... recommendations for tPSA cutoffs and interpretation ofthe fPSA/tPSA ratio The aim of our study was to compare commercially available automated methods for PSA concentrations (total and free) ... PSA is problematic because PSA is really an organ-specific marker for the prostate rather than a specific marker for cancer Controversy exists regarding the medical decision levels for tPSA and ... of calibration against a universal standard In an effort to standardize PSA methods, the World Health Organization (WHO) developed a standard, the WHO (90:10) (National Institute for Biological...
... between an organism’s morphological and functional complexity andthe absolute size of its genome Some invertebrates have a genome size comparable to that of humans [10,11] The well-known example of ... ofthe unicellular Amoeba dubia, with a genome 200 times larger than that of humans [9], demonstrates that mere DNA length does not determine an organism’s complexity The major fraction of an animal ... Jeffares et al [17] have recently reviewed the process of intron gain and loss They and others have demonstrated that intron evolution is not a simple stochastic process, and that a number of...
... both the state ofthe learner’s knowledge andofthe ways in which the second language is being learned “Error” in English language teaching isa mark ofa learner’s transitional competence as distinct ... probably claim that their aim was to learn to speak accurately and fluently at the same time Another consideration when deciding what to correct isthe nature of errors and how ready or capable ... feedback have motivated the present study Of particular relevance is Lyster and Ranta’s (1997) study of corrective feedback and learner uptake and, specifically, their analytical model of error...
... course, the disinflationary impact ofthe Asian crisis ofofthe NRR Hawkesby et al assume that there is no default the late 1990s may counter-balance the impact of these or liquidity premium between ... expand on the above distinction and clarify between actual and potential output is known as the “output alternative concepts ofthe neutral real interest rate We gap” If actual output is greater ... Zealand’s NRR is to take estimates ofthe NRR for Australia andthe United States 23 Table Estimates of New Zealand’s NRR NRR estimate Average NRR estimate Method 1: Estimates based on historical...
... ethics applications; measurement design and development; data collection, data management and analyses; interpretation of results andthe preparation of this thesis This PhD research program andthe ... revised DSM-IV-TR Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, text revision EFA Exploratory factor analysis FA Factor analysis xiv What explains the association between ... Supervisor) and Professor Michael Dunne (Associate Supervisor) at the School of Public Heath, Queensland University of Technology, Australia, andA Professor Vo Van Thang (Associate Supervisor), at...
... to talk about roads and motorways Someone I know took over hours to complete a 25 minute drive, because he didn't know what his sat nav system meant when it said "Take the ramp" Another huge difference ... windscreen zip student moving van eraser garbage knapsack sedan report card Scotch tape stocks free time garters panty hose can candy apple bathroom flashlight pants undershirt rubber boots windshield ... huge difference that causes great confusion is writing the date When you write the date in numbers British and American English differ To write the date 7th of September 2007 a Brit would write...
... even a small persistent imbalance betweenthe rates of synthesis and degradation of proteins is inimical to cellular and organismal life1 Over the past half-century we have learned a great deal about ... explicitly asked This even though in the fullness of time balance betweenthe rates of manufacture and destruction, betweenwhatis made andwhatis broken down occurs andis quantitative whatever the ... as a matter of logic and our understanding of physical and chemical kinetics The principal conclusion to be drawn from this analysis is that through the agency ofmass action andthe conservation...
... of this paper Additional data file shows a comparison ofthe shared interaction ratio for duplicates and random ORF pairs Additional data file shows the semantic distance distributions for each ... maintain the function ofthe ancestral gene Alternatively, when dosage is not advantageous, they may diverge and either (second reason) gain a new function or (third reason) assume part ofthe ... (the fraction of all genes associated with that term) and S(t1, t2) isthe set of all parent terms shared by t1 and t2 For two genes aand b with sets of annotated terms Aand B, we define the...
... student or professor caught plagiarizing might be told to leave and never return Using information from experts is usually OK, as long as where the material came from is identified Any material copied ... Punishments for plagiarism differ in schools A high school student might fail the project A college student might fail the class and be suspended for a year In some colleges and universities, a ... word-for-word is supposed to appear inside quotation marks Where people get in trouble is when they try to claim other people's words as their own IN THE NEWS in VOA Special English was written by Nancy...
... from the global t The constant aisthe ratio of apparent dissociation constants for binding GST-IjBa in the presence and absence of ATP, andthe value ofa indicates whether the binding of one ... GST-IjBa in the presence and app absence of ATP K m isthe apparent dissociation constant for full length GST-IjBa substrate at saturation concentration of 60 lM ATP, andthe dissociation constant ... Immunocytochemical staining of A5 49 cells and analysis ofthe dynamics of NF-jB nuclear translocation (A, B) Doseresponse data from A5 49 stimulated with IL- 1a and xed with formaldehyde (A) and MeOH ...
