein 1 (ARL1) is a new regulator of golgi structure and function

Cao đẳng - Đại học

... superfamily small G protein Ras Rho ARF ClassI:ARF1, ARF2, ARF3 ClassII: ARF4, ARF5 Rab ARF Arl Arl1, Arl2, Arl3, Arl4, Arl5, Arl6, Arl7, ARFRP1, ARD1 ClassIII: ARF6 Fig Classification of mammalian ... understanding of the cell 1.2 ARF family GTPases and their classification The small GTPases of ARF family are classified into the Sar, ARF and Arl subfamilies The Sar subfamily consists of only ... divergences of the mammalian ARF and Arl subfamily of small GTPases The alignment was assembled by clustal W method using DNA Star software The prefixes “h” and “r” indicate human and rat species...
  • 184
  • 301
  • 0
Báo cáo y học:

Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

Y học thưởng thức

... coefficient and linear regression analysis was performed after logarithmic transformation of Ang-2 values (logAng-2) The primary outcome studied was 30-day survival and was calculated from the day of ... optimal cut-off values Data are displayed as median and range (minimum to maximum) unless otherwise stated All statistical analyses were performed with the SPSS Page of (page number not for citation ... be statistically significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA score and circulating Ang-2 (Table...
  • 9
  • 634
  • 0
Báo cáo y học:

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Y học thưởng thức

... work KA and IK drafted the manuscript and participated in the acquisition of data and the study design JB participated in the acquisition of data NM helped to draft the manuscript, and participated ... Morocco Acta Anaesthesiol Scand 2007, 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated ... participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of the study AAZ participated in the design of the study, and performed the...
  • 10
  • 597
  • 0
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx

Tài liệu khác

... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... a margin as any candidate in the state’s history (C) having been reelected with as wide a margin as any candidate in the state’s history (D) she was reelected with as wide a margin as any candidate ... as wide of a margin as any candidate in the state’s history (A) she was reelected with as wide of a margin as any candidate in the state’s history (B) she had been reelected with as wide of a...
  • 696
  • 1,001
  • 1
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Báo cáo khoa học

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...
  • 14
  • 517
  • 0
The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx

The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx

Tài chính doanh nghiệp

... ―Mapping Against Standards‖ is the percentage of companies that map against relevant external standards and programs, including AA1000 and the Global Reporting Initiative, as an element in the ... percentage of governance mechanisms in Panel A that a firm has adopted ―High Sustainability‖ is an indicator variable that takes the value of one if a firm is included in the High Sustainability ... percentage of stakeholder engagement mechanisms in Panel A that a firm has adopted ―High Sustainability‖ is an indicator variable that takes the value of one if a firm is included in the High Sustainability...
  • 57
  • 447
  • 0

Xem thêm