... 154 C Hoff and S Rambal fall and leaf quantity [33, 43] Important then are the timing of rainfall and drought events, the quantity of rainfall, the storage capacity ofthe soil and quantity and ... relations betweenthe LAI and both climatic and soil factors; (2) understand how the water and carbon balances behave as a function of water availability and LAI; and (3) define how the balance between ... stomata are open Stomata closure limits transpiration, but also limits carbon assimilation Thus, there isa trade-off between water loss and carbon assimilation at the scale ofthe leaf [9, 10] At...
... CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG ... Mutant Primer Sequence (5’- to 3’) 2B4F33 L Sense Antisense Sense Antisense Sense Antisense Sense Antisense CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG ... enhanced apparent affinity ofthe mutant For both substrates, the mutation decreased the Vmax values On the other hand, the Vmax ofthe mutant towards 17-epiestriol was slightly increased and the...
... andthe Medicaid Checklist2 assess how readable and understandable education materials are, and also evaluate how well materials stimulate learning and motivation and whether the materials are ... understandable for patients A few tools are available to measure the readability of materials as well as the health literacy ofthe patients Evaluating the suitability of education materials for the audience1,2 ... Furnas S, and McClellan F Literacy, Health, andthe Law: An Exploration ofthe Law andthe Plight of Marginal Readers within the Health Care System: Advocating for Patients and Providers Health...
... data characterising the situation in some Asian EMEs, namely, Malaysia, South Korea (henceforth Korea) and Thailand, during the Asian crisis (19971998) The Asian crisis is best characterised as ... has taken place alongside adverse shocks to risk premia In the case of Korea and Thailand at the time ofthe Asian crisis, the picture is similar to the case of an adverse risk premium shock alone, ... experience of some Asian EMEs at the time ofthe Asian crisis (1997-1998), that of some Latin American countries at the time ofthe Asian crisis (1997), the Russian default (1998) anda couple of periods...
... imagination, affect, emotion) are involved (exalted) in AE? Whatisthe relationship between AE and evaluation? Whatisthe articulation ofthe natural and cultural bases of AE? Has AE the same ... and multidisciplinary debates Whatis AE for? Is AE an adaptation or a by-product? Whatisthe relationship between AE andthe goal of knowing? Has AE a mental distinctiveness? What mental processes ... conceive ofa neural system in which landscape paintings would not activate the parahippocampal place area and that facial portraits not activate the fusiform face area, parts ofthe brain that respond...
... ofa separate approach is that a clear distinction is drawn between more classic health and life issues and specific safety issues This view only strengthens the argument that the case-law-based ... is coherent in its approach Then logical reasoning disappears andthe Grand Chamber defers to the Italian arguments wholesale, almost giving the appearance ofa compromise; the rejection ofthe ... turn, affects the access of that product to the market of that Member State[,]” is also found in paragraph 56 of Commission v Italy, in paragraph 57 the Grand Chamber made it clear that the measure...
... size statistic relates change over time to the standard deviation of baseline scores The standardised response mean compares change to the standard deviation of change The responsiveness statistic ... practice The interpretation of HRQoL scores raises many issues [1–7] The scales and instruments used may be unfamiliar to many clinicians and patients, who may be uncertain ofthe meaning ofthe ... an HRQoL measure and an independent measure (or anchor) to elucidate the meaning ofa particular degree of change Thus anchor-based approaches require an independent standard or anchor that is...
... Recruitment and training Staff training is an integral part ofthe overall development strategy ofthe business Staff are not trained or not trained fit isthe main cause leading to the current state ... Good organization • • A manager must be able to plan, direct, coordinate, and organize through out the day 1 Good organization Summary, organization is an important management quality because keeping ... There are many kinds of conflict, a good manager isa person who can aware what are the best ways to resolve conflicts logically Resolving conflict may include: listen for whatis felt as well as...
... OA were imaged on at least one occasion, and 123 were imaged on at least two occasions The mean age of healthy participants was 56.1 years (standard deviation [SD] 7.3) The mean age of OA participants ... drafting and revision All authors read and approved the final manuscript Acknowledgements This study was supported by the National Health and Medical Research Council (NHMRC) (Australia) andthe ... formal plans to deal with the ongoing management of these incidental lesions at many levels, incorporating clinical, ethical, and financial aspects Whilst, based on these data, the prevalence of...